Spermophilus_tridecemlineatus Locus Mono:39:SNORA42
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:39:SNORA42
Spermophilus_tridecemlineatus
Mono:39:SNORA42
scaffold_147610
SNORA42
1001..1110
2110
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTAGAGTAATTGCTAAATAAACCTTCA
TGAAGACCAAACAGGACCATAGAAACCTATGCCTAGCAGCAGAATATCTGGACACAAATT
ACTAAAAAAAAAATAGCTATTTTGAACTGATAATTGAACTACCTGACATAGTGATTGAGT
TTTAGGGCTCAAGTGTGTGAGTATACTTGTATCTATAAATATGGGTAAATTTAAACTATT
ATAATTATTATGTGATGGCAAATTTCATTCATACTTCTTATGAATCTTCTGGTGGATTTT
AAAAACGCCATGGTCACAATGCTTTAGATACTGTCAAATGTAAAGATATATTTTAGATGG
TTTAATATTTGGCTTCATTTCAGATTAAAAAAAAAAAAATTGAATGGCAGGCCTGTTCCC
CTGGGTGTCCCATGCCACAGCAAACTGTGGCCCTGAATAGTTGCCTGGCCTCTGCCTGTA
GGATGCTGGCACTGAAGTGGGTTGCACAGTGGAAAAACTATTATAATATTTCTTTTGAAC
TGATTTCTTGGAGATGATGGCCACTCAAGCAAGGGAATTTATTTAAGCAATTGTTCAAAT
AATTAATTTTGAATTTAAGTCCTCGACTAAGTATGGTGAAGTAGCATCCAATTGCATTAT
AACAGCTCTACAGGAAATGTGGAGTCCTATGTTATTCCACATGGTATTATTTATTCTTTT
GATAGCTATTTCTGTTATTCTAATTGTTTTGCTGATATAGGTGGGAGAGATTATCTTGAC
TAGGGTTTGGGTGTTGACTGCTATCATTAGAGGGTTTTTCCTTAAGGTGCAGGACTTCAA
GGTGACTTATGCACCTTTTTGTCTTAGGAATGAGGGTTTCCCATTTGTGTTCTTCCCATC
TGTGTTCTAGCTGCTGCTTCTGAACAGGAGAGACATATACGAGTTTCTTTATCTCACTGA
CTCCAGCTCCACACCTTCAGAGAAACTTGGCAGTCACACTGAATTGACTCCTCCAGCCAC
GTCAGTACTTTCTGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCAC
ATGCATTTCTGGTGTTCTTCCAATTTCTTGGAAGACCTCCGGCACATGGGGACTAGGCCT
TCCCCCTTCAAACAATAAATTGCCTCTTTAAATGGAAGACATGTTGGATTAGGGGTTTAA
ACATAGGAATTTGGGGGAGGACACAAATTCAGTCCCTAATAGGTCCCAATGTTCACAATT
ATCCATATCTATCCAGGTACTTTGGGATGTCCAAAGGGTACAGTCAGAAAATTGGTTTAC
TTGATTCTCAATGAATAACGATTTCTGCAAGTACTTGCAAGAAATCCATCTGTCCAAATC
CTTCTCCAAGAATTTCTAGTCATCCCGTATTTAACAAATTAAATATCAATATTAATTGCC
AGGATATCCAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved