Spermophilus_tridecemlineatus Locus Mono:55:SNORA72
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:55:SNORA72
Spermophilus_tridecemlineatus
Mono:55:SNORA72
scaffold_118361
SNORA72
1001..1132
2132
TCTCCTCCTTTCAGACCCAGTTCAATTGTTACCTTCTTGGTTGGAAGCTGTGTGTTGTC
ACTTATCCTAGGATTTTTAAAGATAGTGTTTACTATGTCTGTTTTTCCATGAGCTTGTGA
ACTTCTAGAAATGGATGTTTTGCAAGTGTAAAGAGATGCTATGGTAATATTTTTGTGAAG
TGTGTAATGGTTAATTAAAATGAACCATTCAAAGCATGGGGCCTTGAAGAACTTTGAAAA
GAATCCATAAAAGAACAGGGCTCTTGGGGCTGGGGATACAGCTCAGTTGGTAAAGTGCTT
GCCTTGCCTGCACAAAGCCCTGGGTTCAATCCCCAGCAACACACACACACACACACACAC
ACACACACACACACACACACACGAACAGGGCTCTTCATAATATAAACAGACAAAATCTAA
GAAGAGACAGGTTTGAGTTCAACAAAATTATGAAGAGTGAATAAGATAGATAAGGAAAAC
TTTACCTATTAAATGATATACTCAGTACACAGTAAATGTCTCTTACGTGTCAGGTGCTCT
GAATACAAGGGCAAACAAACGCTGCCTCATGGGTGTTTGCCTGTTCTTGCAAGTGCAGTA
GATAGAAAGTCTTTGCTTTAAAAGTTTTAAGTAAGGGAATGAAATGATCTGATTGACATT
TTGGGAGGTCATCCTGGCTTTTCTGAGAACAGACAAGCACATATAAGGGGCCACTGGTTG
GGAAGCCATTGCATTAGATGAGATGACAAATAAAACTGATCTCCTGATCAGAATCACCTG
GAAGGCTATTAAAACACAGATACATGAACCCCACCCCTCCAGTTTCTGATTTTATAGGTC
TGGTGGTGATGTAAGTGGGAGGAGTGGAAAATTTGTCACCCAACAAGTGCCCAGAGGGTG
GAGCTGATGCTGCTGATCCTGGAACCCCACTCAGCCCCCTGACCTCTACTGGGTGAGAGC
AACGAAGCTGGGATGAAGGGCACCAGCTTCGGCTAACCTGGAAGTCAGATTAGAAAGACA
GGTGGCACTGTCATTATCAGGACAGGCTGAATATTCACTATAGAAAGACTATGCATGTGT
CCCCAGACCTATTTCTTTCTCCAGGTCTGATTTTATAAATGCCTGTGATAAACCAGATCT
GATTTATTATATGCTCCTTTTGTGTGATCATATAATGGCTACAATTCTAGGTTATCTTTG
ATCAACCTTTAAAATTACACTAGAACAGCTAGTGGAATAACTTGCAAATAATCAGTGCTG
AGATTTGTCTAAAGAAAGTGTAACCAAAACAGGGGAGTTTTGTGACTACCAGTTGCCATT
AAATGTATTGTAAAATTACTGTTTTATTTTTTAAAACAATAAAAGATGTGTGACATATAT
AACCAGAATATATTAGGAGAAAGAGCATCCCTACAATACTGATCAGAATTTTCTTTTTCT
CAAAAAAGAAAAACCATGAGGAAAGTCTGATCAAAAAAGGAGTATATGAAACTTGAATGA
GATTAAAAAGACAAAGGAAACTAAAGGAGCCCCTTTCACATCAGAGGTAATAAATGTATG
GGCATCATGTACCCTCCTCCTCACACTTACAAGTGAAAACAAGATTTTTTTCCAAACCGA
AGTAATTCTGTGTCCTATGAACAGAAGTGTAGCTCCTAAAATTTGGTATCTTGTGAATGG
CTATATAAGAGAAAGTAACTATACTTTTGCATTGTTAGACTCTTGGGGTTTCAGATGAAA
AGAGAAATTGGATAAACAGACCCTGGATATAATCCAGTGTCAGTCAGTTTTGCATCACTG
TGACCAACGTACCCAACAAGAACCACTTAGAGGAGAAAAAGTTAATTTTGCCTCATGATT
TCAGAGCTTCAGTCCATGGCCAGCCAAATAGCCTGCTTTGAGCCTAAGGTGAGGCAGAAC
ATCGTGGCTCAAGGGTGTGGAAGAGGAAAGCAAAGGTGTGGTAGATGAAAGTCCCATCAT
GACAGATGGGAGGCAAAGAGAGCTCGAGTGCAAGGATCCAAGGATAATATAATCCCCAAG
GGAACACACCCAGTGACCCAATTCCTCCAGCTACACCCTATCTACAGTTACCACCCATTA
ATTTATTCAAATTTTTAATCCATCGAAAGGACT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved