Spermophilus_tridecemlineatus Locus Mono:122:SNORA26
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:122:SNORA26
Spermophilus_tridecemlineatus
Mono:122:SNORA26
GeneScaffold_4404
SNORA26
1001..1122
2122
ATCTACTCAGATTATACTGTGGCTGTTTTATGTCAACATTATATGTTTTACTGATGTTT
AGGAGTGTTCTAATACTAATTTGGCATAATTTTTTTCTTAAGCACCTACTTTATAATAGC
ATATTGAAATCACTGAAATACTTGCTTTTTGAGATTTGGCTCTTTGAAACTTGCAGGAGC
ACACCTCCTTCTTCTGCTTGGCATCTCTAAAGATAGATCTTCTAAGTCATTTTTAGATTT
AGCAGTGTTACTTGAAACAAAACTGGTATTTGTCAAGTCCTGTAATGTTCTGCTACCTGC
AAAGAACATTATTTTCACAAATATTTGTAAAATTGTACACAGAGTTATAGAAATAGAAAT
GGGATATATGGCAATTTGCAAATCCATGGCAGGAATTTTAAACCTGATGATTCAATTTTG
AGAGTAAAAGAGGCCTAAAATTGGAAACAAATTATCAAAAAAAGCCTGCAGCATTTTTAT
TATAAAATCACATACAAAGCAGCCAGGTGTGGTAGCACATGCCTGTAATTTCAGCTACTC
AGGAGGCTAAGGCAGGAGGATTACAAGGTCAAACCCAGCTTCAGTAATTTAGCGAGACCT
TGTCTCTAATAAAATTTTAAAAAGGGCTGGGCTGGAGCTGTGGCACCCCTGGGTTTGATC
CCTGGTACCAAAAAAAAAGAAAAAAAAAAAAGAAGAAGTCATATACCAAAAATTCTTCAT
GGTTCAACTCTTCACAGAAACACAAATTTCTGCACATTCATTCGACATAGATGTCACTAT
TGCTCACTGTGAAAGGCACTATGAGGAACAGAGGGATGAGAGGTTGTTCCCCAGTCCTGA
AATATATTCTATAACTCTAGACTTTGTACTTCTTTTTCTTCAGGTGGCTTTTACCTGAAC
ATCCTTATCCATATCAAAATCCTAGTGTTCTACATAAGTTTTGAAATGTTACTTCCCAGT
AGAAAAAATTCAATTGATATGAGAATGTATCACCCTTACCTGTGCCTTTTTAAGGTTGAC
GCAGTGCTTTAAGAAGCTAACACAGAAGGGTAAAGCAAACCTCCATAGAACCCAGAGAAG
AGATTGCAAAACTCTTCTTTGGATCCTGCCTGGAGTTACCAATGAAAAAAAAAGAAAAAA
ATATGGGAATGTCTAATGTTACAAAATTCTAATAACAAAGGAATATCCTTAGGATTCAAT
GTTAATGAAAAAAGTGGGATAAGTAAAATCAAATATAGTATTATTTCAAATATGTATTTT
AAAATCTGCAGATTCAAGTTTTCAAGCATATGGCAAAATGTTGACTGCCATTTTTTATTT
GATTTGATTTTTTATACCAAGGATTGAACCCAGGGGAACTTAACCACTGAGCCACATCAC
CTTTTTATGATTTTTTGTTTGTTTGTTTTGTTTTGTTTTGGGTCTCACTAAGTTGCCTAT
GACTTCACTAATTTGCTGAGGCTGACTTATGAACTTGCAATCATCCTGCCTCGCCTCCGG
AATTGCTAGCTCAGCTTACTGCCATTTTTCTGGGTGACTTTTTTCCTGGTTTTCTACTTC
ATTATTTGAATAACTGGGGAAAGAAAAAACACTAAAAGAGTAAAAATCTTACCTATGCTG
ATTACTTAATAATGTCTTTGCAAATTCCTCTAATTGAAATTTCCCCTCATTATATCCTCT
AGCATAATTTACCTGCTTTTATTAGAAGATTTTTATTTCACCATTGTATTTTTTTTTTTT
TTTTACTTTCACATGCATTATGTTCTAAGGAAAGGATGCTGGTCTTACTTTTCAGTCCTT
GACAGCACCTAGAATAATTCTTAGATCACACGCTGTTGAATGAAGAGTTGCACTCTTAAG
AAACTTGTAATAGTCTTTGGCTATTATAAGTAGCCAAATAATAAAACCAATGCCATTCCT
TATAATATACATTTAAAACACTCAATTTCCTTCAAACACATGAAAAAGGAAATTTTCTAT
CTAAAGCTACTAATAGATAACTTTGTGATAAAGACCAAATCGCATTTAAGGTTGTAAATG
TCCCTGACAATACTGTTATCTTCTCAAAGCACTAGAATTTAATTCGTTTAAGCTACACAG
TTATATACTGTTTTAAAATTCAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved