Spermophilus_tridecemlineatus Locus Mono:61:SNORD56
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:61:SNORD56
Spermophilus_tridecemlineatus
Mono:61:SNORD56
scaffold_117360
SNORD56
1001..1072
2072
ATAATACTTGGAAATGGAGCAAGCAATATTATGTGCATTTATGAATAAGTCAAACCCCC
ATATTATGTGAACATTGCACTAATAAAAATATAAATAAAATGGTACTATTAACAAATTAC
ATTAGGTCTTAAAAGAGAAAATATAAGATGTTCAGTAAATATTGTATAATATTTTCTCAG
TACTTAAACTGTGTTTAGTATAGGCTTTCCAGCTGTCCTCAGCAACTGAAAAAAAAAGAA
GTTAAATATATATGATTAATATTTTTAGATCAAACTTGCACATATTAATGCAATTAAAAT
TACTGTTTTGATATCATCTATAAATTCTATATAGAAATAGTTTCAGAAAAACTCTACAGA
GTGTAGAGAGAATGCTCAGATTAATTTGCATTGATTTCATGGGTCTATTATTCATGTATC
TCTGTATATTTATACATACTCTTTCCTTTCCATTACCTCCTCTCCAGTCAGTGTTTTCTG
GTACAAGAACAATTCAAGACTGTTATCTCGATTTCCTAAAGAAACCACCTTTCTCTATGT
TAGAAATAAGAGTAATAACTCGCACAAAAAGCATTCTTGCTGACACTGTCATTTATACTA
CCAATAGAAAACACACTCTTAGATCTGAGATATTTCCTTTTGAATGAGTTTATCAGTCTT
TTATAAACTGGGCTCCTCACAGGAAATATCAAAATAGCTCCCCATACAATACTAAAATAT
GCATTTAGAACTGTAGAAAAATATTTCTAGAAATTTCAGAAGAGTATTTTTTTGTTGTTG
TTTTACTTTTTCCAACTACCTTAATTTCAAAAATAAAAAATTTGGAATTATGCTATTTGG
GAATTCAAGGAATGCAATGGGTTTTATATAGTCATAGCTGAATCAAGAATTCAAATAATG
TCATCGGGTAAGGGACTCTTCTCCGTTTCTCTTGGCCCATATGCTCTTTTGGGTTAATTC
TCAAAATCCCTGTTCTCATATGTTGGCAAGATAACCCCCAACTACAATGATAGTTAATAT
TTTCCATCAGTAGCAATTCACCTAGTGAGTGTTGATACCTGACCTGTGGTTAACGACCAT
GCCACGGCTCCCAGATGGCCGAGTGCCCGTCCTTCAGCTCCACAGTTCTCACGACAGGTC
CTGAGGCAGGCAGGCAGGCAGGCAGGCAGGCGGGGATGGGGAGGTGTGCCAGGAAATCTC
CGCCCTCGCACAGAACCGGTTGTTAATGTTTACCAGCACACCACTGTACCAACAGGGGAC
CCTGACATTGAGGCATCAGAGGACCCTCCCCTGAATCTGAGTGGAAAAAAAAAAAAAAAA
AAACCCTGAAGAGTTACAGGATTACAACACCTTTATAGCTAGTAATCCTGGTAAAAATAA
TACCTTCCTTGTTCTTAATATTCCCAGAAATAACATTCATTGATTTAACATCAGTGCTAT
ATATCAACTACTGAATGCAAGAAGTAGAATACACTGACTGTCCAAAATTAGGTCATGTGT
CCATTATTTTCAGTCTACTGTGGAGGTAAATGGACTGAGTCCAACTTGAAATGAAAAGGT
TGAGGCTCCAGAAAAGGTAGTAACACAGAAAAGTAATACATAGAAAATAGAAAAATGAGT
GAATGTTTCTAAGAAAGTTAAAAAATTAGTATTTTCTGACTGAAATATCAAAAATTATAT
AATATGATATGCATCATATTTTTTCTTATTCCACCATGGAGACATATGATTGATGATTTT
GAAGTACTAAGAATAAAGTTGCTAGAACACATAGCAAGTAAATGCTTAACTCCAAAATAC
CTGCCAAACTGCTTTCCCAAGTCATTGTGAAATTTTACTTTCCCATATTAATGAATTTGA
GTTCCGATTACATTATAATGTAGCCAAAATATAGTGATGTAATTTAAAAAAAATAGTTTT
CTACTAAACATAAGATAATTTTCAAAGTATCTTTACCTATGATGATGTTGAGAATCTTGT
GGTGTGCATAAGGATACACATACACCAATATTCTTTTGTAAAGTAATTAACTATTTTAGA
CTGCTACTGTTCACTATTTTTTAATTGTTTAGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved