Spermophilus_tridecemlineatus Locus Poly:1:SNORD115
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Poly:1:SNORD115
Spermophilus_tridecemlineatus
Poly:1:SNORD115
scaffold_112033
SNORD115, SNORD115, SNORD115
1001..1080, 4696..4775, 6654..6729
7729
GGAAACTTCTAGAGTGCCAGGGCATCCAGGAAGCACAGCATGGTAGCAGTCAAGGATGA
TGAGGGGGCTCAGGGACTGCTGAACATGCAGGGGACCTAGCTTGGACTCCTGTATCCTCT
CCATGTCTTCCTTCAAGCCTGCCTTTGTTTAGAGCCTTATCACTGGCATTTCTGGGTGCC
AGGGCATTATTCTAAGGGTACCCCAGGAAGGTGTGTGGTCAAAAGTCTCCCAGAAAAAGG
GACTGTTGTTCTTTGGAAACCCAAGCTCAACTCCAGACTGAAAGAATGGGGCCCAGGGGA
AGGGTTTAGCTTCCTGGTGGGCTTCCATTGACATAGGGTCTGGGCCTGGGGCCAGGGAGC
AACACACTGTGGGGCTGTACCAAGGAAGGAAGTGGCTCCAGGTTATGCAGTTCAGTGTTC
TTGGGACTGTGGCAGAAGAGGTGTCTTTTTGGACCCATGCACTCAAGGGAAGGATGCGTG
ATTCTCCCACATGCTGGCCAATGCACAAAGACTCCTGTAAGGGCAGCTTGATGGTAAGTG
TGCCTTGGGCCCAGAGCCTAGTCTAGCTATCAGACCCTGCTGGGACTCCTTGATACAGGA
GGGGGCAGTGGAATGCTGAATCCATGGGGTCATAGGCATCTCATCCTGCCCCTTGTTCCC
AGAGACCCACAAGTGCACTTGCAGGGGGCTTACAGGACTGGTGGTCACAGCTGCAGATAG
GGGTCACCTTTGGGGATGGAACACTGGGGTCCATATAGGAAATGACTGTGTGAGCCTGCC
CCAAGGCTGGCATCCTTCCCCCTCCTCAGCTGTTTTCCTCTTTCCATCCAGGTCATGCTC
CCGACAGAAATAACGCCTTGATCCTCCTGGCAGCAGCCTAGCCCTGACTTTGCCAATCCT
CAAGGCCCCTTAGCACACTGACCTGGCGTATCCATCTTGGTAAGCCAATCCAGGTGCCAG
TGCCAGTGAGAAGATGTATGGGGAGAGGACCATCTAGGTTTGGGTTGATGATTATAACTT
TATTGTCTTGAAAAGAGATGAAGACATAAAAATCATGCTCAATAGGATTATGATGAAGCC
CAGGCTAGGGGACATTGGTGGAGAAGGATCTGGGTATTCCTATGTCCCTCTTAAAGAGAG
TGGTCACAATGGGGGCCATACACCTGAAGGCCCCACCAGGCATCCCAGGAGGCCCAAGCC
TTTGGAAGTGCTTCTCAGTCAGGCCCCAAAACTCCATACTCAGAATGTGGGCACTGGCTA
CTCTGGGCACATGACAAGTTCCAGAGCCAAGCTTTTGCTCAGCTCCTTTGTCCTCCTTTT
CCCTTCCAGTGACAGAAGCAAAGCAGATGGATGCCTCTGACAGGCCAGGCACAGGTGAGC
AGATGGCCAGGGTCATGGGGCTATATTGCTGCTGCTAGGAGGAATGAAGTGTGAAGCCTG
GGTCAAAATTGGTGGAGGCCTTTACCATGGCCACTGGCTACCCTGAGATGCCTTGTCCAG
GAGGGTTGCCATTTGGGGATTTCCCTGCTAAAGGTCACTTTCTCTTCTTGACCCTTCATG
GTGATGGGGCAGAGGCTAATCATAGATGTTGATGTGAAGGGATGGACAAGTATGTTCCCA
ATCAGGCAACTGCAGTCACTGGGCCAGAGGAGGGACTTGTTGGCTACAGGTCACTGCCAC
TAGTTTCATGGCAGCAGTATGTGCCTATGGGGCATCTGTCCCTGGGGGCTGGGAGGATAA
AGGCATGAATGAACTTACCCCTGATCAGAGGGACTGGGCAAATTCTGGAGTGCCAGGCAT
CCAGGGGGGGCATGCATGATAATGGGCAGGGATGATGAGGGGTGGGGTAAAGGGCATGGT
CTGTATTCAATTTATGGGTACAGGAGGAGGTTTAGAGAGATTCCATGGGTTGTAGTACAG
AGGCACATGTGGGTGTTTGGCTGTGGTCATGTGCCTTGAGTACTTTTGCTGATAGCATGG
AAACATGAGCCCAGCAGCAATTGTTAAGTGTTCAGCTGCAGCCAATTGCCCTCTTTGATC
TCTTATTTGAAGTTCAAGTTAGATCTTTTGTCAAGGTTTTTCCTGTCTTTCTTTCTGTGC
ATGTGTTGTGTTGTTATTGGTTTTTTTCCCCTTTATATGTGCATTCTTACTGTCATACTT
TGTGTAGGATGTGTCTCCCAATATCTCTTTTTTAATGGTGGAATATTTGGAGGTCTTTTG
TTTTATATTTGAGTGACATAAAGTCATCAGTTCTTTCTAGTCTTTTTTAAATAATATATT
TTAAATTTTTTAAAATTGTATATGAACACAATATCTTCACTTTTATTTATTTTTGTGTGG
TGCTGGGGATCGAACCCAGAGCCTCACACGTGCAAGGCAAGTGCTCTATCACTGAGCTCT
AGCCCCAGCCCCAAAATATTTATTTTTTTGCTATAGGGGGACACAATATCCTTATTTTAT
TTTTATATGGTGCTGAGGATTGAACCCAGTACCTCATTCATGCTAGGTGAGTGCTCTGCC
TCCGAATCACAACCCCAGCCCCAGTTCTTCCTAGTCTTAATGGTTTGATTGGATTGTAAC
TGTACCTAATTGAAATGTTCCTACAAGAAGTAGATTATTAGTTGTCTTCCCTGTAAGTGC
TCATCTTCCTTATATATCTTTTTCTTTTTCCTTCTCTCCTTGATGCCTGGCTGCCATAAT
GGATGTTTACTCATCCAGCTTGCCCTTCTACAGTCAAATTCTTCCTTACCTGTAACTACA
TTTAATGGACTGTTTTATCCTTGGAGTGATTATCTGAACTGTGAGTACTAAAAATTTCCC
TCCTCTATGTTGCTCTTGACAGGTTTTTTTTTTTTTTACAGTGACCCAAATCTGATTAAT
ACAAAAATTGGTACCAAGAAGTTGGGTCCCTGTTGTAACTAACCTGACCATACAGTTCAC
AATCCTTTGGAGTCAGTTTGCAGAGGAATTTAAAAGGTTTGGAGATAAAGCCTGTAGAAG
GTCTCATACATTTTATGAATAGCCTAAAAGGTGACTCATTTTGGCTCAGAATACCAGAAT
TCTGATAGAAATGTTACCTGTGTTCATAAGGTTTCATCAGGAAAGGGAAACTTGGTTGGG
ACTAAATAAAGGCCATTCATGTTATATCTGGCAAAAAAAAAAAAACTTACCTATAGTTTA
CCCGTGTCTTGAGATGTTGTTTGAGCCTGAATTTAAAGATGATGAACAAATTACTTTATG
TTACTGACAACATTTTAACCAGGTTTACTGTGAGTTTCCAGGGCAGAACATAGAAATGCA
AGATTGTAAAAACTTGAGTTTAGCTAGAAAAGTTTGTACAAAACTGAGGCCAAGGAAGAT
GTGGTTGTTAAAGTGATCACAGCCAATAAATATTTGCTAATTACTTTACACAGAGAAAAT
AGGAAGATGCCTTGACAGCATCTCAGTAATTTGTAAGACCATATCTATTGCAGGTTCAAG
AGTCTTGAAAGAAAAATTCCTAGGAGAATAGATTATGGAAGTGCCCTGCTTTTACCAAGG
GGCCTAGAAAGTTTTTCATCCAGTATATTGAGCTGCCCAGGCACCAAGAAGCTACTGTGG
CTGTGATTCTAGGTGGCCCAGATATTGCATGAGTCGGCAGTAGACTTTGGCATAATCCAC
ATGGTTTTGGTTCTTCAGGTGTGCAGAATGCTGGAATTAAGGTGTTGTGGGAGCTACCAT
TGATATTTCAAAGGAAGTCTTGTAAGGCCAGGCAAAGTGTAACAGGATCAGAGTCCCTGC
AGGCTGCAGGGGAGAAAGTGATGGGTGAAGCTATAAAGTCAAAGTTTGAATGGATACCCA
GGAATTAAGAGATGCCAGTAACAAGGACAGACCATCTGCTAAGGAAAGCTTCTGACTGTG
GAGGAAGCCAGGCTAAAAGAGAGTCTATGTGCATGCTGTAATTAGCAATGTCAAAACAGC
CAGGAGCCCTTGCTCTGCTGGAGTTCTTTAGAGAGCACATCTCACAGCTATGTGTCCTAG
AGGAATTTAGGTGGAGTTGCACTACCTTTTTGCCTGGCTGGGTTTCAGTCNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATGCATTTGCATGTGTGGTGACATGACT
TTGAGGACCAAGTATGAAATGTTATGCTTCGACATGAGATCACTGATAATTCCCATGAAT
GTAGGACTATGGTAATGGAGGAGATCCAGTATGCCTATGAAACTAAAATTTAATAATTGA
TGACCAAAACAATGCCAAATTTTCAGCTCCTGAGTATCATGAGACATTATTATTTTCAGA
ATAATGAAGGAACATGTTAAAAATGATGACAGTTGTTTCTAATATGAAAATGATGCTGAC
CAGATCTCCAATTCATGAGTTCATTATTGGTTCTCCTCAATGCTTAATTGGCGTGGTTGA
TGGTATCTTCACTTCTCACTGAAATTTTCAGTCCTATTGCTGTTTACCCATTCTTGTCCT
CCTAGATAAGGACTACTGAGTAAGAACCTGCTTTGTCAACTCCTGCCACTCAGGTATGCT
GCAGTGAATCTAATGAGTCTCCTGTCCCTTTGAACCATGGTTTCAGGATGCCATTCTGGT
AGGTGTTTACAAAGCAAAGTGGATATATGTGTAGAGAATATCTTAAGGAGACATGATAAT
GTAAAAATCATGCTCAATGGGACTATGCTAAGGCTCAAAATAGGCAAAAATCCTGGCAAC
AAGGTGTAAGAAGTAATTAGATTTGCAGAGGGGTATTCATTTCAGGATAAGAATGAAGAA
ACTTTGAAGTGTTATCTTGTTTTACCTGCCTCTCTTTGTTTCATAGAGAATATTCATATT
CCTTTATTCTGATCTTCATATCTTTATTTCTCATAAATTGGATATTTTAGCTTATTTTTC
CTCCTTGTGTGCTTCAGAATGTTCAACCAGAAAAGAAATGCCATTACATGCATTAGATAT
GAATTCTTCCATAGTGGTTAAAGATTAACAGGTAGACTATTTGACTATTGAAGTCTGGCC
TTTGAAATGATTATAGTCAGGCCTTGTGGCACAAGTCTTGTAGTCCTAGCTACTCAGGAG
ACTGAGGCAGGAGAATCACTTGAACTCTGGGCAGAATAACAAGACCCCATCTCTAAAAAA
GAAAGGGGGGGGGAGGGAGAAAGGAATGAAAGAAAGAAAAGAAGACATTCCATGCATTCA
TTTATGCAAAATGAATGATAACCTGTTCTTCCCAATGAGTGACTGATGAATACTCNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACGAATGGGGGGAGAGAAAGGAAG
AGAGAAGGGAATACATATGGAAATGGTAGGAGACCTTCAGTGATACACAAAATAATAAGA
TAGGATGTTTTGTAATTCATTGCAATTATCTCTTCAGTGATTCTATATGCACAAATTAAC
AATCCGTTTCTCTTATTCTATTCTGTGGATTACTATAGTGTTATAATGTTTTTGGATCAT
TGAGCACTATTCACAACTGAAAGACTTTGCAATTTCAGAGAATTGTTTGAGACTGAGGCA
CAGTCATTCCTCCATAACTACAGGAAATTGATTCCAGGATCCCATGTAGACACAAGAATC
TGCAGATGCTCAAGCTCCTTATATAAAATGGTATACTATCTGCATATAATGCAACCCTCC
TGTATATTTTAAATAATCTCTGAATCATTTATAGTACCTAATACAATATAAATGCTTATA
TAACAATTTAGTTTTATATGTAAATAGTTATTATACTATATTGCTTAGGGAATGATAACA
ATACATCAAAAGAGTTGGTACATTTTCAATACAGATGCAACCATCGTTGGCCTAACTACA
TAGTACACAGTCCATGGGTATTTTAATTATGGATGCAAAACCCACAGATACCTAACCTAT
ACTGTATATAAGCCACCATTTACTGAAATTGAAAGCAATGATTAGTCTTAAGTCCTATTT
TCACATTCTGAGTCTTATGTGGTTTCACTATATTCAATAAAAGGTATACATATGTTATAT
ATGATGCCAGTATTACTAATATAATTACTAATATAGGTACTTGCATATGTAACCAAGTGA
TGAAAGTAATATTTCATCTGTAGGTAAATCATTCCTTGACATGAAAACCTAAGAACAAAA
CACATGAAACCTATTTGCTTTGTCCTTACTGTAAGTGGTCAATCAATGTTCTGTAGCTTT
TATAGTAGTTCATATTTGGAGTATCAAATATATCAGTCTTATAAAATTAGAAATAGCTGT
CAGGTGCTGTATATACATAAGAGATGTAATGCTTCCCTTTGACTATGTTCTTATTCCTAT
CTCCTAGAAAAAGACTACTAAGGAAGGAATTTTTTACACTGTTGTGCTCATGGGGCAATT
TGTACCACCAAAGTGTCTGACAGTAAATATGTGGCATCTGGTTGACTATAGTACCAGTGT
TTAAAGATCCATTTCTGGTAAGTATATTACACCTAAATATATGAGTGCCATGACAGCTCA
ATGATGATATGTTATCTTGAACAAAAGTGATGGCTCAAAAATCAGGCTCAGTTGGATTAT
GCTGAGGCCCAGCTTAGGTGAGAATTGTGAGATAAGACTTTTGGAATTTTTGGTTTCTTT
TCATGAGAATTTTATTTTGGGTTTCCAATGATGAAGTCTCCTGTGAAACTCATTTTCATT
CTAAATACATTTTTTCTAAATGCTTCCAAGTCAAATTATGATCAAGTTTTCTATAATTCC
AAATTTTCTTGAATATTTGACACTAAGATATTGGCTTTTTTCTCTCTCATCTCATGTTTC
AGTGAGTCCTGCTGGCACTATTCTACTGAGCAGAGGTGAAAGGCTACCTTTGCTTGCTAA
AAATTCCAAATTAGACCATTGGATTAGTGAAGACTCACCTCTATAATAATTATTTATTCA
TTTAGACAGTATATCATTATAGGGTATATAATATCATTGTAGGATACATCAAGGTTTATA
GGGTATATTATCTTCACAATGATTGAAACATGAGAAAATTCTTACATTTATCTATAATTG
CTTTTATTGAAGGTTGGGAAATATCATATGTTGAAAATACGCTCAGTGTGTTATAGTTAT
CTGGGGTCTCAATACACTAATAGAAAAAAATATTAGTACTGAATTTTAACAGTATTGGGA
TATTTTTTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNCAGTACAGCTGACACATCAGTACTGTCTTTTTTCCTG
TCACTTCAATCATGGTTTACAATACCATTATAGTAGGTATCTCAGAAAAAAGTGAATGAG
TGTATGTAGATGGTTTGTTTCAATGGTTTGTTTCAATGATAAGACATATT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved