Spermophilus_tridecemlineatus Locus Mono:71:SNORD101
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:71:SNORD101
Spermophilus_tridecemlineatus
Mono:71:SNORD101
scaffold_114016
SNORD101
1001..1073
2073
CCAGGCCTCTGGGACTACAGGCATGCACCACCTCACCCCAGCTCCTCTCATGCACTCTT
GACCCAGAGACAACTTTTGTTCCCTTTTACTCTCATTTTCATAAACTTAAAAAAAAAATG
TCTGAACAATTCCTCTAAATGAGGAATGAAAAACAGCAAGAACAGAAACTGCTGACCCAG
AAGCAACAGAGCGGAGCAGAGGGAGACAGAACCTAGAGTTGGGAGCTGGACTGTGACCTT
TGAGGTCCACCAAAGCAGCTGAGTTAATCAGGCAAGCCCCAGGAGTGTGAGGAAGGAGGG
AGAGTGAGTAACTGCGCCAGGACCCGCATCAGTGACTCCTGAAGGGAGGGAGGGAGGGAG
AGATGGAGGCAGTTAACAGACAGGGTGGCCCAGCCTTGCAGAGACACGATTTGAATCCCT
AGAGTTCACTCCTGGTGGGAAGAGAACAGCATGGGGGCCTTACGGTTTGGAAACTTGAGC
TTGCAGTTATGGTTCTTCATCTAAGCTGTTTATTATGACCATTTCTGTGGCTGGAATCTT
AAGTGTCCCCCAGGGTCCATGTGGCAAAGGTTTGTTCCTCAGCTTGGCACTATTGGGAGG
TGGTGGAAACTTTAAAAGGTGGAGCCTATTGGAAGGTCTTTAGGTCAATGGGGGCATGCC
TCAATGGAGTTTGTGGGACCCCAGTCTCTTCCTCTATGTCTCTTTTGCTTTCTAGCCAGG
GGGTGAGTAGTTTTTCTCTCCCATATGCTCCTGTCAAGATGTGACATCTTGGGCTGAAAG
CAAAAGGACCAATGGATCATGAAGAGAAACATCTAAAACTTCGAACCAAAATAAACCTTT
TTTCCTTATAACTTGATTATCTAAGGTATTCATTACAGTAATGGAAAGCTGACCAACACA
GCTTCTCCCATTGAACTGATTGTGTTCAATATAAATAAATAAATAAATAAATAAATAAAT
AATATTTTATTTTAAATTTATAAATTTAAAATAAAATTTTGATTTGAATGATGACTTAAG
TGTCGGATACCCCTTCACTCCTTTCATGGATGAAAACATTACAGTCTGACAAACCTGTAG
GTTGTGGCTCTATTCTCGTTTTGAGGATTCTGAGCCTCATTTATAGCAGTTAGCAAATCA
AGCATTATGCTAAGTGAATGAAACATGAAGCTGATGTTTGTTGCAGAAGCATCTGGACTT
TGAGGAATTGTGCTCCAGGCCCATCTCTGTGTACTTGCATCCAACTGTAATGAGCCTATG
TATGTCAAATTGGTGGAGGCTCTTTGTGCTGAACACCAAATCAATCTAATTAAGGTTGAT
GACAACAAGAAACTAGGAGAATGGGTAGGCCTCTGTAAAATTGACCGAGAGGGCAAGGCC
CGTAAAGTGGTTGGTTGCAGTTGTGTAGTTGTTAAGGATTATGGCAAAGAATCTCAGGCC
AAGGATGTCATCGAAGAGTACTTCAAATGCAAGAAATGAGCAAATAAATTTTTCGTTCAC
ATTCCTCAAAAAAAAAAAAGAAAATTTTGATAAGAACACACAATTTATTCATTTATATTT
TTAAATATCAAAATTTTATTTTAAGGTTTAATCTTGGACTGGACTTCCAAGAAAGCCAGT
TCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCTCCAGAGGTCACAGG
TGTCAGCAGTCACCTAGACAGGGTGGCACTGGGTGTGAGTGATTTCCTGCAATAAGTTGG
TATTCCCATCACACCTGAGCCCTGCTTCTGACAGTGTATGGGAAGGTACTCCTCTGTCAC
CTGGGAAGGGCTGAAGAGACTGCATCTCTCTGGCTCAAGGCATTTATCTTCCTTGGAAGC
ACTTCATTTAGGCCTCCCTTCTCACCCAGGGCCCTTTGGACGGTGTCCTAGGGGGCAGCT
ACCTTTGCTCCATATTCTCTCCCACTTCTGCCACCAGCTCTTCTCTGGCAATGGCTTTGG
TAAGCCTCTGAAGCCCAAGTAACAAAGACGCCTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved