Spermophilus_tridecemlineatus Locus Mono:119:SNORA32
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:119:SNORA32
Spermophilus_tridecemlineatus
Mono:119:SNORA32
GeneScaffold_5524
SNORA32
1001..1120
2120
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNT
CTGTCAGAGACGTGCCACTCACTCTCTTACAAAGTCTTGCAGGGTCATTACCCAGGTTTG
TAGGTTGCAGTCTCTCCTTTGCTGTGCATATGACCATACAAAATTTCCCACTAGGTTTTC
TAACTGCTGACTTTCTAACAATCAGCCTATTGGGGACAATTTATTAACTCTTTATGAAGC
CATTTCTGGTTTTATTTCCATTACTCACATGAGCACTGTTCAGTGGAAATACAGAGCAGA
AGCTGGGTGTAGTGGTGCACTCCTGCAATCCCAGCAATTCTGGAGGCTAAGTCAGGAGAA
TCAAAGGTTCAAGGCCAGCCTCAGCAACTTAGTGAGATCTTGTCTGAAAATAAAAAATAA
AAAAGGGCTGGGGATGCAGCTAAGTGGTAGAGCACTCCTGGGTTCAGTTGCCAGTACTGC
AATAAATAAAATAAAAGGTCTGGGGATAAAACTCAGTGGTAGAGCACTTGCCTAGCATAG
GCAAGGCCTGGATTCAACACCCGCTATCCCTCACCATCCTCTCCCCAAAGAAATATAGTG
CAAGCCACATGAGATTTTGTAATACTTTCTGATTTTTCTCATTGGCAATGAAATTTTACA
AACAGCCACATTTCAAATTCTCACCACAGCACATGACCAGAGCTCTGGAACCTTTCAAAT
AGGCTTTGCTAATCCACGTAGTAACCTTTCCAGGTTGCTAACAACAAGTCAATTTGTATA
TAGGGGAGCTAGCTGAGGTATGCTGGTTCCAGAACTCATTCTTGATTACAGCCTGATCAT
GTCTTTACTTGTAGGTTATTGTTATGAATGAATTCGGATTTCGCATTGGTTCTTTTAAAA
AGGGCTCTCTTGAAAATAAATCTTGACTTCAGATTTAAGTAAACTTGAACTTATTTTAAA
ACAGGATCCTTGATGGGCAAGGGCAGGAAATAACAGCATGTGAAATTCCTTATACAAAGG
TGTCGCGGGCCGGGTTGTAACTCAGTAATATGGCATTGTGTGCTGAGTGTGCATAGGCAC
TGGATATGATTGCCGGAATGGGGGGGGATATTGATTTATAAGAAAACCTCACTGCCTAGG
TACAAATGTCTGCTTTAGCTTACAATCAGCCTCAACAAATGACAGTGAGGTGGTGATTCA
AGGGTCAATGTGCACTGAAAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved