Spermophilus_tridecemlineatus Locus Mono:173:SNORA67
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:173:SNORA67
Spermophilus_tridecemlineatus
Mono:173:SNORA67
GeneScaffold_2356
SNORA67
1001..1143
2143
AGAAGATTGCAAATTTGAGGCCATCCAGACGGTTTAGCGAGATCCTGTCTCCAAATGAA
AAATTTGGGATTGTGACTCAGTGGTATAGCGCTTGCCTAGCATATGTGAGGCACTGAGTT
CGATCCTCAGCACCACATACAAAAATAAATAAAATAAAGTTATTATATCCATCTACAACT
AAAAATATATTTTTTTTAATTTTTATTGTTGGTTGTTCAAAACATTACATAGTTCTTGAC
AAATTATATTTCACACTTTGATTCAAGTGGGTTATGAACTCCCATTTTTACCCCGTATAC
AGATTGCAGCATCACATCGGTTACACATCCACTGTTTTACATATTGCTATACTAGTGTCT
GTTGTATTCTGCTGCCTTTCCTATCCTCTGCTATTCCCCATCCCCTCCCCTCCCATCTTC
TACCCCATCTACTGTAATTCATTTCTCCCCCTTGTTTGTTTTCCCCCCTTTCCCCTCACT
TCCTATTGTATGTAATTTTGTATAACCATGAGGGTGTCCTTCCATTTCCATGCAATTTCC
CTTCTCTTTCCTTTTCCCTCCCACCTCTCACCGCTGTTTAATGTCAATCTTCTTCTCATG
CTCTTCCTCCCAACTCTGTTCTTAGTTACTCTCCTTATATCAAAGAAAACATTTGGCATT
TAAGGGTGGGGATGGAGCTCAATGGTAGATAGAGGGTTCCTGAGTTCCATCTCCAGAACT
GCTAAATAAATAAATAAAATCCAATTATGAGCCAGAGTTTCATACATTGCTTTGTGTTTT
CTTAATAATTATAATAAATAATACAGAAATTATAATAATTAACTCAAAGTCTAATTACTC
CTGGACATATGTAGTATATAATATATCTTTTATTGAGCTCCTATTCTAAGCCAAGCACTG
TGACAATTGTCTCAATCCTCATAATATTACTATGAGAAGTTATCTTATTTTGTAAAACAA
GGTAATTGAGACTCTGAGAGGCTAAGTCAGGCACCTAATGCTTATTAGGTGATTTCCTCT
CCATAGGGCCAACTAGTGCCTCTCTTAGGAAAGTAGCAATTTGGAAGAAAACCTGGCATG
CTTAAGATCTTTGGGAAACAGAGGATACTTGATTTCTCTTGCATTTCTTTGACTGCCTAC
ATGTATATTTAAGTCCCTCTGATGGATCATATCCTCAATTCAAAGGATGAATTTGCCATC
TTTCTTGACATAGGCCAGAAGCATTGATGTGCAGCAGGTTTCTGTAGTCATCAACTATGA
CCTTCCCACCAATAGGGAAACTACATCCACAGAATTGGTCAAGGTAGGTGTTTTCAATGA
AAGGGTGTGGCTATTAACATGGTGACAGAAGAAGACAAGAGAACTCTTCGAGACATGGAG
ACCTTCTACAACACCTCCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATGATCATAAGGATGTTT
ACATACAGTCATCTTTTTTTTTCTGCAGTGCTGCAAATTGAACATGTGGACTTAGTGCAT
GCTAGGCAAGCACTCTATCACTAAACATCCCACAGTTTTTGCTTTCTTTTAAGTTTTTTT
ATTTTAGAGAGATCCTGTCTCACTAAGTTGCCTAGGCTGCTTAGAACTTGTGATTCTCCT
GCCTCAGCCTTCTGGGTACCTAGAATTACAGATATGCACCACTATGTCCTGCTATAGTCA
TTAACTGATTAATCACCCATTTATATATATGCAGTGTTCATTTATTCTTTTTTTAAGAGA
GAGTGAGCGAGGAGAGAGAGAGAGAGAGAATTTTTAATATTTATTTTTTAGTTCTCGGTG
GACACAACATCTTTGTTGGTATGTGGTGCTGAGGATCCAACCCGGGCCGCATGCATGCCA
GGCGAGCGCGCTACCGCTTGAGCCACATCCCCAGCCCTATTCAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved