Spermophilus_tridecemlineatus Locus Mono:78:SNORA43
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:78:SNORA43
Spermophilus_tridecemlineatus
Mono:78:SNORA43
scaffold_149025
SNORA43
1001..1130
2130
TTCTCCCCTCCACGGCCACTTGGGCTCTGTTCTCTCCCTCAAGCTGGCTCTATACTTCA
GGTCATTAAGCACATTTCTTCCTTAACCACACCTGATGTTGTTTATTGCTCTACTCACCC
TAGTCTTTGCACCATGAGTACAGATAAACTGTAACTCGTGCTTTCCTATTCTTCTTAGCT
AAAGTCTTCTTACACTCACTTTATAAATATGTTTTAAACACTTAAATAGAAACAATATTC
TATTCATTTTGTGTTTTCTTTTCTACTCTTTGAATCTTTAAACAAGAAATAAAGAACGAA
TATTTTATTTCTTTAAATTCCAAAGGATCTAAAGTAAGTGTTGAAACAAAAACTATTTTT
TTTATAGACAACTCTACCTGCAAAGACCACTCTTTCTTGCTCTGAAGATGATGGCAGTCT
CTTAAATGATTAGGTTTATGGGTCTACAAGAAAGAAGTTTATTTATTTATAATGTTTATT
TTCATAACAGAACTTGTTCTTGCTGTGTATCAAACCAAAAAAAGAGACAAAATAGGTCAA
ACAAGTTTAATTTAAAGTTTACTTTTAACACATAACTTAAAAACAGGCCTTAACTGCAAT
GATTTATTTTGTTCTGATTTCTAAGTAGCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNCAAAATCTACCAAGGTGCCTTGGTCTGGACTTCCCAGGCTCTATTCAGG
AACCAGAAAGAAATAAATTTCTCCTGTTCCATAAATGATTCAGTTTTCAGTGTTTCTTAT
TGGCAGCACAAAAGAAATATGTAAACTTCCCTTTTTTGAAAATGAATTTGCTATCTTTTC
CATGAATTCTCTAAATCCACGAGAACAAACTTATGAGAATTATTTCCACTGAGATGTGGG
GGAAGTCACAAGATGATGTAAGAGTAAAAGGAAAACTGAGCATTGTGGTAAGTTTTAAAA
CTAAGCTGATTCTGCTGTATCTGTGACATCTGGGCAAAGAGCAAGTGGCTGTTTCTATGC
TCTGTGTTCAGAAACCAGTGAGCACTAAGAATGGTTTATAGCCTCACATTTCTTAGAACC
ACAGCGAAGTGCCCCTGGGTTGTTTGCTTTGGAAATAACCATCTGGTTTGCTCCCAATGG
GTGGCAATATAGGCCCTGGCAGCAATTACTCTACACAGGTTGGGTTGTTGCTGGGAACCC
TGAACAAGATGCTAAACTTAGCTTTTTGTAGTGCTGGGGGTTGACTGTAGGACTTTGTAT
ACTAGGCCTGGGCTTTATCACTGAGCTACATCCCTAACCCTTGAATTTTGATTTTTTAGT
TTCTTCATCTGTAAAATGGGGCTAGGTATGAAGATTAAGGGAATCTGTGTAGCATAACAA
TGTGGCAGGCTTTTGGTACAGTGGGATGAAGCAGGGAAGGATCTCATTCCCTGGTTTCCT
TCCTGGAAGAAGGTCTGTCGGGGAAGGACTAGGAACCATGATGCTGGTGAAAACTTTCTG
TGTCCTGTCAGTGTGGGAAGGCTCAGTGGATGTGAGCCCCTGTTGTGAGGACTCTTGGGA
TGTGCAGCAAGGAGCTGGAGCCTGAGGCAAGAGGATCACAGTTCCAGGCTGGCTTGGGAA
CTTGTTCCAGAGAGGCCAAGATGGATGGGGCCCAAGATGTGGCTCAGCTCTGCCCCCTGT
GCCTCACAAAGTGCCATCTACCTACCTCCATCCTTGTTCAGTGACTTCATGGGACCACCT
TTCTTTGCTGGAGGTTCAAGAAAAAGAGTTACTTTTGTATGTAGGGCGAGGTTCAAGTAT
TAGCACTAAGAACGTTAGGATTTATGGCCAAAGTTTCATTAATTCAACTAGAAAGCTGGA
GTTTTAAGCAAAAGGTGTTAAAATACATTAAAAGGTTTGCTTTAAAAAAAAAAAAAACTT
AAAAAATGGATACAATCTTTTTTTCAAAGTTTAAATGTGGGTGTCCTGTACTGCATCTTA
CCACATGTGCTTTAGTAGTTCCTACCTTTAAAGTTTGTCATTTCTTGTGTTAAACACAAC
TCAACCTATAACAATTGTCTTTTGTTCCTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved