Spermophilus_tridecemlineatus Locus Mono:98:SNORA21
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:98:SNORA21
Spermophilus_tridecemlineatus
Mono:98:SNORA21
scaffold_143375
SNORA21
1001..1137
2137
TTCATGGAATTAGATGGATTTGGGGGCTACTTGGATGTCCTCCAAGCATCAGCCACAAA
GGGTAGAATGATAATATTTTTTTCCCCAAACTTCCCATAAGACACAGTTATGTCTCTCAG
ATTGTTAGGAAAGTAAGAGAACAAAGGATTTTTACAGCAATCCCCAGAAACATAAATTAG
GTGGAGATTAAAAACATAAATTAGGTGGAGATGTGAAAACACCACATCTCCAACTGGCTG
CATAATGTTCCTGTGTATTTAGTATTTAGTCATTTCAAACACCACATATCTAAAATAAAA
TCCATCTTTTCCTTAGAACTTTAGACCCTTAACAGGTTAATATTGACATTTAATTACATG
GTTTCTTAAAAAGAAGAATAAATCTTAAGATTGATTCAGAGAAGACATTTAGGAAAAGAT
ATTGAGACAAAAACAGTATGAAGACAGAAATGAGGATTTGGAGGCATTAGCTAACAGCTA
CTTTCGGTCTAGCTAGAGGTATTGATGGTATTAAATAGCTAGAGATACTAAAGCACTGCA
ATACTGGATGGTATTGAATGATAATATAACAGCATTTCCAGGTTCATTTCACATTGATAC
ACATTTTAGAAGGAATATTATTTGATCACACATATATATGTAATTACTCATCCCAAATTT
TATAAAAAGCTTAAAAAATATTAAAAGAATATAAATTCACTATCATTTGGAAGAAAAGAA
AGTGTGCCATCTGAAAATACTTTGGGGAATCTCTGAAAGGTAGTAAAGGGGACAGAATCA
TATCTCTGGAGTTTCAAAACTGAAAAAAGTCTCAGTGTAAAACATATGCAGGAGGCGACA
TGTGGCTAAGGAAGTTCTGGAATTGGCAGACAAAGTGGCAGGGAAGGGTCTGAAGGCAGC
TTTGAAATGCTAGGTTGATTGGCCCAAGAGAGACATTGGCAACTGGGCTAAAGCACCAAT
ATCATTTCTAGGCCCCAGGCACAGGCAAAATCTGAACCAACCCCCCTTTAAAATCACTTA
ATGTACTTTCTTACTAGTGACCCATTGAGTAGTCAAGAAAGGGCAGAACGCAAACACCAC
TTTTGGATGAAACGGCATCAGGCTATGTTGTTTTGCTTCAATTGATGGTATGATGAGGTA
GAAAAGTAAACAACAACCAGCTACAGAATGTGGAAAAGTTTGTAAACTATTCCCATGACA
AAGTATTGGTATCCAGTACACATGACAAACCTCAAAACACTTAACAACAAATAACCCAAT
TTAAAAATGGAAGGATAGGAGTAGACACTTCTTAAAAGACAAATAGCCGGGCTGGGGATG
TGGCTCAAGTGGTAGCTTGCCTGGCATGCGTGCGGCCCAGGTTCAATCCTCAACACCACA
TACAAACAAAGATGTTGTGTCCACCAAGAACTAAAAAATAAATATTAAAATTCTCTCTCT
CTTCTCTCTCTCACTCCCTCTTTAAAAAAAAAAAAGACAAACAGCCAACAAATTGGTGAA
AAAATTCTCAACTTCATTAGCCATCAAGGAAATGCAAATCAGAACCACAATAAAACACCA
TGTTACTCAAGTTAGAATAGCTATTATCAAAAAGATGAAAAATAACAAGTGCTGATGAGA
ATGTGGAGAAAAAAGGGCACTCTTAAGCACCATTGATAGGAATTTGAATTAATACAGCCA
CTATAGAGAACAGTGTAGAGATTCCTTAAGAAACCAAAAACAGAAGTACCATATGATCCA
GGAATCCCACTTCTGTGTATCTGTCCAAAGGCAATGATATCAGCATATCAAAGAGACATC
TGCATGTCCATGTTTTCTGCTGCACTATTCACAATAGTTAAGATATGGAATCAACCTAGA
TGTCCATTAAAAAGTGAATAGATAAACTGTGGTTTATCCACGATGAAATACTATTCACTC
ATAAAAAAATGATATCATTTGCAGCAAATGGATAGAACTTGAAGACATTATACTAAGTAA
AATAAGTCAGATACAGAAAGATGAATGCCTTACGTTCTCTCTCATATGTGGATTTTTTAA
AAATTGATTGGATTATATGATAGTAGATTACAACAGCCTGGGAAGGGCAGAGGAGGTTGG
GAAAAGGGTATTATTATGTTTGGATCTTGAATGTTCCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved