Spermophilus_tridecemlineatus Locus Mono:63:SNORA25
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:63:SNORA25
Spermophilus_tridecemlineatus
Mono:63:SNORA25
scaffold_155484
SNORA25
1001..1129
2129
ATTTCCCTGATCTTTTCCAAAGAGAGAGAGCCATATTGATCAGTAGGGACCACCAGTGT
GAAAGTGATTTGGGAGAAAAGAGGGATACTGGCAGTTGTGCTGTTGGTCATAGAGATGCT
AATGTCCTCTTCCAGTTTATCAATGATCATAGCTAAGGCTTGGAAGTTTATGTGCATGTC
ACTCTCTTTGTGCGTCTTCTTAACTGATATTTTTCTTTCTAAGGTTACTACTAACCACCT
TCACACACATAAGTAGCCAGATAAAAAGAGTGACATTTAATCTCTTCAGTCACACCATTG
TTCATATCAAGCAGTATCATAGGGAGCTGGACTTTGGTCAAGTCTTTAGTCATTGCAGGC
ACAAGGCAACTAAGGAGGAAAAGAAACTGGCCTGAACTGGCCCATGAAGAAGAATCTAGG
GTGGAGGAGGAGGAAACAGGAAAGAAACCAGGGAATTCAGGCAGCAGCTCTTCATGCTGC
TGCCTCTTATGGTCTGGGCTGGATTCTTAATTGCTATGATGGTCTTCCCACTCCCTTCCC
CTCCATAATGGGGATTGAACAGGGGTGCTCTACCACTGAGCTACATCCCCATCCCCCCCC
CTTTTTAAGCTGGACACAATAGTTTTATTTTGTTTATTTTTTTATGTGGTGCTAAGGATC
AAACCCAGGTTCTTGAACATGCTAGGCGAGCGCTCTGCCGCCGAGCCACAATCCCAGCCT
CATATCCCCAGCCCTTTTAAAAAATTTTTATTTTGAGACAGAAGCTAGTTAAGTTGCCCA
GGCTGGACTTGAACTTGCTATGTCTCAGCCTTCTACACCACCACATGCGCCACCATACCC
CAACTGTTGTTTTTTTTTTTTTTTTTTTAAGTCTATGTTTATGTCATTCTTTAGCTCTGT
ATTAAATCTTGGGATTAAATAAGATGTCATTTGTAGTCATGTTTTCTTTATTATTCCTAG
ACCTTTCCACTTCCCTATAAGTTTAGAATCTCTTAATCTTTGGGTCATTTCAAAGAGTTC
TTGTGGAGGTGTGAAATCAAGAGCTCTTGATGCTCTACCTAAAGAATGAGGTTCTCTGTG
GACTACTATAATCACTCAGTAGAGCTATGTTTTCCCAAGGAGCTATAGGATTTAGCAACT
CATAGTCATAACATAATCCATGATTAGTGTTGTGGGAAAATAAATAAATGTTTTAAAGTT
CATAAAGAATCTTTTAATCTTTGTGGTACTGTATTCTTTACCCAGAGTTATGGGAGCAAA
ACATCATGCCTCAACACACTGCTTCCAAACAGTGTGTTTTATTGGTGAAAATAAAACCAA
GAGCTGTGAATTTTAAAATCAGCACAATGTATGAATGCTGCATGATGTATTTTATGTATA
ACAGTCTCACAGAGATTATTTTCTAGCAGCCTTTCCATCATATGTTTGGTTTATCATACT
TCAAATTCTTCATTATTAGTTAAGGAAGTCAGAGTATAATTCCATTCAAGAAAAATTTTT
TTTCTTTGTTTAGGAACATACCTTAATTGAGTGTGTTTGGTTATGAAGATCAAACCCTCT
TCACATTGCATGGATGGTCATGGATAGACAAAAGACAGGTGAAATAATTGATAGGAGAAT
TTAAGAAGAATTTTGAGCATTCTGAACAAACACACTGAGCAGAGGCAGGCAAGGAATAAT
GCCCAGCAGCTTGTTAAGTGACTAGGTTTGGGAAGACTGTATAACTTGGGTGGTAAGAGC
TTGAGTTCTAGAGCCAGATAGCCTGGTTTAGCTACTTACCAGTTATATAAGTTTGAGTAA
ATTATTTATCCTTTCTGTGCTTTACTTTCTTTAGTACACGAGGTGGACATAGATTGTCTT
GCCTCTAAGGCAGCTGTGATGATGTAAAATATTAGTACCTGTCATATAGTCCATTCCCAT
AGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTACAAATTCACTGTA
ATCCAGAAATTGAAATAACTTCTTTGGGAGCGGGGGCAGTGCATGAGCACCCATGCTGGG
CACTGAACTCAGGGCCTTGATGCACAACTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved