Spermophilus_tridecemlineatus Locus Mono:88:SNORD116
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:88:SNORD116
Spermophilus_tridecemlineatus
Mono:88:SNORD116
scaffold_128280
SNORD116
1001..1083
2083
ACCTTTCTAGAGAGACATCTGTTCTGTTTGTCTGGACTTCCTTTCCAGTCTCTTCTGTC
TCACTAGATGTGTTGCCTCTTGAATACCGAAGTCAAGAATTCAGGGCACATTCTTCACAG
GTTTAGTCTTTGTCCAAGACCTCGCCCCTCCTCCAGGGACATTGGCAGCCTCACCTCTTC
ATGTTCTGGAGCCAGTGATGGTGGAAGATAAAACACCCTAGTTAACGTCTCAAATTATTA
GTCTGCTGTGTACTAAGGTGAGAGCAAAAGGGCTAAGTGGTTCCTGGGCAACAATTATAC
CTTAAGGCACTTTAGAAAGAGAGAAAAAAGTGATTTCAAAGGACAGCTTTAATGTGGGTA
TTTTGGGATGCCTGTACCAGTTTGGGGCAGTGCATGGAGCTGGTGGGCGTTGTATTTGGA
GAACTCTAGGGGAGAAGTAAGCAGTACCTGAGCACGTCCTGTGAAGCGAGATAAGTGGCT
TCCAGGCCACTTTTATCTGGAAAGGTGCCAAGGTCTCGGCTTGGCACCAGAATCATGAGC
CACCACACACCTTTGTAGGTTCAAACAGCAATTCTTTATTCCCAAACTCACACCAGCCTC
TACAAACACGTTCAGGGGAAATCCAAGTTCTCCCGCACAATTCACGTCCCAAAACTTTCT
CAATTCCACAAGAACTCAACTGTAACTCAGGCAGCAGGCACGCCCTACTCCCAGCAGGAA
TAATCTTCAACCTCCAACTTCCCTAAAACTCCTATTGTCATGCCCTAAACCCAAGGACGG
GGATACTTCCTGCAAGATACACCCTAATCCTGGATCCACCCTGGTGATTGAGCAGGGTCA
CCTTTCTCAAACACACAAGCAAGGTCGCAGCAAATTTCCAAGGCAAGTCCATTTAACATA
GGGTACGCTGGCAAGGATTTTGATGCGTCATTCCTACTTGGTAATGGCCCTCAGCAACCT
ACCAAATACCTTAGACTCAGGGTGGCTTATTCAATGTGCTTGGACCAATGATGACTTACA
AAAATGAATCTTGTTGGAATCTGAACAAAATGAGTGACCAAACCACTTCTGTGAGCTGAG
GTCTAGCATGGGGATCCTGTTAGACAGACATATGGGAGGGATTTCAGGTACTCAGGCAGT
AGGGACCATGGGGTCTAGGATATTTGAAAGCTAACATGAGAGCAGCTGTTAAATAGATTG
TAAAGTTCTTTATAAATATCTATTGTGGATTGCACAGCAAATTTTGTGAGTACTTGACAG
TTAACGTCTATCTCCTTTTAGTAATCCAACTCTGGGAAATTAGCACATGACTAGTGAGAC
TCCACTGAGTTATTATGGTAGTGTCTGGCCTTTAACCATTTATACATTTACAATTTTCCA
TTAGGAGCAGTCTGTAGAAGTCTATTGAATGATCAGTTCAAAAGATATTTTTGTCTTCTC
TATTGTTTTTAGGTAAGAGTATCTGGAAAATGAGTGATTTCTAATCATGGGAATGTCTCA
GAATGTATTTGAATTTTCTTGCTATTCCAGCTGTACAAGTTCAGATGATTTTTTTCTGTC
ATCCTTAAAGAGCAGTTTTCTAAATACTTGAGTGATTCCAGTGGATACTGCTTTAAATAG
TTTTAATTGTAAAATTATTATATTCTACTTCTTAAAGTTTTATACCAATTTTATTGGCTA
ATATTCACACCCTTCAGTGGATTTCCTGTTCTCTTTGAGGAAGACCCTAGTTTTAATGAG
GGATGCTAAAGTTTTGAGCAAGTTTTAGAAAAAAGATTTTCCACACTTTCCTGTTCCATG
GAATACAGTGACTTGTTTTTTTGTCATACAATTTTATAGATAGATAGATAGATAGATAGA
TAGATAGATAGATAGATAGATAGATAGATATAGATATAGATAGATATATAGACATATATG
TGAAATCAATTCCTTAAAAATTAATATTCAATTTGGAAGATTTCCTTTTTCCACTTTTCT
ATTTCCACTGTGTTTTGTAGGTTCAAAATTGGAATTGCATGAATCTCTTACTGTCACACT
AATGAAGAGCTAATTTCGTCATTTCTACCAGTTTGTTTGAGAAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved