Spermophilus_tridecemlineatus Locus Mono:109:SNORA42
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:109:SNORA42
Spermophilus_tridecemlineatus
Mono:109:SNORA42
GeneScaffold_5638
SNORA42
1001..1133
2133
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTGGACTC
CATTTATATTCCAAGAAAAGAATTTTAAAAGCTCCTGAATTTGTGAGAAAAGGGAACAAA
ACAACCAGAGCCAGGAAGTACAGTACTGTGATCCAAAAGGAGTGGACTGGGTGGCCAAGG
GCAAGAGCAAGCCCATCCCCATCTGCACTACTCAGTGCCATTTCACATCCACCAGGCAGC
TATAATCACAAAGATAGCCAAGAGTGAGTTTTGGCAAAGCTATACTGTTGGTGAAGTGTA
AAACAGTGTCACTGCAGTGGAAAACATACAGCAGTTCCTCAAAATGGTAAAAACAATTAC
CAGCCCATCCCCAGGTCTGTCATAGAGTCCCATGCCAGAACAAACTGTGGCCCGGCACCA
CTGCCTGGCCTCTGGTGCTGGTAGGCTACTGGGGCTAAAGCAGGATGCACAGAGGGAAAA
CAGAATTGCCATGTGATCTAGCAACTGAAGGAAGGTCTGGGCAAGATTCTTGTACAATCA
TGGTCATAGCAGCATTATTCAAAATATCCAAGAGACAGAAGCAACCCAAGTGTCCATCTA
CAGATGAATGTATAAACAAAATGTGGTAAATACACTCACACTGAAATATGCCACAAAAGC
ACAACCCTCAAGAACAAAGTGTGATATTCTACACAATGGAATATTATTCTACAATAAGAA
GGAATATTGTACTGAAACATACTACACATACAACAGGGATGGATCTTGAAAACTATGTGA
GATAAGCCAAATGCAAAAATACAAATATTGCATAATTCTACTTCTCTGAAATATCTAGTT
TAGGCAAATTAGAGACAGAAAGAACATTAGAGGTTACCAAGAGTTGGGAGTAGGGAGAAA
AGAGAAGTTGTTGCTTCCTGCCTCAGCTAATAAAAATTACAACGATGATGGATATGCCAC
ATAAAGTACACTCATCATCACTCAACGGTATACTTAAAAAAATATTAAAAGGGTTAGAGT
GATATTAAGAATATTTTACCACAAAGAAACAGCAGGGGAGAAGACTGAAGTGCACAATCA
TAAACTTAGCTAATATAAGACTATGAAATCAACGGAATCAGAAGGAATTCCTTTAAAAAT
GGAAGATGTAATATATCTACAACAATAAAATCAGAAAATATTTTTGTGCAGCAAAATAGT
GGCACAAATAGTGGCACAGGACACTACACACACAAATGTTTTTAAAACTAAGTATCAACT
TCCCAGTGATGGCTGCTATTATGATTAAAAGAATGTCTTTGTAGGAAACATTAAGAGACA
CAGAGTAGGGCTGGGGTTGTAGCTCAGTGGTAGAGTGCTTACCTCCCATGCGTGAAGCCC
TGGGTTCAATCCTCAGCACCACATAAAAAATAATAAATAAATAAAAATAAAGATAAGATA
TTGTGTCCATCTACAACTAAAAAAAATTTTTTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved