Spermophilus_tridecemlineatus Locus Mono:164:SNORD65
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:164:SNORD65
Spermophilus_tridecemlineatus
Mono:164:SNORD65
GeneScaffold_4241
SNORD65
1001..1072
2072
CCTCATCCTCCAGCATACTGAGATTACAGGTGTGGGCCACCGGGTCCTCTCTCTTTTTT
TTTAAATGTAGTGCTGAGGATTGGACCCAGTGCCTCACACATGCTTAAGTGAGCGCTCTA
CCACTGAGCCATAACTCCAGCCCCTCCAGTGGGTTTTTAAGGCAATGTTAGTTTTGGTTT
TGACAATATACAGGTCTCTGGAGCAATATTGGAGAGTAGTGAGGTATTGACTGCTCTGAT
GAAACCATTAATAATAGGAAGTGCCGTCAGAAGCGATAACTGACGATAACTATTCCTGGC
TGACTGCAGTCAACAAATCTTTACCATTTGTTGGTGCCCAGGATAAAGTTGGTCTGAACT
GTGACAATTGCTATATTCACTCAGGTTGCATATTAGCAGAAGGAACACCAGCAGCTGAGT
TTTGGAGCCTGGAACATTTGCCTTTTCGTGAGGTAAGCTTTGGCCTCTAGAGAGTATAGT
GACCTTTATTGATGATATTCTGGAAATGCTGAGTGGCATGCATAGCCATAGAGGGGTTCT
CAGATTACCTCTTGGTGATTTAATAATCTCGAACCAATTTACCTGTCTATTCTGAGGTAT
AGTATTCCTCATTTGTCAGAAGGAACCATAATCTTAAGTACGTGAGGTTTGAAATGTGAC
TGAGTAGAGTTACAGCTCCCAGACAAGCTAATTAAGACTTAATGTAATTCAGTAATTTTA
CAAAAAAAAAAAAATCTCTTCTGTAAGGTCTTAAAGGGCTTTTGTTAGGATGGACTTTAA
ATTGTTACCCGGGCTAAAAGAAATGCCTTTCCTGCTTCTGTGGTCTTTAGGTACTTTGTT
TTATCCATTCTCAGGATTTTGGAATGAAGCCCTGAAGTGCAGATTATAGACCTGGTGGCA
GCAACCTAAGCTCTGGAGGTAAGCCTTGATCTACATAAAAATTACCTTATTAGTAGAGTA
GATAAAGTGGCTAGTTGTTTTAAGTAACTTAAAAGGATATCACATGATGAAATCACCCAA
AATAGCTGGAATTACCGGCAGATTGGTAGTGGTGAACCTACGGTTTTCTGAAGATATCAT
TGCACTTGTGAATGACTGCTGTTAATTGGAGTAGAAAGTAAGATTGAAATTTAGTTTCTT
TGCAGGCTGTATCTCCCAGAGGATGATCAGTTCCGGGGATCAGTAACCACCATTGATTTG
GATTCTGAAAATCTAAACAGCTTCAACATTTGGAAACATGGTCACCTTGTGTGTCAGGCT
GTTCACAAGAGATCATTCAGCAGGCCCGATTGGTTTCATTACNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNATGGTCTAGGGGTTACTTGGTTTAAAGTGAGTATGGAC
AGTGACCCAGTGAGTAGCTCTGTTTCCAGTTTCTCCTTAACAGCTATCTTGATAACTGCC
ATAGGCTCACTGGTCCTGGGATTTTAGAAATGCCCTCATAAGTTAGGGGGTGAAGACAGA
CCTTCAAGTGATAGGCAAGTGCTCTGCTATTGAGCAAACATCCTTTGCTGTCCTCAAATT
TGTAATTCCTCAGCCTGTGAATAACAGGCTGGCTAAGGATCAAGATTTCTGATGGGTTTT
CCCATGCATGCCTGTGTGCATAGGCACTTGTCACCACAGGATGCTCTAAATATTTCAAGG
TGTGGTGAGAGCTGGTTTTAGGAGCAGGTCCCTGGACCTGGAAGCTAAAATGTGGGAAGT
CAGTTCCAAGCCTGAGACCAAGCAAGAAGAGCACCTTCCTTAAGTCCATGCTTAGCATAG
CTAAGAACTAGGCTCCAACCTCATTAAGTTGGACTTAACATCGGGTGGAATTTGCTTCCC
CATGTAGGACAAGGGTAATACAGAACTGGGATGGCAGGAGCCTGTCTGCTGTTTGGAGGA
AAGCTCTTGGTAACATTGGCTCAAGCTTCATCATCTCCAAACCTATGCTTTTCCAAAATC
TGAGGAAGCCAAGGACTGAGTTGTGGGGTACCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved