Spermophilus_tridecemlineatus Locus Mono:115:SNORD15
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:115:SNORD15
Spermophilus_tridecemlineatus
Mono:115:SNORD15
GeneScaffold_5890
SNORD15
1001..1142
2142
TAAAAACTGTTTCTATCTAGTTCCCATTGAATGAAAAATTGGGGGTGTGTGTGGCCCAA
CTCTCTGTCTAAATAAGCCTTCCATGTGATTTTTGTTGACATTAATTAAAGTTAACTTGG
AAGTTTTGCAACCTAATCAAATTACTGAGTTTCTCTGACCGTTGGATCTCCTTTAAATAA
AGGTTATTATGCCAGTTGTCCTTAGTTGTGATGATTGAATGACATTGAGAAAGGGTGGGA
AGTGGTTAATAATCCAGTTGGTATCTCATATGGTGTAAAGCAATGGATAAGACTGGGCAG
CAAAGGCAGGTATTTTAAAGATTGAGTTTTATAGACCTAAAGTTTTTTCCAGCACTCTGA
TATCAAAACAGCCAGGTTCCCATATAGTACTCTTGTTCACTTCTGAGTATGAATTCTAGA
GGTTGAATATTTCAGTAAACCATGGAAGAACCCTAAGTTATTATTAAGAGCGGGTTTGTG
GGGTTTTTTGTTGTTGTTGTTTGGCACGGGGCATTAAACCTAGGGTTGCTTTACCACTGA
GCTACATCTCCAGCTTTTAAATTTTCATTTAGCAACAGTATCACTAAGTTATCTAGGGCC
TTATTAAGTTGCTGAGGTTGGCCTTAAACTTGGGATCCTGTTACCTCAGCCTCCTGAGTC
TCTGGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNATTGCTTTGTTTTTGTCTTGTCTTAGTCTTCTCTGTACCCTTCAGTGATGATATGATG
ACGAGTCAGAAAGGTCACATCCTGCTCTTGGTCCTTGTCAGTGCCACGTTCTGTGGTGCT
GTGCAGGGTCCTTTTGCAAGTGTCCTGTTCATTGATTGATTTAGAGGCATTTGTCTGAGA
AGGGGCCAGATCCAATGGTGCTCGAGAAAACTGCTCTTTTCTATCCTGTATGTGTGTGTG
AGGGGAGTGTTGGTGAAGCACTATTTAGTTCCTGTCTGATGTCCTCTAGGTGTGTTAGGC
ATCAAAGTGAAGATCATGCTGCCCTGGGACCCAAGTGGTAAGATTGGCCCTAAGAAGCCT
TTGCCTGACCACGTGAGCATCGTGGAACCCAAAGATGAGATCCTGCCCACCACTCCCATC
TCAGAACAGAAGGGTGGGAAGCCAGAGCCCCCTGCCATGCCCCAGCCAGTCCCTACAGCA
TAACAGGTAAGTCTGCAGTGTCCTTCCTATTCCTTGTGCATGTGTGTGCATATGCATGAT
CACGCATGTGTACACTGGTATCAAACTGATAATAAGCACTTGGTGAATAAAATTGGATTC
TGGAGATTGACTAAGTTGGAATCTGGGGCCCATTTAATTCACAGTTCTGTTGGGGTGGCT
GATCCAAGAATGAAGATCCTACTTTTACTGTTATCTGAAATACTTGCTCAAGATTTTCAA
GGCACTCTTGTTAGTAATTGGCTGGTGTTCTTCAGCAGCTCCCTAACAAGCAGCCTCTTA
TGTATCTGAGGGTTTTGTTTGTTTCTTGGTGGTGGTGCTGCTTCTTATTTTTATTGGTAC
TGGGAGTTGAACCCAGAGGTGCTTTATTACCAAGCAACATCCACAGCCCTTTTTTAATTG
TTGTTTTGGGTCAGGGTCTCACTAGGTTGTTGAAGATCTTGGTGAGTTGCTGAGGCTGGC
CTAGAATTGTGATCCTCCTGCCTCAGCCTCCTGAGTCACTGGGATATTGGCATGCGCCAC
TATGCCTTCCTGTATTGTTAATCTTAATGTGAACCTATTTGATAAGTGAAGGAACTTGAT
ACTGAGGTACAGTGTCACTTACTGTTGTGCTCTGTTTGGTTTCAGGGTCTTCTTGGCAGC
TGTATCTGGAGTCTGGATGTTACTCTTTAAAGACATTTAATAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved