Spermophilus_tridecemlineatus Locus Mono:42:SNORA2
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:42:SNORA2
Spermophilus_tridecemlineatus
Mono:42:SNORA2
scaffold_132243
SNORA2
1001..1125
2125
AAAGATTCTGCGAAAAAGCAAACAGTATTGCAAGAAAAACAAACAAGAGCCTGTGTTTT
AAGAAGTGCCTGTGTTTTGGTGGGTGTGATCCAAAGCCAGGAGCCTCACATACCAAACCA
TCCGGCCGGACCGCTTCTCAGACACTTGACCCGAGAGGGAGAGGGAGAGGGAACTGGGAG
CACGGGCATCGGCATCAGGGCTTGGCTGTGGGAGAACAGCACCGAGGAACACACCGGCGT
GGGAACGAGAGCGAGGGGCGAGCGGCCACCCTGGCCCAGGTCCAGCTCGGGCCCCGGGTG
TGCAAGGTACTTTTATTTTTGGGTGGATAGATGGTCCAGAGCTTTGTTCCTGGGATGCAG
TGCCAACTAATCTAAAAAGAAATTGCATGTTCGTCTCCAGAGACCATCCTCCCCCAAAGG
AATCTAAGGCGCCAAAGGAGAGTCGGGACTTGACTTGTTGGTCACAAAATAAGGAGGTGC
TCAAAAGTGACAGGGACAAGCCACTGTCACGGCATCCACTTAAAGGGGCCCCCACTGGCC
TGGGTGGGAGCAATCTGAGCGTCAAAACCAGTAGAGGAAAGGAGTGGGGTGGGGTGGGGG
AGGGGGACGAGAGGGGGAGGGCTGTATGGCTGTACCGCGTGCACGCACGAAAATGGAACA
ACAGGTCCCATCAGTATAGGCGACTGTCATGCACCCCCCAGGAAATGGGGAAGGAGGAAA
AGAATCGAACGACAGGAATCGATTATAAAACGTCAGGTAAAAATGAACCCACGAGTTCAT
GCTGATCACTGAACAATATATTTAAAGGCCGGGGATGGAGGAGAAAGGAAAGTTACTTAT
TTCCTTAAAAAAATGTTGAAGGTGATGGAATCAGGCAAGTTCCATGCTTGGCCAGGTCAC
CTTCAGGGGCCAAGATGGTCGGGCCCAAGACGGCCAGGAAAGGGGACGGTGGGATGGCCT
CCGTGTCCAGTCCACGCACCTGCTCGACAAGAGGGAACAGATTGGCCTCGATCAAAGCTG
AAGCTGTTGGTTTTAAGCAAACGCCTGCAGAAACGTCTTTCCGTGGCCGGTTGCCCATTT
CAGAACTTTGGAAACCCCATGGTCAATTCATCAGAAAGAAACATCGGGTTGTGAGCGGTA
GATGTGGGTGAGTGCGGGGATTCCACAGTCATCCAGACAGTCCTGTTCTCTGGATCCCCA
CTTAGAATTCTGATGCTCTTAAATCGTTTACCAAAAAGGTTTGTTTTAAGTTTTTCAACC
AAAAGAACGACTGGGGGGTGGGAGGAAAGGAACCAGGGTCTGATGCGGAGGGAAGTCCTG
CTGCCCAGCTGACCCCCCCCATACTGCCTGGCCCCCTGAGGACACCCGGGCACAGAGGCA
GGCCCCGGTGCCAGGACATGGTTCGACCCGCGGTTCTCATACCTGGTGCAGAAGATCGTG
GAGGGGACAGAGGCTTAGCTCACAGGTGGGTGACAGGACAGTGTGGGGTGGGGCTTCGTT
CTCCACCAGGGTCCCAGGTGGTCCCGAGACGCGTCCCACACAACACCGTAGCCCACTCCA
CAGACTGGCAGCCCCTCTCTCCTTCTGCGAGTCCTTTGGCCCAGACCCTTCAATATACCA
GTGCAGTGAGGGCCAAGGGAGGACTCCCCTGTCCCTGAAGGTCGTGACGGCTAAATGCAA
CCCGAGACCCTGGGCTGGACCCCAGGTCAGGGAAGGGGAAGGCCACAGAAGCTATTAGAG
CAGGGGCTATCGGCATGCAGATAAGGGAGCACACCACACAGACACAGTCGTGGACCACCG
CCCAGCCTCGGGAGCTCGGAACCAATGTGTCACCCAGGGCCACTCGCCCTGCGCCTACGG
AGCGCCTGACACCAACAGAGGCACTCAGAGGCTGCTTATTTTTAAATGCACTTGTATCGG
ATATATACTTTTTAAAGAAACTCAGCCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved