Spermophilus_tridecemlineatus Locus Mono:19:SNORA2
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:19:SNORA2
Spermophilus_tridecemlineatus
Mono:19:SNORA2
scaffold_152687
SNORA2
1001..1133
2133
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATGGCGACAGTTCGTTTC
CCTTTGCCGGGTGACCAATGCAACGGGTGGGTCCTTACTGTCTCTCCCAAGCCCCGTTTC
ACACCTGTGGCCACTACCTATGAAGGCTCGGTTGGCATTTACCTCCGTAGGATCAGAAGG
GCTGACCGGTTGTTTCAGCCGGATGGATTAGTGCTGAGTCACAGCTGTTTGTCTGCGGGA
AGCAGGCGAACGGGAGCTTGAATTCAGCCGATCCAGGTTCAGTGTGTGTTCTGAGAGGCC
CAGACTGCTCGTTCCAGATCCACGTCAGCTCAGCATTGCCTAGTGATCCTCAGCAAACAG
AATTAGGCTGTTTACGACTCCCTATGCCTGCACAGCTGAAGAGGTCAGAGACTTGATCTC
TCCGCGCCCGCCGCCATGTTGGAATCTGTCACGTTATTCTAAAATAAGCTTCTTTGTGTG
TTTCAATCACAAATTGGACTAGACAGCCAGGTATCATCTAACATGAAAGACATGAATGAG
CAGGAAAAAGGAACTCGAGAAAGAGATGAATGAGAAACAGAAGAAAAACTTAAAATACAA
CTAATATTCCCAGAGCAACAAAGAAATATACTGTCTCTAAGAAGCCAGAACAGACGCTAT
AACAAAGAAGAATGAAGAGGAGTGGTTGGTGGGGGAAGGATATGGAAGGAGAAGAAAAGA
AAAAGGAAACATGAAAAACCATCAGTTAGAAAGAGGAGGACTAGGCACTGAATCAAGACC
AATGTTTGCTGTACCTATTGGTTTCAAACAGGAGCCAAGAGTGATACCTTCCCTTGGTCC
TTTGGCTATTCAGTGTCTCAGAGGGAATGGCCAATTCATTTGGAAGAAACATGGTTTAGA
ATATGTCTTTTTCTGTTGTCTGTTCTGTGGTATTTGGGATAGAACCTAGGGTCTTAAGCA
TGCTAGGCAAGAGCTATACCAGTGAGCTATATCTCCAGTTTTTCTTTTTTATTATTATTT
TTGTTTTGAGATGGGATATTGGTAAGTTTCCAAGTTTGGCCTTGAACTTGGGATCCTTTC
TTTTTTGTGTGTGGTGCTGGGGATTGAATCCAGGGCCTTGTAAATGCAAGGCAAGCACTC
TACCAGGTGAGCTATATCCCCAGCCCAAACTTGGGATCCTTTTGCCTCAACCTCCCAAGT
TGTTGGGATTACAGGTGTGCATCACCATGCCTAGCAGTATCTTTTTTTTTTAACAGAAAG
ATTGAACTGTGTTAGATTTAAAAATGAATTATTCTGTGAGGATAGGGATTTAACCAAAAT
AATATTTCAGAGGAACTTCTGAGTTTTCTGTTCTACCTACTTTCCTACTCTCCCTTTTCC
TCTCACTCTCTTGCATGCATTTGTGGCTTTTGGGTCATTCATCAAACAATCTCATCTTGC
CCAAAGTTTAAAGCAATATTTAATTTAATTTACATTTCTGCTGATTATCATAGATTCATC
ACTAGTGAACTTAGATGTTGACTGCAGTAAACTTGGAANNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved