Spermophilus_tridecemlineatus Locus Mono:191:SNORD75
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:191:SNORD75
Spermophilus_tridecemlineatus
Mono:191:SNORD75
GeneScaffold_2720
SNORD75
1001..1062
2062
AGGTATAAATATATTAAGGAAAACAAGAGCTAGGATTCTCATTGTTAAAGATGATAGGG
ACAAATATGAATAAGAAGAAAGCTAGAAAGAACCCTATAGTGTAGGACTGGATTAGAGGT
GAGCTGTGGTCTTTAATACAAATACAGAAATATGTGGGATGGGTATACTGTATATATAAA
TACATGTAAGTGAATACACATTTATTTACTAGCTCTGTCCACTGTGAAGAAATAGGAAGA
GTAGTGGCAACAAGCACAACTACATCCAGACTCTTTGTTTCCAAATAAGATTCTCTGCTA
AAGGAATCAGGGCTCTTTGCAGAAATGGTTAACTCCAAGACTAAGGCAGACAAAATATGA
GTGTGGAATATCTTTTCTGTTGTGGTTGTTTGTTTGTTTGTTTGTTTGTTTGTTAGTTTT
ATAGAACTGCAAATTGATCCCAAGGCCTTGCATATGATGGGTAAGTGCTCTACCATTAAG
ATTCAACCAATGAAGATGGAAAGTATTTGGGGAATGGCAGGAAATGTGCCTGTACTGAGT
GCGTAAAGATTCTATTTCTTGTCATTATTGCCTAAATAATATTAATTATTTACATAGCAT
TTACATTATATTAGGCATTGTAAGTAATCTAGAGATATCTAAAATATTTGGGAGGGTGTG
AATGTACAAATATATGCCAATGAATTCTGCTATTGTGTATAATTATAGTGCACCAATAAC
ATTTTAAAATTTTTTTTCCCTTTACACAGTGCTGGGAATCAAACCCAGGGCCTCATCTCA
CACTGCTGGCAACTACTCTACTGTTGAGATATATCCTCAACACCACAATTTTTTTTTTTT
TTTTTAAAGAAGTCTGGGGCTAGGGATGTGGCTCAAGTGGTATCGTACTTGCCTAGCATG
CATGAGGCACTGGATTCAATTCTCAGTACCTCATAAAAAAAATTTAAAAACAAAGATATT
GTGTCCACCTAAAACTAAAAAATAAATTAAAAAAAAAAAAGAAGTCATGACAGTGTAAGA
GTAGTGGACAGAAGGGATTTCTAAAATTTTTATTTTGAAACTTAAGTTAAAAAATATTTA
AAGAAACCTTAATCCATTTTTTAAAAAAAGTATATAAGAGAATATGAATAAGTTATATAC
AAAAAATACACCATTTCAGTAAAAAATTTTGGTATCTGCAGGGGTCCTGGAACAATTCCT
CCTCCCATCCCATCCCCATGTTGAGAGACCACTGTACATAGAAGTCACCTAAAAATTCTA
CTACTCAGAGATATCCAACAATGAGTTTGTGATCTTTATTACATACGTTTTCCCGTGCAC
ATAAACATACACTATAATTTTAAGTGACATGAAATCATATAACACAAACTGATTACTTCC
ACTACTTCATACTGCCAAGGAAATAATAACTGCGATGTTAACAACTGGGTGTTCCTTCTT
GCCTCTAGATTACTTTTATGATCACCCAAAACAATGTTACATTAAAAATTTTAAAAGAAA
AATCCTTCTGCTTGACTTTGAATATATTACATCTATTTGTTTATTCAGTATGTACAGGGT
CATGAAATAAATAATGACATAAAGTATTTCTTACCTTGCTGGTTTGTGATACTGGCAAAG
AAAGTCAAACCTTTCGTCTGGCACAGGTACTCTGCTCTCATTAGGATCGATAGTGCAGAA
TGGGAAGTTTTCTGCTGAAGCCTGACTATTGGTTAATACATTAAAGAAGGTAGATTTCCT
AAAATGAAAAAAAATTAAAAAAAAAGCAATTTCAAAGGTTAACACCAAGAAAAATTTATC
TCGTGCTAATTTCAGAGCTCAGGTAAGATATTGGTTAATACATTAAAGAAGGTAGATTTC
CCAAAATGAAAAAAAAAAAACAAGCAATTTCAAAGATTAACACCAAGAAAAATTTATCTT
GTGCTAATTTCAGAGCTCAGGTAAGATCTATGAGGGCTATAAAACGAACATGGGGCAGGG
ACTGGAGGAGGAGGAAAAAAATACAATCTTACTAAAAGAAATGAATGAAATTTACAATGA
TGCAGCTCATGATTTACAATTAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved