Spermophilus_tridecemlineatus Locus Mono:27:SNORA62
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:27:SNORA62
Spermophilus_tridecemlineatus
Mono:27:SNORA62
scaffold_12486
SNORA62
1001..1136
2136
TAGAAAATATGTCATTTTCTTCATTTTACAACGTCTATTTAGTCATTCTTCCATACCTG
TTTGTTGTATTCTAAATTTCTTTATTAAAAATTATTTAATTATTATTACAGATTTTTTTT
AAAGATCAGCACTATAAAAACTGTGGTTCCTGGTGTAAATGCACCTCTTTCTAATGGTTT
TGTTTAGATGATTTGTTCTTCCTGGAATGCGGCATGCTATGTCTCAACAGAAATCCAGCT
TTAAAAAGCAGCTTGAATGTATTTGTAGAAGACATAAGGGAAATTTTTGTAACTGACACA
GCATATTGCTGTCTTTAAAACCAATACCTCCCAAGTAGTTGATTACATACTTCATTAATA
CTTCATTACCGTGCTAGATTACAAATGGGATATTATCACAACAACTGGGAACTCTATGGG
GGCAGAATATATATATGTATTTATATATATATAAAATTCTGTGTAATATATATTTATATA
CAGAATCCCGATGTTTCCACTAACTAGTACCTTGCCTAAAACACAATAAAAATAAATGAA
TTCATAACTTTGTAAAAATAATATAATCATTGTTCATCTGCTGGTTATGCAGATCATGGA
CTGGTAAAGTATTTCAAAGTACTTTCATATTACATTTTTAGAAAAGCCTTAATTAGGATT
CTAGTATGAAATTACAAAAAAAAAATTATTTTTTTCCTTAAAACATATGCAAGATCTAAA
GTTCTCAATGACTAGAAAAAAACATAAACAATAAAAACTTATGGTAAATTTAAACAGTAT
GTCTTAAATATTCTTGTTGGAAGTATCACATAGTTACTGTCAGTGTTAACTCTTTCAGGT
TATCTTTCTTGTAGTTGCTTAGGCCAATCTACGTTACCCAGTGAATTGGTGCTTTAGGAA
TGTCAATAATATTGATTTCAATCCTTGATTATGGAGGACAAACTTTATGTAGGTCAAATA
TCTTTTTTCTACCAATGCAATATATTAAAAAAATGTTCTTTCTTACACATTTTCAGAGCT
TGGAGTTGAGGCCACCAACTAGGCTCACAAATGTAGGTACAGTGCTACATGAAGAGTCAA
TTTTTGCTGATTAAGGGACCCAATGGATGAAGTTTGATAGTAATCCTTGCTACACATTTA
AAAATTAAAAAAAAAAACTCTTCCAACTCATTTCTCCATTTCTTCCATTATATATTAAAC
TAAAGTCAATAATTAGTAGTAGGGTTATTATAGGAAAAAATAAGATATATTTTAATAGAA
ATTTTGTATAATGGATGTTGTTGGTGCCCTCTTCCTCCTCTCCATGCCTCTGGATCACTT
CTGAGAACAGAGCTCTTCCACCTGCTGCCATGTGCTTCATAGCCAAGAGCATACACTTGT
AAATCTCTTTATATGATGCCCTTTGAGCACTGGAGCTGCCTATTGAGGAACAGCCAGAAA
TGCTTGGGAATTTTCGTACTCATCTTCAACCTCCCAGAGTGGCTGTAGTCAATTGCTGAC
AGGTTTGGGATTATAAAACTCATTTCCCTTTTTCCTCTAGGCAGGATAAACCTGTGTGAT
GTAATCCTATTCTTTGGAGTTTCCTGATAGATTGGGTTGAATCNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNCACACGTGAATAACCACACTAGTCAGCATGTTCAGAC
GTTTTAAAAGACAAGATACAATGGTAAGTTCAATTGCTTTAAACATCTGAAAATTGCTCT
ATGCAGTTATATGGAAACCAGCAGAAACTTGAAAAATCAGTAGTCAGTAATAAAAAGTTT
TACTCTGGGAAAAAAAAGAGATATTAACTTTTGATGATTGTTTTGAAATCCTGGCAAATA
ATCAAGAACAACTAGTAAAAGTGAGAAAAGCCTACAGCTTTCTCCAATCTATCATTTTAA
ATGTGACCACAATATTTTTATCGTAACCTGTTTTTCATGTGGGACTTTGATTCCATGTAC
TAATGGTGAACTCTCATTACCTGAAATGCTGCTGAAATTAACTAAGATGTTAGACTGTTC
AAAACCAGTACAGCATCGTGGTTCAAAATGTACTCTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved