Spermophilus_tridecemlineatus Locus Poly:3:SNORA75
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Poly:3:SNORA75
Spermophilus_tridecemlineatus
Poly:3:SNORA75
scaffold_137425
SNORD20, SNORA75
1001..1079, 1574..1711
2711
AAACTACTGAGCTCTCTGAAATATTTTTCTATTGAGAAATGGTAGGCCAGTCTAGCTTC
TTTTATTAGATATATTTTTTTAATAACTTCAGCCTGTATATTATGGAAATATCACTGTTT
TATGAAGATATGAAATATTGAAGAATGTACTAGAGGACTGGGGTTGTAGCTCAGTGGAAG
AGTGCTTGCCTAGCATGTGTGACATTCTTAAGTGTTGATCCTCAGGAACTGGATGCTATT
TTACCTGTAATTGTAGCTGGGAACCACTTTCATTTTTAAAAATGACATCTCTATTTGCAG
GTGAATCAAAAACTCTGGTTTTAAGCAACCTTTCTTACAATGCGACAGAAGAAACTCTTC
AGGAAGTATTTGAGAAGGCAACTTTTATCAAAGTGCCCCAGAACCAAAATGGCAAATCTA
AAGGGTAAAATAATGTCTTTATGTTAGGCTTGGGGCCTGGGGGTGTAGCTCGGGTTATAG
CATTTGTCTAGAACACATGAGTCCCTGAATTTGGTCCCCAGCACTACAAAGGAAATAAGT
ATGTTGGTTGTCAGGAGTGAGCTGTAAGAGTGTCTTCAGATCTAAAATAAAGGTGGTTGG
GGCTATAGCTCAGTGGTAGATGGTAGAGCGCTTGCCTAGCAAGCATGAGGCTCTGGGTTC
GATCCTCGGCACCACATAAAAATAAACAAGATAAAATAAAGGTAAGCCATCTTGTCAGCA
GAGGAGTGGAATGGTTTTAGCTGCACAAATGAGTGTAAAATGAAGTGCCTGCTTGAGGTA
AAAGGCCTGGGGCATTGTCTGATAGTAGAAAAACCATGTGTTTTCTACTAGCTAAGTATG
GCTGTCCATCCTCAGGTATGCATTTATAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNTCCTATTTTTCTTTTATCACTGAGTGATAGCTGGATATGATGACTGATAC
CTGAGAAATAATTGATGAAATATCAAGAAAATTCCTCTAGATAGTCAAGTTCTGATCCAG
CTATGTCAACTCAGAACAACAAATTTGCCTTTGGTTGACTGACTCCTCTACCTGGTGGGC
AGTACACAACTTGTTCAGTTTGCTTTTGTTTTCTTTGAGACCTGAGGCAGAAACTTGACT
GTAGGTAATACAAAATAAACTTTTTTTGGCTGTTGATAGGAGCCTTAAATTAAGCATTAG
TTGGCTAAGTTGCTTTTAACTGCTTTTGTACTAAAGCTTACTGGACGTTGCACAAAATTA
CTGTCATATGAATGTGACTTAAAATAGAATACACAATTTATTTTTCTTCCACAGAGCCAT
CAAAAACTCTGTTTGTCAAAGGCCTGTCTGAAGATACCACCGAAGAAACCTTAAAAGAAT
CATTTGACGGTTCTGTGCGTGCAAGGATAGTCACTGACCGGGAAACTGGATCCTCCAAAG
GGTAAGGCATGAGAAATGGGCAGCATTGCTTCTGTTCATATTGATGTCCTGGGTGGAGAA
TTTGGTTCTGATGTATCTTCTCATTGAGCTCCTTTCTGCCAACTGGTGGCAGTTTATGGA
TTCGCACGAGAAGAAGAGACATTTCACAGAACAGCATTACTTTACCTTCTGTTTCTACTG
AGGTGTGTATCTGGTTGTTCTGTGAGACAGACATTTTAGGATTTAAACTGGCAAATTAGG
ATTTTCTGCAGGGATGATCTGTCAGATCTTTTCTCAGTTAAACAAGGCTACTTTCTGTGG
GGTGACATGTGGAAATAACTTATTAGTATGTATTTCCTTTATAATGGGTGATTTCATTTG
GTGTTTTAGGTTTGGTTTTGTAGACTTCAACAGTGAAGAAGATGCCAAAGCTGCCAAAGA
GGCCATGGAAGATGGTGAAATTGATGGAAACAAAGTTACCTTGGACTGGGCCAAGCCTAA
AGGGGAAGGTGGCTTTGGGGGTCGTGGTGGAGGCAGAGGAGGCTTTGGAGGCCGAGGTGG
TGGCCGAGGAGGCAGAGGTGGATTCGGCGGCAGAGGCCGGGGAGGCTTTGGAGGTAAAAA
TTGGTCCTCCACATAGCACACAGACTGCTGAGCCTGTGCTATGTTCAGTTTCTGGTCACT
TTGGGCATTTTTGCACCATCCTTTCATGATGTTTTGCATTCCTGCAGGGCGAGGAGGCTT
CCGAGGAGGCAGAGGGGGAGGAGGAGACCACAAGCCACAAGGAAAGAAGACGAAGTTTGA
ATAGTTTCTTCTGTCCCTATCTTTCCCTCTTCCATTTGAAAGAAAGGACTCTGGGGTTTT
TAACTCTGTTACCTGTTCAATGACAGAGCCTTCTGAGGACATTCCAAGACGGTATACAGT
CCCGTGGTCTACTCGGAAATCCGTATAGATGACATTTCAAAGGAGATACCCTGTTGGTTT
TGACTGGATGTTCATATAAACTTTTTAAAGAGATGAGTGATAGAGCTAACCCTTATCTGT
AAGTTTTGAATTTATATTGTTTCATCCCATGTACAAAACTGTTTTTTTCCTACAAATAGT
TTTTGTTTTGTTTTGTTTGCGTTGGGGGGTGTAAAGGAAAGCAGAATGTTTTATGATTTT
TGCTTCAGTGACTTTAGGACAAATTAAAAGTCCTAAACTCTGGTGCCAGACTTATACTTA
CTAAAATCATTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved