Spermophilus_tridecemlineatus Locus Mono:26:SNORA25
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:26:SNORA25
Spermophilus_tridecemlineatus
Mono:26:SNORA25
scaffold_156752
SNORA25
1001..1127
2127
AATTTGCAGCAACTGGGAGGCTGAGGCAGGAGATCCCAAGTTCAAGGCCAACCTCAGCA
ACTTAGCAAGACACTGTTTCAAAATAAGGGGGTTAGGGTTTGGGGATGTAGCCCATTTGT
AGGGTACTCCTGGCTTTAATCCCCAACACTGCAAAAAGAAAATAAATATTATTGAGCACT
ATACTGTAACAGGGAACTGAGATAGTCATTGTATGAGATAAAATGAAGTATAAGAGAGTT
CTTGTTCTCATGAAGTTTACAATTTAGTTGGGGAGATAACAATATAGTTTAAAAAACAGT
TGCTCCTCTGCTGCTTAGTCTATCCTACTTTTTTTTCATCACAGTACCCTCAGTGATTTA
TATAATGCTGCCTCACACCATACACAAGGTGACTCAGCCTAGTCAATAAAAGTAATAGCT
CATTTCCAGGGTAACAATAATTGAACTAGAGATGGACTCATGACATAGCCAGGCCAATAT
AATTAAGTAAACATCAGCTCAGGAGTTGTGTGTGTATTCTGTTTGTTTGTTACCTTTTCT
AATTTTTTAAAGTTACTTGCATACCTGAATTTATTTTTCTTTAAACTTGAAGCTCAATAT
CAGATGGTGGTTGTTCTGTATCTCTTTCAAATCCAACGGATATCTTTTTTATCTTAATAT
ATCCTTCCACTGAAACACCTTCTTTTACACATCCATATTTTAAGATTCATCTAAAATTTC
ACCCCCTTCATAGCTTCCTCTTTTTATCATGCCAATCTGAGGCAATTGTTCCCATACTCC
CAGAATGTGTGGAATTCTGGTGAAACTCTCACCTCTATCTTCCATTTCACTAATTCTTTT
TTTTTTTTTAGTTCTATCTAATCTGCAATTCAATCTATTCACTGGGTTTGTATTTTAATG
ACTGTATTTTTTCATTTCAAAGCAAATCAATTTTTTCAAGCCTGTCTGGTCTTTTTTGAT
ATTACCTTAATATTTTATCATATTTTTCTTTAAAAAAAAATAGGTCAATTTCAGAGGACT
GGTAGGGCTATGAAACCAAGAGCTCTTAAGGCTATGACCAAAGATTGCAGTTCTCCACAA
AATCCCCCTCATGACTCAATAATGCTATTTTCCTGAGGAGACATGCGAATTAGAAACATG
TATAGAAGTAGTTCATAGTATGTAATTTTAAAATCTCATCATATGAAGGACTTGAGGGTC
TCATCCAACCATTGACTGTGTTGGCTGCCTTATGCTAATCCTTATGCTTTTTTAAGTGTC
AAGCTCATATTTAGTAGGGCTTTTTCTGCATGAATCCCTTGTGGCTTGGTTTGGCATTTG
TTTCTACCAGGGGGATACTGGGTGGGGAGCACTCTTTGTGTTCATTTCATGAGTTGGGGT
TTACTGGGACTGTAAAGGGAGTATTTATGTGAACCACAGTTCAATTGAGCAGAATTAAGT
TTTTAGCTTTTTCAGGTGGGGGACCGGGGAGAACAGGAGTGATTGTTTCCCTAGAAGGAG
GTAGATGTTAACTTCTGCTCGCCTTTGAGGTTCATAGCTTTAAAAAGTCATTCCCTTTCT
GAATTTCCTTCTGGTCTTAAGGTAGGGGGTGTGTCCTCATTTGGCATGTAGAAAACTAAT
TCCTCTCGGTATCAGAAAAAACCAAATCCTATGACACTCCACTAGAGCAGAAGAGCTTCG
GATCCCACCTTTACATTCTAGTTTTTTCAGTATCTGCTTCATTTCGGTCCTGGGAGAATC
CCTAGGATTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved