Sorex_araneus Locus ENSSARG00000007557
snOPY snoRNA Orthological Gene Database
Sorex_araneus ENSSARG00000007557
Sorex_araneus
ENSSARG00000007557
GeneScaffold_6162
SNORA44, SNORA61, SNORD99
1078..1206, 1415..1549, 2370..2449
3573
GCCTGCTGGGTGGACCCCGGGCAGAGGCCGTTGTAGCACGTGGTAAAGGTCACCTTGGT
GGGTGGATATGTCAAGGAGGACGGCTGGTATCCAGATCCCACTCTGAATACGGATTTTGC
CACGTTACATTGATAGGTCAAATTCATCAATCTACATGATAGGCCTGAACTGCTCTTTAA
AACGGTTATATGAGGGCGAAGATCAAGCGAGTCCGCGCTAGTCACCTATGGAATGCCCCC
GAGACCCCAGAAAGCCCAGCAGCCGAGTTAGAGGAGGCCACGGCTACTTCTGCAGACGAT
TTGGGTGAGTGCGGGTTCAACTGCAATTGGAGTTGTCATGTGGCCCTTATCGAAGCTGCA
GCAACTTCCACATAGCTGCTGTGGTCAAAAAGGAGCCCAGAGTGACAGTTTTCCTTGACG
GTCGCCGTTCTGTTTGTAGTAACTGATCTGCAACATTTCGGGAAAAGACAGTTTCCGCTG
TGTATCTTAGTGTTAGTATATTTTGGGGGCACTATATGTGGTTTTGGGGATCAAGTTGCT
AGCTTCAGGCAAGGCAAGCATCTTGTCTGCTGTATTATCCTTGACCCTATCTATTTAGAA
AAGCATGACTGAACGGAATTCATGGGGAATACAATGCTGCAGGCTGGAGCACATGATTTA
TTTGCTTGGCCCAGGTTTTACTCCCCACGCTACGTTGGTGGGAACTTAATGATCTCACTT
CCAACAAACTTGAGTAATTGGTTGTCTGAAAATGGAGGAGAGGGAGGTTGGTTTGGAAAA
CAAGGGAGCAAAGATCATGAACTAGTTTTGTTCTTTCCCCTAAAAAGGAGACGTTCTATC
AGCAGAAGCCAAAACCTTTGAAGCCGTGATAACTTCGATGCTGATGTCTAGATGAAGGGA
AGAATATCTAGCAGGACAGTTGTTCTTAGCTATGCCGAGTGAATACTTCAGGCTTTCTGG
TGAGTGAGGAGTCTTGGGATAAAGATCCACAGCCTTACACTGTGCTCTGGCCTTGGTTGT
TTTTTTTTTTTTTTTTTGGGCTGAGACATAATTTGGGGGTTGCCTGGGGGAATTAAGGAA
GCATGTTTCCAAGGTCTGTGGCTGATAGTGTCCACGGTATCTCCAACTGCATGCGAGAGC
AACCTGGAGAGACTTTGACAGCACAGGTCACCAGTACCTGCAGCTGCCACTCGACTTTCC
TATAAACTAAAGAAAGGTTCTGGCCCTGAAGCCTTCAACCTTAATTTGTTTTAGCATTAT
GTACCATGTAGTCACGTGTATCATATCAACTGTTAACTGCTAACATTTTTTGGTTGCCAC
TAGGTTTTCTGCAATAGATGAAACTAAACCTGAATCACAACTGGTCGCTGAAACTGTTCC
TTTAAAGGTAAAGTTAGGTCTGGAGGACTTGCCTGACCCTCCTGTTCCCTTTCCCATCGG
ATCTGAACACTGGTCTTGGTGGTCGTAAAGGGAGGGATAGTAACACTGAAGCTGGCCTCA
CAGGGCTCCTTGGTTCTGCCATGTAGCACATGGGCTAGTTTCAAACAAACTTGAATTCTC
AAATTTAGTAATATACCTGGAGGAAAGCTGGGCTTAAAGGTTATGTATAGGGGTGGTGCC
ACAGTACCGTGGGTAAGGTGCTTGCCATGGATTTGATACCTGTCCTTCTATATGGTTCTC
CGGATCTCCCAGAGTACAGACTCGGGAAATAACACCTGAGCACCGTGAGGTGTGTCTCAG
AAAAATGAATACACAAAGCTCTGGATAGTTGGCTATAGTGATAGTGAACATTTCCAATGG
ATTTATGAATTAATTCATCTCTTTGATCTGTTTTAAAAGGTCTTCATTAATAAAGCTCCT
GCTGTGAATCTATGTGATTAGGTAAGTTGACTGGAGGTTGGTTTTAGCTACAGCATGAGG
TAGTGTATGACTTGGAACTCTTTAAGTTAAGCAGCAGGGAAATTGAATCTAAATCTTTAA
ACTCAGGCCTTCACTCTTGAGCGCTGGAGGTTGCACCCAAGATCTCAAGTGTTTTTATGT
TTTGGGCCACACCTGGCTGTGCTCAAGGCTTTATTTACCTTGTTCTGAGCTTGGGATCTT
GACTGAGGGTCTATGTGGTGCTGGAGAATGAAACCCGGTTTGTTCTGTATAATAAGGCCC
CTCAAGTTTATAACTACCTCAACAGCTGTATTCATTATTAGAGGACAGATAGCTCAGTAG
AGGTTCATTCCCCTGTTAAATTAATGTGACTATTATTGGAATCCAACTGGGCACCTTAGG
CAGAATAATTGCTGTGAACACCATAGCTTGAGCTCATGACTGATGGTTGGGGTGGAAGTG
AGTTCCTTGCAGCTCAGGGTTACTGCTTCAGCTGGTTCAGGATGAAACCTTATCTGAGTG
GACATCTATGGATGATAAATGCGGATATGGGACTGAGACCTGCTGTTTGAAGAAGAGTTC
TTGGGTGTTATAACTGGGACAAACTCTGATACATTGGCTCTATACTTCTGATCTAGGTGT
GAAAATGAAGAGACAAACTGGAAAACAAGATATATGGAATCAGCTCTTAGGCCTGCAACT
CAGAAAGTCAAGACAAGCAATTGCAGGCAAAGCTGTACTCATTGGCAATGTCGACACCTG
ACATCAAACTGATCAAATAAAGCTTGGTGTTTTCATCATGAAATTGTTTTCATTCTCACA
GCGCTTAGTTTAAGCAGTGTGCAAGGCAGAGAAGTTTTAGGAGCAATTTTCGCTTTTTGG
GTCACAACCGGCAATGCAGAGGGCTTAATCCTGGCTCATACACTGGGTACTGGGGGGACT
GTAGGATGCTGGGAATCAAACCTGGGTCAGTCACGTGTAAGGCCCTACCTGCCATGCTAT
GGCTCCAGGTGCTGATTTTTAGGCCTTATTTGGCACTGCTCAAACACTTACACTTAACGG
GCTCGATCACAGTGCTACCTGTGATACAGCCAGTGGGCTGTGTACATGGTACAGTGGATC
TGGCACCAAACGTGTGCAAGTTTCATGTGATGACATACTTTCTGTGGAGGCCTGATTTGA
ATCTGCACTGCTTGCTGGTTAATTCTAGATAAAAGGCAGGCTTCATCTGGTGCTGGTGGT
GCTTGAGATTTGAACCTACAATGACCGAGTGAGGGAAAAGACATACTCAGGCCCCAAGCT
TTGAACTCAACCAGTTAAGTTCAGCTGGTTGGAAAGTGAGGTTCCTTGGTGTAGTCAATC
CTGCTAATGAAACTAATCAAACAACTCAACTCAAATGAAGGTAGCAGTGTTGTAGAAATA
TCTCTGGAAACATTTCAGTATAAAGGTGTAAAAATTATTTTTTAAAAGATGTCTTATTTC
CTTCATAGTCCATTCTGGCTTGGCTACATCATGGCAGGGATTTCTGAAGAGACTGTGTCC
AGTGGCTGCCAATGACAGTCCATCAGTGCATCATATAGCTCCTCACTTTGCTCCATGAAT
TCCTTGTTGGCCTCAGTCACGTCCAGCTGTGGCGTAGGGTCTGGAAGAGAAAGACAGCTT
TGGATGGTTCACAAAAAGCACTTAGCAAGACTTC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1014, 1312..1330, 1333..1346, 1351..1381, 1384..1386, 2533..2538, 2541..2573
1001..1014, 1312..1330, 1333..1346, 1351..1381, 1384..1386, 2533..2538, 2541..2573
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved