Sorex_araneus Locus GNL3
snOPY snoRNA Orthological Gene Database
Sorex_araneus GNL3
Sorex_araneus
GNL3
GeneScaffold_5427
SNORD19, SNORD69
4101..4177, 6406..6482
9534
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNCTGGGTCGGCAGGCCGGTGCTCGTATGACACGGCCCATAATGCGGGGCCCTTC
CGGGCCGCGCGGGGAAACAGCCGCCGCTCGGCGCCCACGTGCGCGCCGGGCCCCGCCGAG
GCGCCTGTCCGCCCGCGCGTGGGAGCGCAGGAGGGGGGCACTCGGCTGGACCCCGCCGGG
ATCGGCGCGGCTCCGACGGCTGTGAGATGACTTACAGAGCGTCAGCGCTACGTGGTGTCT
TGATTCTTTTTCTGATGTTTGTTTGCTTTTTTTGGGCAGAGTTAAAGAAAGCGAGTAAAC
GCATGACATGCCATAAGCGGTATAAAATCCAGAAAAAGGTAAGCGTGCTGGAGAGAGTTT
TAAGTAATGGGAATGCTGCGTTGCTGCCCCAGGTTTCTTCCGGGAGGAGGTAGGGGTGAA
TAGGAATTATTTCAGGAAGTGGAAGATAGTTCAATCGTGACACCAGCTTTCAGGCATCAG
CTCCGAGAAGCTACAGAAATTCTGTGGTGCGTCCTGTAAATTTGAACGTTTAAGTAAACC
GTTTGCAGGGGCCTGAGTGATTGTACCGGAGGAGGGCTGCTGCCTTGTGAGCGGCCAACC
CCAAGATTTCCGGTTCCCGGCACCTTAAGAGGTCGTCCCGTCCTCTCCCCCCCACTCCTA
GCCACGAGATGGCAGAGCTAGGCCTGAGCACCATCCAGTGTGTCCCAAGAATAAAAATAG
TCTTTGCGAAGAATCTCCTTAAGACCTTGGCTTCACATATTCTTTGCTTTGTTTAAATTT
AGAGACAAAACCAAGCTGTAGTCCGATTAGTTTCTTAAATGTGGATTCTCTCTGTAAGAT
TTGTATAAGTTGCTGGTGATCTTTTTGCCTTGCACGTGTTAGATCTTGGCACCCCGGGTG
GTCCCAGAGCATTGCCAGGAGTGATCACTGGGTGTGGTGTAGAAACACTTCCTCCCCCCC
CAACAAAAAATAAGTTGTGTGAACTGACTTTTAAGAATAAGTATTTAATAACAGATCCGT
GAGCACCATAGGAAATTGAGAAAGGAAGCAAAAAAAAAAGGTCATAAGAAACGGAGGAAA
GACCTGAGTGTTCCCAACAGTGCTCCCTTCAAAGAGGCCATTCTTCAGGAAGCTGAACTG
AGGAAACAGAGGGTAAGAACTGATGTGTGGAGCGCATGCATCTTGAAAGGAGCAGGTCGG
AGCCCCATGTCTCACCCATTTCTCATGGTTTCAACACACAGCGTGAAGAACTTAGACAGC
AGCAAAAACTTGATCGGCTGGAGGAACAGCAGAAGAGAAGAAACCTTGACACGGACTCTG
ATAATAAGCCATCTGATGAACCTGTGAAGGAGGTATGATTTGGTCTCTGGAAAGGAGATT
AGTTTCAAATAGAAGTAAAAGCGTTTTTACATTTTTGCATGTGCTCAGCCCTTTGTGTCC
CCATCAGTAACTGTGGGACTGCTCATCGGCCATATGAAATAAATGTTACAACTGCTGTGC
TTATTTTAAATTTTATTTTGTGTTTTCCTTAATTCTAGGAATTGGGGCAATGCAAAGCTA
AGAACAAAACCAAGTCAGGCAAACAGAATCCAAAGAAGCTGTATTGTCAGGAGCTCAAAA
AGGTATTTTAATCTAGGTCAGTGTCTTAAAAATGAGGTTTAAAAAAAGATCAGAGGCTTG
TCTTTTTTAACACCAACCTAAAAGTCCGTTAAGCTTAAAAGATGCCATAACAAATTGGCT
TTCCTATTTAGCACTTGTTACTTTTAGCTGAGTGGGAAAATTTATTTTTCCTTTGCATAG
GAATTCCTCCACAAAGCATGACTTTAGGAAAAGGCATTTTATGTTAACATGGCAGGGCTG
GAGAGAGAACTCAGCGGATTGTATGCAGATATACTGGGTATGGCTCAAAACCAAAATAAA
AGCCAATAATAAGTAACATGTTGACAAAGGTTTTTTTTTTTAAGTTATTTTATTGAATCA
CCATGTGGAAAGTTACGAAGTTCTCAGGCTTACGTCTCATTTACACAATACTCAACCAAA
AACACCCATCCCTTCACCAGTGCCCATATTCCACCACCAAAAACCCCAGTGTACTTCCCA
CCCGCCGCCCCCCCAAAGTTTGTTTTTGTTTTTTTATGCCATACCCAGTGGAGTTCAAGG
TTTACTCCTGGCTGGGTGGGGGAAATCATATGTAGGTGGTGCCAGGGATGAATCCAGGCA
AGTGCCATTCCTGTTGTACTGTTATTTTGGCTCTAGACAAATTTTTTGGAAGTGGGGAAA
TTCAGAAAAGCAGTGAGAAAGGCATCTAAAGGACTTCCTTTAATTCAGGGAGACAAGGTA
TTTTGGTGTTCTTACCTGCACTCTCCCTGCCCGCTTGGCAGAGCCTGGCAAGCTCCCTGT
GGCATATTCGGTATGCCAGATACAGTAGCAATAAAAGGTCTCCTTCCTCTGACCCTGAAA
GANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTGCTAAAATCT
CAGGGCTTGGGTGAATGGAGATGTTACTGGTGCCCGCTCTAGCAAATCGATGAACAGTGG
GATGATGGTGACAGAGACAGTGATACCTGCACTCTTATTCCCAGTATTTGGTTTTCAGGT
GCCCTCTCTCATCAGTGAGTAGAACTGCACTCTGCTTAGCATCTTAGCAGGCCAGAAGGA
CCTGTCGAATTAATGTGATTCATTGTGCTGATCATATTTTCAGACATGGGATATTTCCTT
TCTCGAAATCCACTTTTGAGAATGGAAGTGTTCAGAGAGGCTGCTGAACAAATGTATTAC
TTTTTTTTTCTGTGCGAAACGCAGATGTAATAAAGTGATGGCTTAAGTCCAGCTCAGCAC
ATTCTGTAGCAAGTTAAATAATGCCAGTGTAATTTAGAGGGTCTTCCCAGGGCATGGGGT
GCTCTTCTCATCATTTCTCCCTTCACAGGTGATTGAAGCCTCTGATGTTGTGTTGGAGGT
GCTGGATGCCCGAGATCCTCTTGGTTGTAGGTGTCCCCAGGTAGAAGAGGCCATTGTCCA
AAGTGGACAGAAAAAGCTGGTGCTTGTATTAAACAAATCAGGTAAGCAAAGGTATGACCT
TCATGCTTCATATGTACTGGTGAGGTATGAGGAAAACATCTGAACAGTCTGACTGTCACT
GAAGACTGATAAGATCCAACTCTGACCTCAGCAAAAGCCAGTACATGTGTTGTATATTGT
TCAGATTGCGGTGTGTGTTGGGGTGGAGGGAGGCGGTGGTTGGTGGGTGTTTCTCTTAAG
TAGTTTGTCTGGTTTCTCCTCTTTTGCCAGTTTGTACTACCGTTTTGTATTTGGAGTCTA
GTTGCTGGGACTGGGGAGGTGGCTCAAAGGCCTTGAACTGCATGTGTTGCATATGGGAGT
CCCCAGTTTGGTTCCTGACACCACCTGACTTCCCCAGCACCCCTGTCAGTGTAAGCTTCT
ATATTCAGCTTTACCATGCAGTATATTTAAGTATGAAGTATGAGGCTGGTTTTTTTTGTT
CACTCAGGGTAGATCTTCCTAATGGGGCACTGACTTCCCCCCTCCCTTCACTTTTGAGAA
AGTGGATAGACTTATTAAGTTGGAACCTCTGGTGTAAAATTTTACTTAATCCTGAAAGGG
TCAGGGGTGGAGAGAATTGGGATCATATAGAGGCTGAACTTTATCAAGATGAGGGCACTG
TGATAGGAAGGTTATCTCTGTTATCTTCCAGTTAAATTATTTGAAAACTGAAAAGGCAAA
CCAGAGTTACTATAGTGTAGACTTTATGAATTCATCTCAAAGGAATAAATTGCAACATAG
TCTTATTCCTACTTGCGATCAGACTTGGTACCCAAGGAGAATTTGGAGAACTGGCTAACA
TACCTGAACAAGGAATTGCCGACAGTGGTGTTCCAAGCTTCAACGTGTCTGAAGAGCAAA
GGGAAGGTAATCAAGGTTCCCTTGACATTTGGTGGTGGGGTGTTTGGTCCTTTCAGATTT
TCGATGGCTGAAGCATGATGAGTATGTAAAATCTTGATAATAGAATGAAAACAGAAAAGA
TCCAACTCTGATTTCATCCAGAGAAATCTGAAAGGCAAAAAAGTGGCTGACTTTGAAAGC
TTGACTGTAGAGCCAGGCCACTTAATGTTTATCTGGTGAATTGTCAGAAAGTTAAAACTA
ATCATTCGGGATTTTATTGTATGAAGGTGAGGAAGAAAGCTACTGCATTCAGGCGTGAAG
TGTGCATTGGGAAAGGAGGTCTTTGGAAGCTTCTTGGAAGTTTTCAGGAGACTCATGGCA
AAGCCATTCAGGTTGGCGTCATTGGTGAGTTTTAATTGAACATCTTTTAATTGGCAAGAA
TTATTCCCTAAAGGGATAGTCTAATCCAGCTTCCCAGATATTTTACTATAAAGGGAAGGG
GGAATTATAATTGTTGCTCCCCCCCCCTTTTTTTTACAACTCAGTTGTTAAAACATCGTA
GTGTTTTCCTACCTTTTTGTGTAAGAAATAGTTTAGTGGGCTGGAGTAATAGTACAACAG
GTACGGTGTTTGCCTTGCACGCAGTCCACTTGGGTTTTATCCCACTTAAATGCCAGTTCT
GCTATTTAACCATCCCTTGTGGTCCCTGGAGTACCACTGATTGTGAGGCCCTCCCCCCAA
AAAAATAGTTGGTCTTAGCGTTGAATGTCGATAATCAGATCAAATTCTGATTGTGCTCTG
AATATCAAATAGAAAATAAAGCAGTGGGAATTTTGTAATTGTTAGCACATAATGCCTTTT
CTGTTTTATTTCCAATTTATAGGTTTCCCAAATGTGGGGAAAAGTAGCATCATCAATAGT
TTAAAACAGGAGCCAGTATGTTCTGTTGGTATATCCATGGGACTTACAAGGTAACAGTCA
TTCTGTAACTAGAGTGTTTTGTATATCTAAAGACAGTTTTTCTTTTAAAAAAAAATTTTT
TTTTTTGGAGGTGTCAGTGGAAAGGCAAGGGTTAAGCTAGTGCTATCTTGGGAAAGAATT
GATTAGTGGGGCTGGAGTGGTAGCACAGTGTGCAGGGCGTCTGCCTTGCACGCAGCCGAC
CCAGGTTCAGTTCCCAGCATCCCATATGGTCCCCCAAGCACTGCCAGGAGTAATTCCTGA
GTGCATGATCCAGGAGTAACCCCTATGCATCGCTGGGTGTGACCCAAAGAGAAAAAAAAA
AGAATTGATTACTGTGGAGTAGTTGAAAAATCTAATTGGATAGACTAAGCAAAAAGATAG
TGGAATGCTCCAGGATTGACGCTGGGACTTGATGTTGATGAGTAAAAGACTGTCAGGCAG
AAGAGGGAATGTGTTTATGGTAGAGGAAATGGCCTTTCTTTCAGGTAGTATATAAACCAT
AAGATGTAATTATCTCCTTAGAAGGCATGAGTATAGTTTTGACTTTTGCATGAAGCAAAT
GATGATAAACTGGATCTGACAGACTATGCTGAGTTTGTTCAATCCAACCCTGAGCTTCAT
GTTCTTCTGCCTTTTATTCTTAAGATAAACCAGTACTCCCATCAACCACTGTTTCTCTAT
GTTCCAGGAATATGCAGGTTGTCCCCCTGGACAAACAAATCACAATCATAGATAGCCCAA
GCATCATTGTGTCTCCACTTAACTCTACCACTGCACTTGCTCTGAGAAGTCCAGCGAGTA
TTGAAGAACTAAGACCACTGGAGGCTGCCAGTGCCATCCTGTCTCGAGCTGATACTCGGC
AGGTACAAGAACCATCATCCTCTTTCCTTGGTGCTTCAGAAACTTTTCCTTTGATGTATA
AAGCTTTGTTTTTACAACCATGCCACATGCAGTTTTTTTTTTCCCCTTAAGATAGTGCTG
AAATACACTGTTCCAGACTTTAAGGATTCTCTGGAATTTTTCGCCTTTCTTGCTCAGAGA
AGAGGGCTGCACCAGAAAGGGGGAAACCCAAATGTTGATAGTGCCGCCAAACTTCTGTGG
TCAGAATGGACCGGGTAAGGCTTCTTTAGGTACACTTGGTGATAATCACCTTTGAGTAAA
GGAACCAATTTTTAACATTTTGGTTTTCAATACTAGTGCCTCCTTAAATTACTACTGCCA
CCCTCCTACATCCTGGACCCCTTCTCCCCATTTCAACGAGAAGACTGTGTCAGACATGAA
GCAGGGCTTTAATCTGGACCAATTGGAGAAGAACAATGTACACAGCATACAAGGTAGTAA
GCAAGGCTGATATTTTGAGTGTGGTTAAATTTGGCTCATCAAATAAAGGTTTACATGTGG
TGGTGTGTTCCTTTTGTAGCTCTAAAAGGCCCCCGATTAGCCAGTAGCATCCTTTTCCAC
TCTTCTGGTCTGACAAATGGAATAATAGAGGAAAATGACATATCTGAAGAACTACCAAAA
CAGAAAGTGAAGCAGCAGGAGAAAGGGGAGGACTGTGAAGACAGTGATCAGGAGGCTGCT
GAAGAAGCTGGTGTAAGTCTGTTGCCTGTGATGTTAAGCTGAAGTTTTCTAATACTAAAA
TGTACAAGAGGTCTTTAATAAAGAAATCTTATTTCCTAGTAGACAACCAGAAGGCCTTCT
ATGGTTTTATATGTATACATATATTATTTTCATAAAAGTAGTTCACAATAGTTTATTACC
CAAAATATTAAAACACCAATCCCACCACCAAGCACCTTCCCACCACAATAAGAGGGAAGT
GTGTGAAGATTGTTGTATTTCATTCTGGAGCCATTTAAGCCGGAATATAAGAATACAAGC
AAGTATGTTAAAACCAAGCAAATGGTTTTTGATAAGTGAGATGGAGTGTAAGAGGTTGCA
TGCCTTTGTTTTTGAGGCTAGCGATCCTTATTCTTAATTCCATCTCTTCCGTTATCTATG
CCCTTTAGTGACTTCTCCATGCTTATAATTACTGAGCAAATTAAAGGCCGATCTCGCATT
CGTGGCCACACGACACTTCATAGGACACATTCTACCCTTAGTCCAAGAGTACCACACTTA
ATAGGATTCAAAGTAGGAGGCAACCAACTTTAGAGGCAAATATTATTTCGTATCTGCTTT
GGGGCAGGGTTTGGGAGTTCAGTATGGAAACACCTGAAGTATGGTGGTGGGATTGGTGTT
TGAATATTAAATATAATCAAACATGGTAAACTGCTTTATAAAATAAGAGGCCAGATAGGT
ACTATAGTGGGTAAGGCTTGCCTTGCACATGGCTGATCCGGGTTCAGTCTGGCACCCTAT
GTGGTCCCCTGAGCCTGCCATAAGGGATCCTAAAGCACAGCTGGTTTTTATACACATGTC
CCCCTGCCCCACCTCTCCCAGGATAAAGCTGTTTAACAGATTCTCTCTGTCCTGCAGGAA
GCATCTTCAGGCTTGTGCCCTGAAGAGGCCTGGCAGATACAGCCTGAAGTGTTGCCAGCA
GGTATGTTGGGTGCAGCGATTTTTGAACAAAGTATTGTGTTGTACAGTTGACTTTTTAAT
GTTACTTTTTTTGTCTCAGATAAAATAATTAAAGAAGAGGGTGATGCCGACAACTTGAGC
ATGGACCACGCATAAAAGATCTTACCTTTAAAATCATTTGAGCAAGGCCTGAGGGAAAGG
ACAGCTGACTGAATATATGCTCGGCATGCTGGAGGCCTGGGTTCCATCCCCGCTTGGTAC
ACTGCATGGACCCTCAAGCACCACTGGGTGTGGGGACACCCCCCACGCCCCAGTAATCCA
TTATGTTATATGAGATTTTGTAAATATGTATCATGTCTTCATTAAAAAGTAGAAATCCAG
ACTTTTTACATGATGTTAGAAGGGTGGGAAGTTACCTGCTAACAAAAAACTCATACCTCT
TTAAAAATGTAGGTTTTATTTACAAATCAGGTCATGGTTAAAATTCAAACCTTATCAGGT
GAAGACATTTATCATCATTCTGGGAAGCTTACAGTGTGTTCATCTTCAGTTAAAGTATCC
TTTATTCCCTGGGAGTTGCTTCAGATACACATTAAGGCCTAGGAACTATTATTTTCTACG
TGTACTGTTCTCCAGCATTTCCTGAGAAATGCTTATGACAGAAATCCTACTTTATATTTG
AGATTTCCACATGTCTTCGGATTAGGCTGAATTTGCCTGTTGGGTCTGGAATATACCATT
TTTCCCAAACATCAGTATATGAAGCAGCTCTTCCCCATGGCTTAAAGTGCCCATTCCAGT
GGAGTAACTTTGCAGCCTTTACGAACTGGGGTGAATATCGTTTCCCAGCACTGGAACCTT
GAATAGAGGAAAAGAACCAAGTGACTGTGCTGGTCTGCAATACAATAATGCACAAAGCTT
AAGGGAAACAATATGGATCATTGGTGGTTAGTTTACATGTTTGAATTGCTACTCACCGAG
GTGGCGAACATTCCACATTGGGTCAATGGTGGAATGCTGCTGATAAAATACAATGAGGAG
AGGCGGCGTTGTGATGCTACCAGCAAGTGTTCTGCTATACAATCCCTCTCTTGGGAGAGG
TAATAACACAATGGTTAGTGAATAATTCTGGTTCTTGTTAAGACAGACCAGCCCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1057, 1734..1871, 1961..2071, 2258..2341, 3928..4060, 4822..4934, 5177..5303, 5782..5869, 6547..6721, 6831..6973, 7056..7192, 7279..7451, 8337..8399, 8469..8534
1001..1057, 1734..1871, 1961..2071, 2258..2341, 3928..4060, 4822..4934, 5177..5303, 5782..5869, 6547..6721, 6831..6973, 7056..7192, 7279..7451, 8337..8399, 8469..8531
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved