Sorex_araneus Locus FIP1L1
snOPY snoRNA Orthological Gene Database
Sorex_araneus FIP1L1
Sorex_araneus
FIP1L1
GeneScaffold_6364
SNORA72
59454..59587
126405
ATTTCGTGATCACCATGTCAGAGAATATTATGAAGCACTGAAAAATGAACACAATTTGA
TATATACTAACATAAAATCTTTAACAGAGACACTGTTAGAAAGAAAGGGAAATAAAGGAA
AGCGGCAGAATGATACACATAGTATTACTGTATCTTGAAAACTCTTAGCAACTTGGTTTT
CCTGCCCTAGCAATACACACCTGAAGCCGACACACAGAAAACTGCGGAACTTGCACACTT
CACAGAAAACAAGGGCTATCTCTGGAAAAGTGGAGGTGTTTGTATCTGTAATGGTCTAGC
AGGGAGAATGCATCAATCATATCTTAGTTTTTTGTTTTAGTTGGGTATTGAATCCTGCAG
GTAGCCTGGAGTGATGATTTCAGTCACGAGAAATGAGTCCCTTCGTCACAACTCTGTGTC
AAGCCATACATACGTATACCATGTAAAGGATAAAGCCAAATCTTTCGGGAGAATAAAACC
AGAAAGAAAAAGGAAACAAAAAAAAAATCAAAAGGTGTAAATGAAGCACGGGCAGGTAAA
GGCAACAGGGATCACCAGAGGTAGGGAGGGGGAGGGGAGGCGCGGCTGACGCAGACGCGG
GCGAGACAGCCACGCTGAGAGGCAGAGCGGGATTTCTTGGGGGCGGGGCCTCGGCCGCGC
GCAGGCGCCGTCAGGCTCAGGTGGCCGCCGCCGCCGCCGCCGCCGCCGCGGAAGCGAAGC
CGCCGGGAGACGCCGCGCCGCTGGGTCGCCGCTGCGCGTGCGCAGAAGCCGCGCCGCGCC
GCGCCGGAGCCCGTCTCTGCCGCCGCGACCGCCGCCTCGGCCGCCTGCCCGGGCTGGTGG
GGGGAGGGGGTCTCGCGCTTTCTCCGTTCGCTAGTCGGCGGCTTCGCCTCCCGCTCGCGG
CGCCCCCAGCCCTCCCCGGGGCAGCGAGGTTGGGGGAGCAGGGTTGGAGGGGGCTGTGGA
GCGCCGGCTTTCTTAGTATTTAAGTGGCGCTCGGGGCGGCCATGTCGGCCGGCGAGGTCG
AGCGCCTAGTGTCGGAGCTGAGCGGCGGGACCGGAGGGGATGAGGAGGAAGAGTGGCTCT
ATGGCGGTACGGAACTCCCTGTCCCTTCTCTCGCGCGCTTCTCCGGGCTCCTCCGGGCCG
CCTCTCCGGGCCCGCCGCGGCCCGGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNTTTTTTCTCGAAATAGTTTTGAGTACATCATGTAAATTTGGAGGGGAC
TTGCTTCAACATCTGGTCTTTAACTTTTTAAGTCGCAGTCCCCCGGCTGGTTTTGAAAGT
GAATATTTTTTTCCTTGCCTAAAAAGCATATTCTTGATTATCTTTGAAAGTAGCGTGAAA
TGGCACGTTTGGGCACCAGGCAGCTCCGTAATGACGTCACTTGAACACACTCACTCTTGA
TTTGGAGAAACAGTGATCTCCAGTGTAAAGATTTTTGCATTAGTAACACTGAAATGTTAA
CGTGTAGGAGTTCCTTGAGCAACCTTTCGAACTGACTTTTTAATTAAGCTTATTTTTATA
GAAGTAAAGTTTGCGTTTTTGTTGTTATTTTTTCCTATAAAAGACGTTTCTTGTGAAATC
ATTGTAAAGTGATCTAACTTTGGATGTGCTTATAGGCCCATGGGACGTGCATGTGCACAG
TGATTTGGCAAAGGACCTAGGTTAGTGCTTGTGATGATCACTTCAGATTTTTATTATACT
GCTTTCCTTAGCGTGATTTGTTTTTTGATTTAATTTATTTATTTGTGCGTTTTTCTTGGT
AGATGAAAATGAAGTTGAAAGGCCAGAAGAAGAAAATGCCAGGTTAGTGGAAATTTCTCA
TGGATTTCTACACTGACTATGTGATCCAGTGTAGTTGTGTTGACCAACATTTTCTCATTA
TAGTCATTGGTTTGATTACAACATTTTGACTGAAAGAGGATATTAAAAGGTTGCACCTAT
TTCAGTACCTATTTCGTTTCGTTGCCAGTAGCTGGAGGAACAAAGTTTTTGAAGTTAAAG
ATGTGATTACTATTCACTCATTTTTTTTTGTTTGTTTGCTTTTTGGGTTACACCCGGCAT
TGTATAGGGGTACTCCTGGCTTTGCACCCAGGAATTACTCCTGGCGGTGCTAGGGGCACT
ATATGGTTGACCGCATGGAAGGCAAAAGCCCTACCCGCTGTGCTGTCACTCCAGCCCCAT
CACTATCAAAATTTTTTAATGATGTTATGCACTTTTGGTTCTATTTAAACATTTTGAGTT
TAATTCAAAGTGTGATTAGTAAATTTGTTATGATTGTGTCTTTCTCTGATTACTAAAAAG
GTATATAATACTGGGAGCCAGAAATTTGCTTTAAATTTCAAGACAGCACATGTATATAAG
TTCATAGACAGGCTGAAATTAGTCTCATTAGATTCCTGAGTCTACTTTGTTGGGGGAGGA
CTGGCTAGGAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTCACATTTCTATCACTTTTTTAGTTTT
TAAAAACATTAAACTTACAAAGAAGAAATGGAAACATTGGTTATATAGCTCTAAACCCAT
AGATGGAACAAATTGGTTACTTTTTCAGTTACTAGATGTCGAAGATGGATTATTGAATAT
ATTTTATTACTGTTTATGTTGGTATAGAAAGTGACTGAAACTGAAGATGATAGTGACAGT
GACAGTGATGATGATGAGGATGATGTTCATGTCACTATCGGAGACATTAAAACAGGAGCA
CCACAGTATGGGTAAGTTTTTAAATTTTAAGTTTCAAGTCTTACGGTGCTGGAAATTGAA
CCCAGGACCACATACATGAAGCATGTACTCTCCCACTGAAATACATCTTTTGTTCCTTTA
AGTAACAGTTCTGTATCAAAAGCTGAGTGCCATAATTAAGACTTTAGTGATTGATTTTGT
TGGTTTTAAATTTTTTATCATATGATATGAAAGAATTCTTATTAAAGTTTTACTTTGAGT
TGCTAAGAGAGTATCTTAAACATTCTCATAAGAAAAAATTAAAACTGATGATGAATGTTA
ACTCGCTGTGGTCATCATTTTGCAATTTATATGTATATCAAGTCATGTTGAACACCTAAA
ACAAATACTTTGTTATTTATGTCACAAAAAATACTTAGCCATGGAAAACATTTCCTTCCT
AATGGTGAATATGATTATAAAAGTTGCATGGAATCAGCAATTTGTAATTCTAGAACTGAA
AGTGTTTTTGTAAAATGGGTGCTAAAAATTTTTAGATTTAGAAACTATTAAATTGCAGCT
TGTATTCTTCCGTTTTATTGCTGTCCAATCTTGAGCTTTGGTTTTGTATATGTGTTGTAT
ATTTTTTAAATAAGGCCAATTGGTGGTGGTGGTATTCATGGTCCATGTGCTGTCTGGAAT
TGACTACAGGGTCAATTCCACACATTAGGCATGTGCTTTTATTTGAGCTAGTTCCCTAGC
TCTAGGATTTTAATATTTTTATTCAGCTTTTTAACTGATTTTAAATCAGGTTTTTTTTAA
AACTCTTTATGGCTTATGTTTCTTTATTTTTGGGGGAGTCGGGGCACACTCAGCGATACG
CGGGTTACACTGGTTACACTGGTTACTTAGGCTCTGCACTCTGGAATCCATATGGGATGC
CTGGGGTTGAACCCAGGTTGACTGCATGCAAGGCAGGCACCCTACCCCACTGTACTATAG
TTCTGGCCACTGTAGCTTATTTTTTAAGTTGTTAATTATCCCTTAGGCTTTTTAGTTGTG
TTAACTCAGTTTTATGTTTTGTAAACTAGATCAAATGAATGAACTGTCATTCATTTGTCC
ATCCAAATACCTTTACTTGTGGGGTGAAGGGAGACATTTGAGCCTCACCCAGCAGTGNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGATTCATGGCTGTTTGAGCAGC
AGTTCAGAGCTGTTTGTGCTGTGAGATGCTGGTGCCACCAGGGTTGTCGTGACAGTGCTT
GGTATCCCTGTATAATAATCTGGCAGTATGCTAGGGATCAGCTTGGGGATCAGTATGGGG
ATGATGACCAGGTCATGCTCATGTTATGTATGTGCCCTAACCTCCGTACTATCTCTTAAT
TCCCAAATACATAAAATTGAATTGTTTCTTTTGTGGAAGAACCCTCCCTTTGTTCAGGAG
GCCCAGGCACACTGCAGGTGATTCCCAGCCCAGTTGGTAGGTGGTTTAATTTGAGGCCCA
AAGTATGTGGTCTGGTTGTCCCAGTGGTGCTCAGGTGCTTCCAAGGCCACACCTGGCAGT
ACTTTTGAAGGCCTTCTGCACTATCTTTCTTGATCCCAAAATATGTTTTTTTTTTTTAAT
CTTTTTAATAAGTGACTAAAAATTAAGACTTTTTTTTCTAGGGGCCAGAGAAATAGTACA
GTGTGTTAATTCACTTGCCTTGCCTGTAACCAATCCCACTTTGATCCCCAACACCATCTG
GTCCCCTGAGCATTGCTGATTTGACTTGAAGGTCTCTGAGCACAACTGGGGTACTCTAGA
TAATCCATGGCACTGCAGTGCCTGAAGAACATTGTATTTCAGACCCAGGCATTGAACTGC
TGACCACAGAATGGCAGGAAGAGGCCCTTAGGCCCGCCAAGCAGCACTTCGGAGCTCTCC
CCAACGCCCATTTTTTTAAAACATGTTAGTCAGCGTCAGTCTGTATATGTATATTGTATG
CATGGAATAAATTGCTATTTTTGTTTAGTTCAAGATTATCAGGATAATTTTTGTTGTTCT
TAGGAGTTACGGAACAGCACCAGTGAATCTTAATATCAAGACAGGAGGAAGAGTTTATGG
AACTACAGGTAAAATTTTTATTTGCCAGTGCATCAGTAAAAAAGTATTGACTATAGCTGA
ATAACACTAGACTATAGTAGCTGTCACAGGTGATCTGAAAAGTCCTTCAGTTCAGTCTAA
GAGAGTAATTGCAACTATGTCTCAAGGATGGGAAGACTTCTCTGTGAGAAGCTACATAAA
AGAATAATGTTTGTAGTTGTGGGTAACAGGATTCTTTTCCCCCTTTTTTTATTTTTGCCT
TTTGGGTCTCACCCTGCAATGCACAGGGGTTCCTTCTGGTTCTACACTCAGGAATTACAC
CTGGTGATGCTCGGGGGACCATATGGGATGCTGGATATGGGATGCTGGGAATCGAATCCG
GGTCTGCCGCGTGCAAGGCAAATGCCCTCCCTGCTGTGCTATTGCTCTAGCCCCTCTTCC
TTTTTTGATTTTTAACTTGTTTGTACAACCTTGTAAAACCTGTTATAGTTCACAGCATAT
AAAAGGTGATTTAATACCTGGAAGTTAACAGGTACATACTGGTACAGGAATTTATTTGAA
TGAGTTAACAAGTTCCTAATCCGTATCCTTTATCTTAGAGTTTCTTCCCTAAAGTTTAAG
TTTACTGTTATTGATAATATGCTTATTCTTATAGTATGCCTGACTTTAATGCTCTCATCA
GAGCCTTTGTTATATTAAGAGCTATCATTAGTAAAATGGTGTTTTCTCTTTTTCTCTTAG
TATCTTGCTCATACCATTCTTTCTCTATTTGCATTTGTTAAAAAAGGAACAAAAGTCAAA
GGGGTAGACCTTGATGCACCTGGAAGTATTAATGGAGTTCCACTCTTGGAGGTAGATTTG
GATTCTTTTGAAGATAAACCATGGCGTAAACCTGGTAAGATGATAAATGATTTCATACCC
CTCTCTGGGAACAGCCTCAGTGACGCTCAAGGTCCTGCAGCCCTCAGTGCATGTGATACT
CAGTCTTCTGGGATGTGCATTGTGGTGCCAGGGAGTGGGGCTCGAGGCTACTTGGCATCT
GCTCTAATACTGGAGCTGTTTCCCCGGCTGAAGAGGCAAGGATTTTCCTTGGGGACACCT
GATGGTGCTTGAGGTCTGCTGGCAGTGATTGGGAACCTTGTGTGCTTGCGATCAAACCTG
GGGCATCTGTATTCAAAGCATTTGTTCTAGCTCTTTGACTTATCTCTCTGTATTGTAAAT
TTTAAAAAGATGTTTAGTATTAAAGTCATTAGAAAAATATATAACTTTCAGTATCAATAG
TATTAATAGGATTTTTGTAAATGTCGTTATAATTGTCTTAAGCATAATTAGCAATAATGA
CCTATATTGTACAATTGTAATAGTAGTTTGACCTTATATTAGACTTGCATAGCATACTAT
TTTATTATAATGCCATTTATAAAGGAAATAATTTTCATTAAAAACATAGTTTTTGTGGTG
CTAGGGAAATAATTGGAAGAACTAGTAAAATTTGAAGAGGTGTTTAAACTGATAGACCGT
ACCATTTACATCTTTTTCTTTTCTTTTTTTTTTTTTTTTTTGCTTTTTGGGTCACACCTG
GCAATGCACAGGAGTCATTCCTGGCTCATGCACTCAGGAATCATCCCTGGCGGTGCTCAA
GGGACCATATGGGATGCTGGGATTCAAACCCGGGTCGGCCGCGTGCAAGGCAAATGCCCT
ACCCGCTGTGCTATCACTCCAGCCTCCCATTTACATCTTTTATATTTTATTTACTGCATA
AAAATAGGATTGAAATACTTGCATACAAAAGTTGTGTCTTCTTTTTAGGCGCTGACCTTT
CTGATTATTTTAATTATGGATTTAATGAAGATACCTGGAAAGCTTACTGTGAAAAACAAA
AAAGGATACGAATGGGCCTTGAAGTTATACCAGTTACCTCAACTACAAATAAAATTACGG
TAATTAGTAAATATTTCAAAATATCCCTGCCTTTTCTACTGTCCCACTTTTTTTCCCCTA
ATCACTTTTCCCCCATAAAGGTGATTAAATACTATGTTATAGTTTAAAATTCCATTCTTT
TTATCGTATTTTTTCCCCTTCCCTTTCACAGTTCTATGTTAATGCTTATCTGATATTTAG
TTACAAGTCACTGACTAGCCACAGCTAGTTTGTCTTTGTATGGCCTATCAATTCAAAATT
ACATGGTATCTTAATGGGGAATATGTTATTTAACTTAGGCCGAAGACTGTACTATGGAAG
TTACACCAGGTGCAGAGATCCAAGATGGCAGATTCAATCTTTTTAAGGTGAATTTTAGTA
AATTATCCTTGGTTGCTCTCATTTTTTGTTCTTGAGTCTGCTCCCATACCACTACTCAAG
GGACAAGATTGAAATGGAAATAGCTTCTTTTTTTCCAAACCTTCAGCTTCCTGGTGACTT
ACAAGTTTGCTGATTGTTGTTTTATCTCCACTCTTGCAAGCATGTGAATTTGTTCCCTAT
TATACTAACAAATGCAAAGTAAAGTTCTTGCTCTATGTTGTCATTTTATTTTGAGTCATA
GTTTATGTTTGTTTGTTGGATATAAAAGCTTATTCCAACAGGTTAAGCTGTTACTATAGA
TCATAATATAGTCTATCAAAATTGGAGGCTTAAATTTTCCTTGTTTTTTTTTTTTAACAA
AATGGTAAGGAAGATGGCAAGCTTAATATCTGTATAACATTGAATATTGTATATATTACA
GTTTTGACATTTTTAAGAAAAGAGTCTTAAGAAAGTTGTGGGTTTTTAACATTTAAATTT
AGAGTTGCAGGTATATGGGACTTGGCGGGTTGATTCTTCCACTTGGGTATTGAATTTCAC
TTCTGATTGCTCTATTTCATATAATCACAAACCAGTTCGAAATAATATATTTCAGTACTT
CAGCAATACACAGCAACTCACAAATTTTTCTCAAAATGTGGTTGTGTATTCCTTTATCTT
ATTTCTTGTTTCTTTTACTGAATGCCACCTGGACGAAGATTGGGAATAACATTTAGATTG
GGTAGAAAACTCTTTTGTGGGCAGGAACATTTCTCTGCCTCTTTTAGGACTACAGCCCTT
TCCACCAAATTCTACCTTGTGCAATGCGTATGCTATATCTGCAGATGTAGCTGCTCTGCT
GGACACAGTTCTCTCTAGAGAATTTAATTTTAATTTACATCCTACTTTGGGTAAGTATTT
GGTTATTGTTCTGCTGTAAATATTTTGAAAGGGCCTGCTGTTTCATCTTTTTTAAATGAT
CATTAGGTTTGGGTTTTGGTGATGTTATGTATTTTAAGGCATTGAACTTACTGTTGTACA
TTATTTACAATGACTAGAAACATTTTCTGGAAAATGAGTTAATTTTATTTTTAGTGGTTC
TTTATATTTTCCTTGAATAGAACTGAGAAAGTCCCTTTGTAAAAACTGCCGTCTTCTGTA
TACTTTTGTCTCTGCAGTAGACCTCTAAAATTAAAGAATATAAAGGAAACTGGTTTCCAT
TGAAGGTAGCCATCGTGAATACATTGTTGATACACATCCTGCTTATTGCAAGTTGTTTTG
AAGGTTTTTTTTCTGGTTTTGAGTAGAGGTCATTTTTCCATTTTAATTTTTGATTCTGAA
TGAATAAGGGTTTGAGTTTGATAAGTATAGTCTGTTGGCTTTTCTTACCTTGATAATGTG
CTTAAATATTGCTTGTCTTGTAGAATTACTGATTTGGGAATAGGGTATGTATTTTTTTGT
TTGTTTCGGGGCCACATCTGTTGGTGCTTGGGGAATATTCCCATCTTGGTGCTCAGGGGT
GGCTTCTTTTGATGATGGGAACTTAGTGGTGATGGGGATTAAACTTGGGCCTCCTGCATG
CAAAGCATGTGGTCAGCCCATTGAGCCATCTTTCCAGTCGTTCAACTTTATTACTGTGTG
CAGCTCACTTTGTTTTTCATTTTGCTTATTGTTGTCTGTAGGATCTTTTTAAATTGATAA
TGCTAAAAAGGTGAAAATGTGTTTGAGAGCAGTTGATATTTTTAAGCTGCAGTTTAAATT
TCTGAAAGTTATGTTAAATTTATGATGTTCAGATTTCTGTCCACTAATACTTTAAAAAAA
TGATTACTTGTCTTTTACCATGTGTCATGTAAATGGTGGTTACTTAAATATTACAAAGAT
CTTATCAATACTGCAAATAGGAAGAGGTAAATGTGTGAGTTACTAAGTGCCAAAAGGCAT
ATTTTAGATAAAAATATTTGTTTCTAGAAAATTGCAAGAAGTAATATGAAATCAGATATT
ACTTTGGTATTATAAAATTATATTGAGATGTTAAATATAGCTTGTTTCTGTGCTTACTAA
AAATCTTTAACTATAGTAATTTTATTGTGGTACTGGAATTTACAATACTTTAAATCATTG
ATTTTGTGCATACATCATAAAAATCTTTAACTATGTTAATTTTATTGTGATACTAGGATT
TACAATACTTTAAATCATTGATTTTGTGCATACATCATTTTAGTACCACACATAACTAAT
TCCCTCAATTGATATCCCAAGGACCTTTCCCAATTCTCCACCCTCCCCACACCAACCTTC
ATGCGACCTTAGTTCTATAGACAGAAACTTGTTTGTTTTTTTGTTTTGTTTTTTCTTTTT
TTTTTGAAAGAAAAACAGTATGCAATATTAGAGAAGTGTGTATTACTTTATTGGGTTTGA
GAGTATAGAGAAATATCTAAAATCGCAGTCTTAGAAGGATCTGAATGGACACTGATCATT
GAGAGATGAGTGAGGTTTCATTAGTAGGGTCATAGGGAGTATAGGGTCTGTTGACAGTGA
ACAATATGATCAAAACCAGAAAGCATGCAAAAAGTTGGGAGGGATGGCAGATACTGAGAG
AAGTCTGGAAATGGTACGGGGGCCATAATGGAAAAAGCTTTTCATCTTAAACTAGTCTGC
AGACATTTGTGGGTAATAGGATACCATATGAAAGTTCTTACAGAGGAGAATAATAACATG
AGCAAATTTATTTTTTTATAAATGGAACTGGCCACAGTACAAGGAGGAAATAGAATATTA
GAGACAGGATAGGAATTATTGGAGTACTCTAGTAATACAATTTTTTTTTTTTTTTTTGCA
TTTTGGGTCACACCCGGCGATGCACAGGGGTTACTCCTGGTTTTGCACTGCTCAGGGGAC
CATATGGGATGCTGGGATTCGAACCTGGGTTGGCCACGTGCAAGGCAAACGCCCTACCCG
CTATGCTATTGCTCCAGCCCCTGCACTAGTAATATAATTGCTGAGGGCCTGAACTAAGTA
TGGGAAATGAACAGAGGAAGTACATTAAAAATCATAAATTTTTAAAAAAATAACTGCAAA
GATTTTTTTGAGGATTGTCTTATGTCGAACCAGGAAGGGTTTTGTACATACAATTTTCTT
TCAATCACTAAAGAAGTTCAGCCACTGAACTAATTTTTTTAAAAATAAACAGAAACACTT
CTCATGTTAACTTTCCAAATACACTCGATAGGATAATACAGAAGAGCTTCTACATGTTTA
TTGTACTCTATTATCAAAATGTTGACAATTTTGAAGTTACTTAGAAGTGGTTTTGGTTTT
TTAAATGTGGGGATGTTTTTTTAAGCTTTCTAAATTGAAAAGGGAGAATTACATTTAGTT
TTTACATGATTAATAAATTTGAACTTGGAATTTACAGATCCAAATTATAATTTAAATTTA
ACTATTTTTATAGCGCTTTCAAAAACTTTTTTTTTCCTTTTTGGGTCACACCTGGCAATG
CTCAGGGGTTACTCCTGGCTCATGCACTCAGGAATTACTTCTGGCAGGGCTTGGGGGACC
ATATGGAATACTGGGAATTGAACCCCGGGCAAACGCCCTACACTGCTATCACTCCAGCCC
CCAAAAACAATGATTTTAAGCACCATGATTTACAGTATCATTAATGATACAGTTTTACAC
ACACAACATTTTAATACCATGCCCTTGACCAGAGTGTCCACTTCCCTCCACCATTAGCAT
AGTGTCTACCCTCACCAGTCCCACCCACCCCCACAAAAAATTCTTCCCTGTTTTTTCCAT
GATGAGCACAGTTCTGTAGACCAGTTCTGAGACTTTGTTGCCTTTCAACATTTACTATGT
TCAAAAACATTTACAATTTTTTATTCCTTTACTATGTTTCTTTACGTCTCAGATATGAGA
GATCATTTTGTGTCTGTTCTTCTGGCTCACTTCAGTCATTATGATGCTGTCCAACTCTCA
GATCCATCCACATAGTGGCAAATTGCATGATTTCATGTTTTTATAGCTCTGTATTTCCAT
TTTTTTGTGTGTGTGTATATACTATGTATATATTATGTACCTTAGTTTCTTTATCTAGTC
ATCTATTCTTTCAAAATTGTTTATTTTATTTTTTAAAGTGAAATGAAAGAGGAAGTTTAA
TAGATATAAGTAAAAATAAAATTGCTCAGTTGTATGCACAAACTTGTACAGTTATAATTT
GGGATCAGGGAATAGAATGGTGACTAGTGAGATTGGTTGGGCAAATATGTGTGTGCATGA
AAAAAATGACCATATTCCTCTCAGACTTTTTCTGTCTGTAACATGTACATACATGTGTAG
ATTTCTCCATGCAAATTTTTGAAGTTTATTTTTTTGGGCTGCAGCTTTGGCTTTTCTCAA
ATGTTGATCCTTTTACTTCCATGAGTGTGCTACTGAGATGGTGATTGTATTAAAGCTTGC
TGATTGTAGCCATCACTATAGGGATGAGTCTTTAGGTTGTTTGCCTTTTCCCTTTTTTTT
TTGTAGACTGATTGTTAATAGGAGACATTCACTGTATCCTTGTAGAAGGTATATTTTTTA
AGGCCCTCCCCCCTTGCACCCCCTCCATTCCTGATTGGCTCTTTCGGTTACGTTGCATGG
TGCTCATTTCCAGTGTACTGCGGCCTCGAAGTGGATCAGAAAGTGGGCACTCGGTCATCT
TAATCCTTCTCCTGGTTTCTTTGTATTTTTTTTTTTCTTTTTGGGTCACACCTGGTGATG
CACAGGGGTTACTCCTGGCTCTGCACTGAGGAATTACTCCTGGCAGTGCTCAGGGGACCA
TATGGGATGCTGGGAATCGAACCTGGGTTGACCACGTGCAAGGCAGATGCCCTACCTGCT
GTGCTATTGCTCCAGCCCACTGCCCTTGTTTTTTTTTTTTGTTTGTTTGTTTGTTTTTAA
GCCTTATCCTGGTTTCACAGTAGGTTATACTGATTTGACTGTTTATCTGGGAGCTAGAGT
TGTCATTCCTCTGAACTTGTTAGGTTCCTGCCATGATAATCATTATGATTTTGCTTTCTC
ATTGCTCAGGTAGGATTCAGATTTACTTAGATCTGCTCTGTTGTAAAATTGTTTGTGCTT
TCAAAGTTCTAAAATTTTGTTGTTTTCTCTTTTCTGTTTTTGTTCTTACGGATGAAGCAA
AGTTGTGTGTGATAACTTGGGTTTTCTAGTTTGCATTTTTTCACCTAAGTATACTGTGTA
TAAATGTTTCCATAGGTTATGAAGTTTTTTAAGTAAGTACTACTTTTAAAGTTGCATAAC
CCTATATTGGCATATGTTATAATCTTAACAAAATTTGTTTTTAGAAACTTTTTTTTTGGT
AATATTCAACTTTTATAAACAGTGCAATGAATGTCAGTTGAAGGAAGTTTTACAAAGTAA
TCTTTGTACAATAGTACTATTATTTTGGTAAATATTCTCTCAGGATTATAGACTTTAGTT
AATTTTCAGTTGGCTATGTAAGATCTAATACGAATTTACTTTAGGAAGTCAGTCATGGTG
TTTTAAAGGTTATTTATTTTATTTTTATATATTAAAGGTTATTTATATTTATTTCAAAGG
TTATTTATTATTTAAGTTTATATTAATTTTTGGAATTTGGGCCACAGATGGCAGTGCTTG
AGGCTTACTTCTGAAGGACTCTGAGACCATGTAGGGTGCCAGGGCTCATACCTGGTTTTG
TTGCATGCGAAGTAGGTGTCCTAACCCCTGTACTATCTTTGGCCCCTTAAAGGTGATTTT
TTTTGAAATAAAAGAACAGGTCGAAAAAGTCTGTGTTCTGGTTAAGGATATTTTGAGTAT
AACACAAATGCAACATCTGAAGTGGAACCTAGATAATGAAAATGCAAGTCAAATTGGAGG
TTTGTTTAAGTGGTGAGGATTTTTAGAATTAAAAAAAATTTTTTTAATGCAGTGACTTCA
AGAATTTAAATAGAAAATAAACTGAAAGTACATATGCAGTATTTTTTGTTTTGGGGCCAC
ACTTGTTGGTACTCAGGACTGACTCCTGGCTCTGTGCTCAGGGATTACCTGGCAGGCTCG
GGACCATATGAGGTGCCAGGGATAAAACCTGGGTCAGCATGCAAGTCGACTTGTACTTCC
GCTCCAGCCCCTATACATGCAGTTTTTACGTTTAAAAATGCAGTATGTCTTCCTGATAAC
CTGTATCTTACTTTTCCCTTGTTTTGTAAATCTCTTTACACTTCTTCAAATTCTGTGACT
TTCCCTCTTCCCCAATTTTTTTTTTCTTTCAGTTTTTAGTTAAGCACTTATTCTCCTAGA
CAGTGTTGGGGATAGGCATTTTAGATATTAGCATTTTTTGTTTGTAAAGAGTTTGTGACA
TTGAGAAAGACAGGTATTAATCATGTCAGAAGTAATGCAGTCATAAATATCATGGCCTAT
GAAGAGACAAAGATTTTGAAGAAGCATCCTAGCTGAGTCACAAAATCAGTTAAATAACAA
ATGTTAATTGCATGCCAGGAACTGGTTTAGAGACCAGGATAGTCCATGAACAGTCCCCTG
GTGTTTGTTTGCTTGATTATTTTGGGCATACCAGGAGGATTATATCTGACATTGTTGAGG
GGGACTGTTTGGTGCCAGGGATCCAACACTGGCCTCCTGTGTTGAATCTGCTCAGCATCA
GCTCAGCAGGTTGAGCTTTCTCTCTAGCTCCAGCAGGCCAAGATATTTTCTTTTATAATG
TCAGCAGACCGACATATAACAAGATAAATGCCTTTAGAGAATGTAGTGTGGTGATATATT
ATTTGGGAAAGGTCAGATCGTGCCAAAGAGACATCGGAATAATACTTGAAATGATTACAA
AGTAATGTCCAAGAGAGATAATCTGTGGGAGAGACTGTAATAGGCAGGCAGAAGGCATAA
CCAATGTAAAAGGTGATAAAGGATCAATTTATATGTTTAAAAGAAAAAGCTAAAACGTCA
TTGTGACAAATATAGTATAGATAAGTGGTAAGGCACAAAGGAAAGCATGGACAAATAGGC
AGGGCTCATAGTCAAGTAATCTTAAGTTACACATAACTTCTACACAGAAGAAGTTATGTT
AAGAAGAATCTTGGGGCTGGAGTGATAGCACAGCGGATAGGGTGTTTGCCTTGCACGCGT
CCGACCCGAGTTCGATTCCCAGCATCCCATATGGTCCCCTGAGCACCGCCAGGGGTAATT
CCTAAGTGTACAGTCAGGAGTAACCCCTGTGCATCACCAGGTGTGACCTTAAAAAAAAAA
AGAAGAATCTTAAGTTACACATAACTTCTACGTAGAAGTTATGTGTAGATTACTGGAGCT
TAGAGGAGCAGTTGAGAACCTGACATCAGCTCTGGCTGCTGTTCTTCCTCACATCCCCAG
GAAGAAGATCGAATCTATTTTTTTTTCTTTTTTTGTATTTCCTTATTTAAAAATATTTTT
TTCAGAGTTTTTATTGTATTGTTATGTTTGACCATGTCTCTGTCTTTTCCACAAACGGGG
ATTTTCTAGTATTTCTCTCAAGTTTTCATTTTTGGTGTGTGGTCATTAATAAATGCTGGA
TGAATGAGTGAATCATGTTTATTTCCTTAAATTCTGTTAATTTTAATTTTCATATCCATC
TGTTTTTCTCATTATTTTTAGTGCTCATCCTCATCATCCCTCATATGGATTAGTGCATTT
TAAATGGATTTTTTTTTGGCAGGGGGAGTGGTGTTTGGGGCCATACTTGGTGATGTTCAG
GGGTTACTCTTGGATCATTCCTGGTGGGCTCGGAGGACCAATAGGATGTTGGAAATTGAA
CCCAGGTCAGGTGCATGCAAGGCAAGCTTCCTACCCACTATATTTGGCCCCTAAATGGAC
TTTTTTTTTTTTTTTAGCAGTGGGCTCATTTTCAAGTAAAATACCAGTGTTTAATCCTAA
ATATATGAAGCTACCTATTAGAGATTGGGCTCACTGTTATTAGTGTTTGATAATACATTA
GTATAAGATAATACATGATTAAGACATAGTTGGTTTCTGGAATTGAGTTCATGGTTCCAT
GTTTTTGTCTGAGTTAAGGTGTCCTCTGGCCATAAGCTATTCCTTTAGCCTTTGCATCAT
GGGGGAAAGAGTGATGATAAAGGTCAAAGGTAGGGGCAACAAAATAAGACATAAATTATG
TGGGATGCTACTTAAGTATAGAATAGCTTCCCAATAGTTATTCTATCCATAAACCTTTTG
TTCTTTTGTGGAGTGGGGCACACCTGGCTGTACTCATGGTTTACTCCTGGCATTATGCTT
AGGAATGACTCCTTTTTGGGCCTTGGGGCACCATTTGTGGTACTGGGGACTAAACCTGGG
TTGATCACATCTAAGAAAAGCCCCCTTCTTGTTGTATTATCCTCCAGCCTTATAATTTAT
TGATAAGTTTTAAGAATGCACGGTGAGTACAAAAGTAAGAGAGTATTAAAAAAATCTAAC
CAGTTTAAAAAGGTGTGACTGTGCTGTGTTCAAATTGTCTGGTGGAAACAAAGGATTGAC
AAATCCGGGAGAAATCATGAAGTAGACACCAGGTTTGAAAATGAACATAAAGAGAGAGAA
GAACTGTTAAGAAGCGATAACTGACCAAGCTTTTGGATGTACATTAGTAAATATACATTA
GTAACATACATTAGTACATTACTTATTAAAGTAAAGCTCTGGTTCTGTTGCAAATCATGG
GAGAACATAGGAAATAAATGGCATGAAATAAAAGAGCAAATTATTAACACTTGCTATTAT
GGCATGCCTTATTCTCAATAGAAAATTATCAGAATGGCTAAAATGACCCCTGCTTATTTT
CTTAAATGAGGGAAGTGCCCCTGAAAGGGAAGAAATCTTTGAGGCTTCTCTTCAGCTTAC
AAGTAGGGGATCCTGATTGAATATCTTGGACTGAATGGTCATCTGAGAATTCATCAAAGC
CCTGAAGAGTTAAGGTTTATTGGAATCTAGTGACATTTTGTGAGCTTTTTTAGTAGTTGA
ATAGTGACAGTTTGTGAACATTAAATCTCATAATTCCCTTTAACTGATACTATATTTAAA
TAGGTCAGTTTTATATAAGCAGTCAGCAATGAAACAGTCTTTCATATACTTTCAGATCAA
GGGTACAAATTTATTTTAACATTTGGAAACTTTACCATCCTCAGTATTGAGTTTTGCATT
CAACAAGCTCTAATGACCCTTTCTTTTAAGGTACAGCAGGGAAGAACTGGAAATTCTGAG
AAGGAAACAGCACTTCCATCTACAAAAGCTGAGTTTACTTCTCCTCCTTCTTTGTTCAAG
ACGGGGCTCCCACCTAGCAGGTGAGTGAGACCGCTAGCTTATTGAAGACACTGGCATCTT
CAATTGCATTAGTGCTGTACGAGGTAGAAAAGCACTGGGTATTCTAGCAGGAAAAAAGTA
AAAACCCAAAATGCAGGAACATTCTATTTTGATTGAGTTTATAATGCATGATTTTTGTAA
ATTTCTGAGTTCTTTTCTAACTTTAAAACAATTAGGTAAGCAAGAAATGAAACATGGTAT
ATATATGTATGTATGTATATATGTATGTATTAAGAGACGACACTCATAATCAGGAGAGGT
GTTTAACAGTGGTCTTTCTATTTTCTCTGTGTTTTTTGTTTTTTGATCATTATTTCAATT
AAAGAAATGGTCGGGTAAGGAAAGTAGGCACATCAGAGGTACTCAGGACTTTTTCCTGGC
TTTGCTCAAGAATTACTCCTGGGGATTCTTAGGGGACCATATGTGGTACCTGGGATTGAA
CCTGGGTCACCTATGTGCAAAGGGAGTATCTTACCCGCTGTATTCTCTCTCAGGTTCCTG
TATTTTATTATTGGCTTAAAAAATTACTGAACTTAAATCTATATGTTGGCTTACAGGTGT
TTCACTAATTTTTAATGAAAGAGATTGTAGATTTTCTGTTTCAGAAATCTTTCTGGTTGA
ACATTTTTTTTCCTTTTTCTGATTTGTTGCAATGATACCTAACTTTGAATTCCACATGAT
ACCAATTGCAAAAGGTAAATTTTTATTGTAAACATGAAGTTTTACATTAACTTTAAATGT
AAACATTAAATTTTAATGTAAATATGCAAAGTGGTGAGCCATGTTCCCATATAATGGTAA
ATGAAGGTTAAGACTAGGAAAAGTTGTCAGCAGTTTAATCTTGGGTTAAATGAAGATATC
TTCAATTATTTCTGTAGTCTTGAATTAAGCCTGTCATGAACTAGATCTTAACTAGATTAT
TTACCTTTTGTGTTACTTGTTTTAAGTTTATAGAGTTTTTTTTTTTTTTAATTCTGTAAT
TTTGAGTTTCTGTATGAAACTATATTTCATAAAACACAAATGTGGTAGGAGAATCCTTAT
GTGAGAATTTAGTGTAGCCTTAAAATAGTCTTTAAAACTGTCAACCTATGGAATTTTTTC
TGGTTGCCTTTGGGTCATACCTGGTTCCTGGGACATTGTCCCAGGCTGTGCTCAGGAGTC
TCTCCTGGCAGTGCTAGGCCGCGGGGAGGACATCATGCAACGCTGCGAGATCTAACCCCG
GGCTCCTGCATGCCAAGCATATACTCCAGGCTGTTTGAGCTCTCTCTCCTGCCCGAGTCC
ATAGGAATTTGAGTTGTTTTTGTGTACCTCAATCGATAGCTACACACAAGGCTCAGCACG
AAACTCCAGAGGGAATAGTAACGCGACTGGGCCCAATCTCCAGCACCGCTCAAGAGCAGT
ATCCTGACTCTGTCCCTCCTGACTGACTCACAACACTGCTTCTGGGGACATTTGNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCCGCTGTATTCTCTCTCA
GGTTCCTGTATTTTATTATTGGCTTAAAAAATTACTGAACTTAAATCTATATGTTGGCTT
ACAGGTGTTTCACTAATTTTTAATGAAAGAGATTGTAGATTTTCTGTTTCAGAAATCTTT
CTGGTTGAACATTTTTTTTCCTTTTTCTGATTTGTTGCAATGATACCTAACTTTGAATTC
CACATGATACCAATTGCAAAAGGTAAATTTTTATTGTAAACATGAAGTTTTACATTAACT
TTAAATGTAAACATTAAATTTTAATGTAAATATGCAAAGTGGTGAGCCATGTTCCCATAT
AATGGTAAATGAAGGTTAAGACTAGGAAAAGTTGTCAGCAGTTTAATCTTGGGTTAAATG
AAGATATCTTCAATTATTTCTGTAGTCTTGAATTAAGCCTGTCATGAACTAGATCTTAAC
TAGATTATTTACCTTTTGTGTTACTTGTTTTAAGTTTATAGAGTTTTTTTATTTTTTTTT
TAATTCTGTAATTTTGAGTTTCTGTATGAAACTATATTTCATAAAACACAAATGTGGTAG
GAGAATCCTTATGTGAGAATTTAGTGTAGCCTTAAAATAGTCTTTAAAACTGTCAACCTA
TGGAATTTTTTCTGGTTGCCTTTGGGTCATACCTTGTTTCAGGGACAGTGTCCAAGTCTG
TGCTCAGGAGTCTCTCCTGGCAGTGCTAGGCTGCGGGGAGGACATCATGCAGTGCTGGAG
ATCTAACCCCGGCCTCCTGCATGCAAAGCATATACTCCAGCCTTTTGAGCTCTCTCTCCT
GCCCAAGTCCATAGGATTTTGATTTTTTTTTTTTTATCTTAGTTGATAGTTACAAACATT
TCTGAGTATGATCCTCAGAGGGAATAGGAATGGGACTGGGGCCAATCGCAGCAGTGCTCA
AGAGCTGTTTCTGACTCTGTCCTCAAGACTGACTCCTGACAGTGCTTCTGGGGACCTTTT
GTAATGCCAGGGATCAAATTGGGGTTGGCTGCATGCGACTGCCTTTTTTTATGTGCTGCC
TCGCTGGTGATCATGTTAAATTACTATAATCTCATAAAATGTTTGACTAAAAGGTTATGA
TAGGTGAGGAATATTCGTTCTTACAAAATAATGGTAATCTTTGTTTTTTCACTTTTGAAG
ATACGAATTTCACTTGAGCTTTTGGTATTTGCCATATAGACTGATGTTAAGAACTTGAAT
TTTAAAGCTAAATTTTTTAAATTCAAATTCTGGCTGTTTAGCTTACTCGTTTCTTAGACA
TAGTCTTTGAATCTCCATATTCTGATCTGAAAATCTAGGAGTACTTAATTCATAGAGTAC
TCATGTTTATTAAATATATTAATTATATAGTTGTTTAGTTCCTGGCACATAGATTAAATA
CTCTTTACATTTATCACTTATTTAAATAACTAGTAACAATTTTTCAATGGTTATTTTCTA
ATTTTAGTTTTTAATTTTAATTTGGTTCAGATTATTATATAGGGCTTTGTGGCATTACTA
TAGTTGAAATAAATGAGTCTCTATTTCAGTTTTGAATAGAGGTATGAAAACATCTGCACT
AGGCTTTAAAAGTCTCAATTTAATAATTAAGTAAACTTAGAGTGTTTCAAGCAGCAGTGG
AAGCCCTTTGATGCAGTAAAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTT
GGGTTTGGACTCACTCTGTACTCAGGGGTTACCCTAGCCATGGTTGGGCACCCTGTGTGG
TGCTGGAAAGATTAAATTAATGTTGCTCACCAAAATGGCAAGTATCTTAATTCCTGACTC
TATTTTGGATTCTGTTTTTTGTTTTTGGTTTGAGGCCACACCAGCAGTGCTTAGGGATTA
TTTCTGGCTGCACTCCGGAATTACTCTTGGCAGTGGTAAGGGGAACATATGCAATGGCAG
GGATTTAACCTGAGTTAACTACATACAAGCAAGCACTTTACCCACTCTACTAGTACCTTG
CTGGCTTCTATCCTGAACTCTTTCTAAAGGATTTTTTCTTTTCTTTTTGGGTCATACCCA
GCAATGCTCAGGGGTTACTCCTGGCTTTGTCCTCAGGAATTACTCCTGGCGGTGTTTGGG
GGGACCATATGGGATGCCGGGGATCGAGCCCAGGTCAGCCGTGTGCAAAGCAAACACCCT
ACCTGCTTTGCTATCTCTCCAGCCTCTCTAAAGGATTTTTTAATCCTTTTTTTGTGAGAG
GAGTGGAAAAATGGGCCAGTAGATAGAGGAATAGGGGGGACTATCTAGAGGGAAATGTGA
GGTCAGGTAGTTTTTTCCATAATCAAATTTTATTAATTTACATTAATTTTTAAGCTTGTA
GTAATAGCTTTCATTAGTCAAAGAAACTACATTAATTTGAACAAGAGTACTGGAAGAATA
AAATTGATGATGCAGAAAGTTGGGATACTTCTTAGCACAGGTTCTAAAGCAGATCAGAAG
GTATGAGGTTACCCTTAAGTGAAAAGCCCTTGGATTGTTCATTTATAGTATAAAAGGGAA
GACAGGATAGAGTGTACCACAGAAGGTTGGAGGTTAGGTAATAGTCATGGGGATAACTGA
AAGTGCTCTTCTGATTATTTTATTATTTCCTAGCTACCTGGGGAGCCAACTTTACCTTGT
TGAAATGAGCATGTTAGACTTGGGTACCTTATGTTAAGAACAGAAGAGACTGTCTAGGAT
TCATCATTTGGAGTAGGTGAATAAGATTAGAGGAGTGACTCTGCTAGGCAATAGCTGAAG
GATGAAATGAGGGGTTGAGGGCTAAAGGTTCTGCTGTTTTGTAAAATGGTTAGACATTTT
TCTATGCCGATAGGAATGCTAGTAGAAAGAAATACTGATGACTCAGGAAAAGATTCTGTG
TTCAACTCTTTTTGAGGTTAATGACCATGGGCTTATAAGTGAGACCGTTTCACATGCTTT
CGTCAAGAATGCATCTGTTTTTGAAATAATAGCATTTAACAGGGTTGAGATACCAGGCAA
ATAGGATAAAGGAATAGCAGGACAAGGAAAATGAGACTGTAGAAAGGAGACAGTTAGGAG
AGTTGGAAAGATAGTCCAAGGAAGAGGATATAAAGAAATGAGAGGTTGCAGATCCCTTGT
TAGTCTACTAAAACAAATAATTAGCTACCACCGTGACCTGTAGAAACATCTAGGACAGCA
GTTCTATTTTTGTTTTTGTACCGTACCAAGCAGTGCTCAGGTTGTGCTTTGTGCTTAGGG
TTCACTCCTGGAGGCAAGTGTTCTATCTCTCCAGCCTCAAATCTGTCACTTTTAGATATA
AAAAATGTGCATTTCTCATTAGGAAAATTGTTTTCTGAGTCCAGCTTTAATTTGGTCAAA
AGGATAGTATTAATTACTGTTAAATACTTTAAATATTTGTGGGGTTTTCCCACCCTGTTC
TGTATTTGTAGAGACTTGAAAGTAACATTTCATTGACTTTATGGAGAAGACAGTACTATC
ATTGAAGACTTAGAAACCGGATAACAAATATTTAAGAGGATAATAAACTGTTCTAATAAG
AAGACTATATTTCCATTTAGAATTTTGGATTCTTCAATTAATATAAAGACTGTTGTTGCT
ATGTTTACACAGCATTATTTATGTTTCTTTATTTTCTACTTTCTTAGAAGTGTTGAGGTT
TTGACTTTCTGTATTGCCCAGCATACATTAGTAAAACATTAACATATCAGTGTGTTTTGC
TAATCTTTAAATGTTTTATATTTTGTGGGGCCCGGAGCCATACTGCAGCAGGTAGAGCCT
TTGCCTTGCATGCAGCTGACCCAGATTCAGTCCTTGGCATCCTATACGGTCCTCCTTACA
CTGCCAGCAGTACAGAATGCAGAGCCAGGAGTAACTCCGGCCATCACCGGGTGTGACCAG
AAAAGCAGTCAGTCAATAGACTGTCAGAGGTGACTCCAAGTTTTGAAGTTTTCTTGCTTC
ATTAAAAAAATTAAAAAATTTTTTTAATTTTTTAAAAAATTTTAAAAAATTTTGGGGCTG
GAGCGATAGCACAGCAGGTAGGGCGTTTGCCTTGCACGCGGCCAACCCGGGTTCTAATCC
CAGCGTCCCATATGGTCCCCCTGAGCACCGCCAGGGGTAATTCCTGAGTGAAGAGCCAGG
AGTAACCCCTGTGCATCGCCGGGTGTGACCCAAAAACAAACAAACAAACAAACAAAAGTT
TTGTATTATGTGATGAATGCAGAACTTTCTCACAAAACTAGTACACCTAGATTAGATCAC
ATCAATAAATAAGCACATCATTAGTCATTACTTCTAGAAGCCCCTGCCTTTCATTTGTAT
TCATTTTTAATGTTTTGGTTAGACGAGAAAGCAAACTAAAGAATTGAAATGCAAGTAAGT
GTAAAGTGTATATGTATGCTGTTCACTCAGTTTTATTAAAATTTTACTGTATTTTTTTTC
CAAACATTTTTTCTGGCCCCTTTAAGTTGTAGCCATAAAGCCCTTTTTCCCCTAAATACT
TTGACAGGATATCGTGTTATTTAATCATATAACGTGATTTTCACTCTTAAAATCTAATAG
TGAGTCAAGTGCTTTCATCTAATATACACACACCATACGTTTTGCTCAGTTGTTCTGATA
AACCCGTTTATGGTAGTTCTTTTCTTGTTGGTTTTTGGGCCACATCCAACTCTACTTAGG
ATTTAACCCTAACTCTGTGGTCAGGGATCACTCATGGTGATGATGGTGGTGCTTGTGGGG
ACCGCAAGTAGTGTCAGGGGTTTGGCCTATGGTCAGCCTTGTGCCTGTGCAGCACAAGCG
TTCTACCTGCTGTACTCTCTCTCTGGCCTCATGGTAGTTCTTCTTTTCTTTTCTTCTTTT
TTTTAATCTAAAACAGGACATTAGCCGTTCTTTGTTGATCCTGAATTTTACAAGAGTGCA
ATCTAGTTGTTTTGTAAATGTCCTTCAGTTCGGGTTTTCCCTTCTGTTTCCTCCATAATA
GATTTGCACAGGAATGTGGTGTCCTGTTGATGATGTCTTGTTCATCTTGGTGCATCAACA
TGTAGATTTGATATTGTTTTGTTTGATTATTTGTGATCATTTTATTTTGCTCATTTATAA
GTGGAAGTATCATTTGGGTGTCTGCATTACAAAGCTGCTCTTGTCTCTTTTGCTCTTAGT
AATCTGTGACGAGACTATAAATACTCTGCTCCTCTTTGAATTTTTTTCTCATTTTAGGAT
TCACTGGTTGTTTGCTTTAGTCACTACTATAATGTCTGCAAAGTGGGGATTTTTTTTCCA
TTTGTTTGCTTTTGTTTTTAACATGAACTCTTTCGCCTCCATTTATTTATCAGACTCACT
TATCTTTATTTTGTGTGAGACAGTATGGTTTTGTAATTATGGCTTATTTTTGTATATAGT
ACATTAACTGAACAATTATATACCACATGTGCATGTATAAGGCATATTTGTGCATATATA
TCTGTAAAGAGAGAATGTGTGTGTATACAAAATTCATATTGATCTCTAATTGTTCAGATT
TTCTTTGTAGGAGTGTCTTCAAACTTTCTCTTGTGGCTTTTGACCATCTCAGTTTTTATC
TTTTGATTTTACCATACTTTACAACTTATGTTTGTCCTTCCCCTACCCTTTAGTCTAGAA
TAAACAATTACTTACATACTGGGTGCCTTTTAATGGAAAATTGTAATCGGAAAACATGAT
CTGGGAACTAGCTGTGATACTACAGGGCTATCAGTGGGTTGTTTTTTTTTTTTTTCTGCC
TCTTTAGAAACCAGGACTGAAAGTTCAGTAGGAAGTTGCCAAATGTATATTCTTAAAATT
TTAATTGGGAAGTCGTGTTTCTTTTACTTCCAATTAAGTTTAGGGTTTGACTTCCTTTTC
CCTAGTCCATTATTGTACTTTCCAGCAGTTTGAACCTGCTTCCAACAATTTTAGTATATA
TTTATTTGTTTAATCTCAAAGTATACATAAAATATTCAAAACCTACATTTTCCATCTTGA
GGCTTATAGTCAAAATGTTTAAAAAGTTTACTTCAAAGTGATTATATTATTTGAAAGATA
ATTTGATATGTTTCTGTTTGCATTCAGTTCTAACATTTTTTTCTTAAATACTTATTTCAC
TTGCTAATTTTTTTGCTCATGTAAAACAGTAGACATGGTTTCCCCCTCTCTATTTAAAAC
CTGTGGTTTACAATGTTTAGGATGACTTGTTACAGGCATTTAAGATCCCACCCCCAATCC
CTCTACCATTTTGTCTCCATTTTCCCAACCATCCTTAAGCCTGCCCCCGTAGTAGGCCCA
CAGTAATTTATTTTATATTGCTTGTTCCCACTAGATGACTAATGTAACGGTCAAAAAAAT
ACTTCAGTAAAAGAAAATTCATGATAGTTGTATATCACCATGCGGTTGTTCTTGTCTGAA
GGTTTGCTGAGCTGTTGTTGTTAGTTAGGCCACCTGTGTTAATGTTTTTGTTGGTCAAGA
TTAGCTTCTACTTCATATTCCCATCCAGTGCTATGTTTCTGCTAGGGTTCTTGGTATTGT
AGAGTTTGGCTCCAGAAAATCCGGAGTATTTTATCTGGTGGTCCAAATGGAGGCTTGGTG
GCAGCTATTGGGGTATGGCTGCCAGGGCTTTTGGTAGGACGGGAACTTGGTCCACCCCCT
TCCCAAGATCTCCCTGAAGGTTTCAGCCAGAACCAGTATCCAGAAATTTGGAGGGCTAGT
TGATCTCTTTCGAGATTTATCTAGAACAGGGTCAGTAGATGAACTTCTGTGGCGGTGGCA
ATAGAATAGGCATATTTTCTGAGGCATAATTAATCACAGGTATACTGAGATTTTTCCTGT
TAATGACCACTTTTTTTAAAAATCTGGTTTCTTGTTTCTTTTTATATAAATAAGCAAATA
CACAAAATTAATTTCTTCCTATTATGTAGAAAGAACATCTTTTAATCCTTTAAAGAATTA
TTGAGAATGTAAATATCAGAACTTTCCATGGATTATATCACCAGGAATAAAGTTGACCCT
TTTTTTTGAAAGTTAACCTTTTTTTAGAATTTACTTTGGAAGAGTTGAATTACTTTGAAA
TGGAATTTTTATGAAATATATATTTGTAGGGTTTTATAAAAGACATCAGTGTTACTTTTA
ACTGGGTAGACTAAAATATTTATTATTGGAAAATGGAGATAACAATTTTCAAGTAGATTT
TGTGAAATTGCAGAAGTAAAGGTTATTTACTAGTGAAAAAACACAAATTTATTTGATAAT
GTAATGTTAAATAAGCCCTTGGTTCTTTTCACATGTCTGCATTCTGACATCAAACCATGT
TGAGAAATAATTATAACTATTCTAGAGTTAATAAAATGTTGATGACAACGTCTCTATCAA
GTACACTAGCAGTCTTAATACTAAAGCAAGTATTTTATGTTACTTGGAGAGAATAAATTT
ATAGGAAAAAGCTAAAAATCTTAGGGAAAAAGCATGTCAAGAAAAAGAAAAGAAAAGCAG
AAGGGGGGTCAGAGGCAACAACATGTAAGAAAAACCATAGAAAATTTATCTCACCAGAAA
CAGCAGCTCTTCTCAGTCTCAGACAAGTACTGCCTCCAGAAAAGCCAGTTCAAGCGTTGG
GAAGTGGCAGGACCGATATGGGAGGGCCGAATCACCTGATCTAAGGTAAGGCTACTTCTA
AACATTGGATACTCCCTGATGTTTAGATCGTCAGTGTTGTTTTGTCTTAGCACTAAAAAT
TAAATTTTGATTAGACGATCATATTTTTACCCCTAGATTAGTTTTTTTATTTGTTTTGTT
TGTTTTTGTTTTTTCTGTATAGAATTGAGGGATATTAAAGATACCTTTGAATCAGACTCC
TTCACCTCATTAGTTGTCTTTCTGCTGTTTTTTTATATATCAGTTGCATGGAACCATGGC
AGTTGATGTTCAGTTGATATTTGCTCTTCCCTTGCTACAGGTTTAATTGGGGGGTTGGCT
TGGGGGTGTATGGGAGGGGTGGGTATCAGGAATTGAATTTGAGTCATACATCCAAGACTT
GTACTACTGCTATGCCACTTTCCTGCTTAGTTTTCTTTTTTAAAAAATTATTATTTTTGG
TTCTTTTTTGGCCACCCCCCCTCCCCCGGCTTAGTCCTGCTTCTTTGCTCAGGGATCACT
CCTGGCTGGACTTGAGGACCATATGGAATGCCAGGGATCAAGCCTGGGTTCACTGGGCTC
AAGGAAACAACCCTCTATATAGTACTATATCACTCTGGTTCTTTCTTATTCTTTTAACAT
ACTCCAGTCAAAGTCCCTAGATGCTCTACACTATATGCTGAATAAAATGTAGCCTACTGA
GCCACTGTTCAGGGCTTGTAGAATAGGACTGCACTAAACCATGTCAGGGTTTTTTTTTTT
TAACCCAACTATAGTGCATATATCTACCATTTCATTAAATTGATTTACTAGCTGTCCTGA
AAACTAGTTTTGCTTAGTTTGCTATGTTTTCATTCATGATTCATTTTACGTAGAATTTTG
GTTTGTGTTCTAAGTCCTATTAAACCATAACCTCGAATGGTAAGGTAAACTTTACTCTTG
TGTGTACTAAATTGTGGGCTATAGTTTCTGTCCCATGGGATACAGTGAGAAACAAATATA
TTTAGGTATGAAAGTGCATTTCCAAGAGTTACGTATCTGAACAAGTAGAAATATAGACCA
TTTAAGTTTTCCATCTGAAGTTTTAAGCAGTGATGGTATGGGGAAGAGTGTGATTTTATT
GCAGATTTTATGTTTTCTTGCTGAACAACTTGATGTTACATTAACATGCTTCAATTATTT
TTATTTAGAAATTTTAAGTGTGTAAACTTTGGAACATAGATCTTTGACCATTACACCAAA
AAGAAAATCAAAAGAGGAAACACTACCAAATTCTGTTTCTAGATATTTTTTATGGTATCT
TCCCACTGAGTGGTATAAATTTCTAGTCAACTTGCTTCAATAGGATTTCTCATTAGGCAA
TACTAAGTATAGTATTCTCAAGAGGGATGAGTATGAATCTCTAAGTCAAACATACTTAGA
CTATCTAACCAATATTCAAATTATAAGTAGCATAATAGATGCAAATATATTCTTAGTTCT
ATCAGTTATGTGCATTGCTTAACATCTTCTAGAGTTAAAATCTCCATACCTTACTGTTTT
TCTCACTTTTTTGAATACAAAATTCTTGAATAACAAATGTCAAGTTAACCGAGGGGAAAA
TAGGAGATGCAAATAATGGAGTGGCGTTTTTTACAGTGTTTGTTAACTTCTCTGGATTCG
CAATAGTGTGAGTGGTGTTTAAAGTATCTGGTTTTAAACTTTCACTATTTAAAGTTTAAC
CAATAAATTATTATTAACCAATTAAACTTTAATCAATAATTAAGTGGTTATTTAACACAT
AATGCAAAGAGAAATGCATGGTCTGATATTTAACCTGCCCAGCAATGTTGGCATCCTGTT
TGTTTACCAGTGCTAAAGGACTAAGTAAGAGCTTTCATTTTTAATGTGGTACTGTTGTTA
CTGGAACTCTAGATCTTTGTATATAAAGAATAACTGCTTAGACTTTATAACTGCTCCATG
CATAAGTACTGGATTGGGATGTTCGGTTCATTTTGAATATGTGTGAATTTGTGTGAAACT
TTGTGGTCCTTTATGTAATGTTGGGATGATCCTGGTGGGCCTGCCATCATTGTTGTCTAA
GTACTGAACCTTCAGACCCAAATGGCTGAGCCAGGTATCACTAGAAGTTGTTCCTGGGTC
CCTTAAATAATGCGTGGGAGCAAACTCAGGACTATTTGTTTTCTGCTTTCTAATACCTGT
GCAGGGACATCCACTTTCACAATCAAAGTCATATAAATTCTCAATTTTTCTTTCATATAA
TTTTAAACAAGGTAGACGTTTTTTTGCAATTGCTTTTTTATACCTTAAATTTCTTAATAT
CAGTCATTTACATATTTAACTCAGAATAGTGGTGCTTTCATGTGATAGGTTATTTCCTTG
AAATAAAATTTCACCAGAAAATGATATGTCTCACTGCTCAGTAACTAGTTCCCCCTCTTT
CTCACAAAACTTTTTGAGACACAGAAAACATCTGACCCTTGACTTTATGATTAATCTCAG
GAAATATAGATAGTAGGAAACTTGTCAGTAGGAAATTTACAGTACATATTTGAAAATTTA
AACTCTCCAGTTAAAAGACTTCTATTTGAAGTGGCATGTACATTTGTGTATTTGTGTATA
TCCACATACACATGTATGACACACTTAAAACATAAGATAGAATATCTCAAGATTCTAGCT
TTTGATTGTTGTAAGAATTTGATGTTTTGGGGGCTGGAGTGATAGCACAGTGGGTAGGGC
ATTTCCTTGCATGCAGCCGACCCGGGTTCGATTCCCAGCATCCCATATGTCCCCTGAGCA
GCGCCAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNAAATCCTGCCTGTTTATGTATTAATTAATACGTGAAAACTGAAAATATGATAT
TGTACATTTATGGTATTAGCATTCTGGACATTTATTGTTCTATTATGTGGCTTGAAAGAT
TTTCTGTGATGGGATATTATGAAGACTTTTAAATTCCTTGTAGAATAGTGTCTTTTTCTA
TCAATGATACAATTACTATTTCAAGCATAGATGTGGTATAAAAGACTTTGTTCCAAGTTC
TGCCCAGAAATGAATAAATATGTTGTCCTATCTCTCCAGCCCCAACTCCACGTTAGTTTT
AAACAAACAAGAATTTAATTTCTCTATGTCTCTGTTTCCCCATGGCTTTATCAGTCTTTC
TTCCTCCTCCCTTCCCTCCGCTATTTGCTGACAACTCTTTTCTTTAAAAAAAGCAAAAAG
TTTTTTTAATAACTAATAAATAAAATCTAAATTATGATTTTATTCATAGTTGAGTTCTAG
ACATAGTATTCCAGCACCATTCCCACACTGGTGTTTCCAGATTCCCTCCCCTCTACCCCG
TCTCCTGCCCCCTGCGTCTTGAGGAGCACCTTTTTAAGGTTGTTATGAAGTTGTCATAGC
AACTCATGGCTTCAGTGTTGTTGACTCTCAGGTATATTTAGCTGACTCTGTGTATTTAGC
TGTGCTGTTTGTTTATTCCTATTTCTTTCAGATGTAGTACTAGAAAATAAATTACATATA
TTGAAGACAGTTTAAAATTCTGATGAAAAATCTTATAAAAAATAAAACTAGGACTGGAGT
GATAGTACAGTAGGTAGGGCATCTTCCTTGCTTGCAACTGACCCAGGTTCGATCCCCAGC
ATCCCATATAGTTCCCTGAGCACTGCCAGGAATAATTCCTGTGTGCTGAGCCAGGAGTAA
TCCCTGTACATCACCGGGTGTGACCCAAAAGGAAAAATAAATGAAAGTGTTAAAATTTCT
TCGCAAAGTATGTACTCTTGAAAAGTATTGTGCTTATAAAAAAAAGTTGTTTAAAAAATT
AGTGTAGGGGTAGGAGAAATGGTACAGGGTTAAGGCATTTGACTAATATTTGTTAGGTAG
GCCTGGTTCGATCTCCTGTACTGCATATGACCAAGTATGGCCTCAGAACCCAAATAAAGA
AAAATTAATGACTCTTTAGTTGAAAACTTATTAAAAATATATGTAATGATGACTGTGAGT
AATTATACTGTATGAGTAATAGGAGTTAAATGGTTTTTTTATCAGCTACTTTAAGCACTT
TTCAGAACAGAGAAGGTAAATTCTCTATGGCATTGCATTGTTGTCCTCAATATTGGTATG
TATTAAAGTTAGCTGGGAGCTTGAAAAAATTGCTGCTGTTAGGCTTAAGAGACTGTTATA
AAAAAGCTTGGTGTGTACTCTGGGTAGTGGACTTCAGAGAAGTTCCCCAGATGATACTGA
TAGGTAGTAATGTTGGAAATTAGTAAGTTTAGAGACTGGAGCCTGACTGAGCACCTTGGA
TTTTCAAGACAAGTCATGTGGCTACAATGAGAAAACTAGCATTTACAAAGCATTTTACAG
TCTCACAGAGGTCTTTTCTATATATAGTTCTCATTTAATTTACATTTCTGTCTTGGAAAG
TCTTTTTTATAGGTAGCCACCATCAAGAATGGATCATGTTCCTTTAGTGCAAAATAAGTG
CTCCTATTTAACTTAGAATCCTGCACATAATATTTTCTCCATGTCCATTCTTTTCTCATC
TTCATCCCTCATTCTAGACTGGCTTCCCTTTCCCTCCCATGTGGCCAAATTTTTATGTCT
TTCAAGACTCTTTTCTTTAAAAGCTCTAATACCAGTTTCTGTACAGAATTGTTAAACATT
AGTGTAGGTGACCCTGTATTAAACAGTCAGACCAGTGAATCTGTCTCTCCTCTGGGAGTA
TGAAATAACAGTCTAGCATTATTTTTTCCTAAGGAAACTCCTGTAATCTACCTGTTGCCC
AAAAACTTATCGGAAGCTCTGTTGTAAGAAAGAATATTCATAGATTTCTACAAGAGCAAG
TGAATCAATCACTCTTCTAAAAAAGGTCCTGACTTTTCTTAGAAGTAGTAATAACAAAGT
TTGCATCCAAACCTTGGACTCTTGAAAAATACATGTATCTGTACTTCCATATAATTAGGT
TCAGTGTCATTGAGTCTGTTTTCTTTGTGTGCTAATTAAGATCTTTTACTCAAAAGTGCA
GTAAGGGCCTTGGATAACATTGTTTTACTGGTAAATTTGCTATTTTGAGGAACTTGTTGA
TGATGTTACTTGAAGACTTACCATGTCTATTAGCATATGGTAAAATTAATTTTATTATTA
GTAAAATATTCTCAGATCAAGCCTGCCAATTAGGAGGGCTGAATTGTTAAGCAACATTGT
CTAGCTTCCCAGATATCCTTTACCTAGCCTTAAGAAACATTCTGAGAAACAGCTGTGAGA
TTCACTTTTTTTGTCAGGATATTATCAGAGATTTTCTCCCTGTTTAAGTGCTTATTAGAG
CTTGCAGTTATGGTTCAGTTGGGTGATTGTAACCAGTATATTATTTTCTTTGTTCTATTA
TTTTCCTTATATTATAGTCTTTAAATGATATTAATGTCCTTTGATTTTAATACTACTCTT
TATGGGATATTATTACTCGATTTTTATATAAGATTTGGTACTGATTGCTCTGCAAAGTTT
ATTTCCTGAAGAACTGTATTTTGAGAAAACAGACTTAAAAGCTATTCTATCATGGTTTCT
CTTTGTTTCTCTCTGCTTCCTCTTCCTTTTTTTAATATTATCACGCTGCCAAACTTAGTT
TCTCTTAAGATGGAACTCTGACCTATAAAATGGCAATGATGGTTACTTTGTAGTTATTTT
GAGGAATTTCACTGATACTGTCATCCCGATGCTCATTGATTTGTTCCAGTGGGCACCAGT
AACATGTCCATTGTGAGACTTGTTATTACTGTTTTTTTAGCATATTGAATATGCCATGGG
TAGCTTGTCAGGCTCTGCCTTGTGGGTGGAATATTCTCAATAGCTTGCCAGGCTCTCCAA
GAGGGATGAAGGAATTAAAACTGGGTTTGGCTGCGTGCAAGGCAAATTCTACCCTCTTTG
CTATTGCTCCAGTCCATAATAATAAAATTCTACTGAATAATTTTATGCACTGAAGTAAAA
ATATTAAAAATATATGGTTCAATATTATTTTCCATAATATGGCATTAGGTTGCCATTGTA
TTTTGAAGATTACTAATCTTTGTTAAATATTGTGGGTTTTTGTTTCGTTGGAATATATTT
AATATTTTGATGGGGAAAAGGTTAATTTTGTATTTCTAATTTAAAGGTTAAGTTCCATTT
TTATGTAGAAATGCCTGGTCAAGGTAATATTGAAATGTAAGCAATTAAACTTTTCAGGAT
TTCTTTTACATATAGACCGATAATCTCATTTGTATGTTATAGAAGCANNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNTATTTGTGATTTCTAATGCTCAGAATCAATAAGGGAAAAGCCCATA
TGTAATAAAATGAGCATTGTTTCCAAGCTCTCCTCAGAATGAAAAAGTTATATAATAGAG
CTATGCAGTGTGTATAATTAACCATACATACATACACACACACACACACACACACACACT
TTTGTGTATATTAGGTATGGGAACCCTTACCTTGCAGACCTCCTGGTTTACTCCTGGTCC
TATGTTCTGGTAGTGCTGGGGGGACTATACGCATCTGCGCAAGGCATGTGCCCTACCCAT
CCTACTCTCTCTCCAGCCTTATGGGCTTAAATTTTTTATTTGTTTAACAGTTATCTTATT
CACATGAAGATATAGTCAGTGGGAGATTATAGCACTGTCACCCCATTGTTCATCAATTTG
CTCGAGTAGGCACCAGTAACTTCTCCATTGTGAGACTTTTTCCTGTTTTTAGCATATCGA
ATATGCCACAGGTAGCTTGCCAGGCTCTGCTGTGTGGGCAGGATACTCTTGTAGCTGGCC
GGGCTCTTTGAGAGGGGCAGAGGAATCGAACCCAGGTTGGCTGCGTGCAAGACAAACACC
TGACCCACTGTGATATCGCTGCAGTCCAGTGGGAGATTACTTTTTAAAAATTAGTAAATT
TAGAAGAAAACAATATTTAAGAATTAAACATTTATGGTCATTTTATGTGTTGATTCCAAT
TTACTAATAAAATAATTTCTACAGCAGCACAACTAAAGTGCATAGCGAAAGATTTTAGAT
TTTATTTCTTACCTAATGCTTGTATTATTTTTCAGACATTTATTAATTCTGCAACTGATT
AATTCAATTTTTGTGTTACAGGAGGTTACCTGGGGCAATTGATGTTATTGGTCAGACTAT
AACTATCAGCAGAGTAGAAGGAAGACGACGGGCAAATGAAAACAGCAACATACAGGTTTA
GTATTTTTAAAATTACTATTTTGGTTTTGGCTTGGGGATCACACGCAGCACTGCTGCAGG
TTATTCCTGACTCAGTGCTTGCTCCTGACTTGAGGAACCCTGTTTCTGGGGACTAAACAT
GAGACTCCTGCATGTAGAACATGCACCCAACCCTTTGAGCTGTCTCTTGCTCCCTAAGAG
TTATTACTGTGTATGTTGAAGGCGAGGTGGGAAGGGGGTGGAAGGGATATTCACACCCAG
CACTTCTCAGGGGACCATATGTGTTTCTGAGGATCAAGCTAAGATATTATATTCTAATTT
AATTTGTCAAATTTTTGTGTGTGTGTGATTCTAGGTGTTACAAAGATTTTTAGATGTGGT
TAACAGTCACTGTTTCACTAAAAATACTTCTATTTGTAATTTAAAAGTTTTTAATTTTTT
TCAGTTAAAAATTGTTATTATTGTTGTTGTTGTTGTTATTACTATTATTGTTATTGTTTT
GGCTTTTTGGGTGATGTTGAAAAATGCCTAGAGGTTACTCCTGGCTCTGATTCAGGAATT
AGTCCTGGCAGTGCTTGGGGGACCATATGGGATGCTGGGGATCAAACCCAGGTCGGCCAT
GTGCAAGGCAAACGAAGTACTATCGATCCAACTCGGTAAAACTTTCTTTTACAATAATCA
GGACAATAATAGTGAAAAAAAAAGTTTTCACAGTAAAATTTTTTTTTTTTTTTTTTTTTT
TTTGCTTTTTGGGTCACACCCAGCGATGCTCAGGGGTTACTCCTGGCTTTGCACTCAGGA
ATAACTCCTGGCAGTGCTTGGGGGACCATATGGGATGCCGGGGATCGAACCCGGGTCGGC
CACGTGCAAGGCAAACGCCCTACCCGCTGTGCTATCGCTCCGGCCCCTACACAATAAAAT
TTATAATAATTATTGTAAAAAATTATTTTTTACAGTAATCTAAACATTTACTGTAATAAG
ACCATGCATATGTCCCTAGACCTGGTTCTTTACCTACCTAGGTCTGGTCAGAAATGATGG
TGATAAGGGGGGGCGGGGTGCATTTTTTTTCTAATGTAATGAAATTTTAGAGGAATGTCA
TCACATCTCTCATGTGTTTGGCTCATCATGCTTATTACCAAGTTCCAGTACCATAGTACC
AGGTTCATTGGACAAAACAGAAATATGGGACAGATTGAAGGAAGGCAAAGAAAGGCACTG
ATACATTTTTGCTCTCTGAAGACAAGCCACTTAAATAGTCTGGAATATTTCTTTATGATT
AAGCAGTTTGGAATACTACTAGATTATATTTACATAGATCTTTTTTTTCTTTTCAGCTTA
TAATGACCATTTTCACTTTTCCATATTCTTTAAAAATATGAATTAAAATCTCATCATTAT
ATACCAAATTTGTTAATATAGTACTGTTTGAACTAGATTTACTTTGTTTTTAAATGAAAT
AAAAGTGTATAAGTTATCAGTAACCTAGATAATTCAAGTTAGAATTTGCAGTTACAAACA
TTCAACTATTAGCTTGATCACACTGTTTTGTTACTAGTTTTCTTATTGAGTACTTTTTTT
TTGCTTTTTGGGTCACACCTGGCGACGCACAGGGGTTATTCCTGACTCTGTGTTCAGGAA
TTACTCCTGGCGGTGCTCAGGGGATCATATGGGATGCTGGGGATCGAACCCTGGTCGGTC
AGCCGTGTGCAAGGCAAACGCCCTACCCACTGTGCTATCGCTCCAGCCCCTTATTGAGTA
CTTTTTTAAAGTGTCTGACAGGCCTGGCAGATGGTAAAGTGGTTAATGTGGCCAACTTGC
TTCTAATCCCAGCATATGACTTCCCAGTATTGCCGTGTTTAGCCCTGGAGACCTCTGCTG
GTTTGGTCCCACTCTGTGTACCACCTGGGCGATATCTAGTGGCCTTGGCACTGCAAGCCT
GAGAGCACTGCATCCTAGGGCCTGAGCATTGAGCTATCCCATCAGATTGGTTGAGAATAG
CTGGATGTAGTTCCTTGGTCCTCTAAATATCACTTGGTAGTCTTCCTCCTAAAAGTGTTC
AGAGAGTTTTGGTTTTAGCCTTGACTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNCTTTTTTTTTTTTTTTTTGCCTATCGGGTCCACACC
CAGCATGCTCAGGGATTACTCCTGGCTCTGAACTCCAGGAATTATCCCTGGCTGTGTGAC
CATTTGAGATGCCAGGGATCATACCTTGTTCAGCTGTGTGCAAGGCAAACACCCTCCCAC
ACTGGACTATGGCTCCAGCTTCCTGAGCTCTTACTAGTTGTGAATTAATTGCTTTGTGCT
TTTAACGTCTTTATCTATAAAATGGAATTACTGGTTAATTCCCATTATCAGAATTACTTT
ATTAATTTTGGTTTTTGGACCACACTGCCATGCTTGGAATCAATCACTCCTGTCAGGCTT
TGGGGACCGTATGGGGTGATGGGGCTCCAACCTGGGTTTGCCATGTACAAAGCAAGTGCC
CTACCCACAGTTACTATCATTCTTGTCCCAGAATTATAATTTAAAACAAAAAATCATACT
GTAGCAGGATTTCTTAAACTTTTCTACATGTGACCTCATTTCACCCAGGTAATTTATGCA
CAGTCCAGGCATATCAAATATTTAGTGATAATAAAGTACAAATTTATTGTAAAACTTTTT
GCTTCATTTACATTTAGTTATGCAACCCCATATTGTGTCATGACCATATTTTAAGAAGCT
AGGCTCTGTAGTAGGATAGGTTTTATTTGGTGGTCAATTGGCTATGTACTTGTCTTATTT
GGAAGTGAGTACTTTATTGTTATATATCTATTTCGTTGTAACTAGACAGATTGTGGTATT
AATTGGTTTTTAGTTTGCTTATATATACTTGACTTTTTTCTGGGTCATACCCAGTGACGC
TCAGTGGTTACTCCTGACCGCACTCAGGAATTACTCCTGGCGCTCAGGGAACTGACTGTA
TGGAATGCCGAGGATCGCTGTGTGCAAGGCAAATACCCTATCCTCTGTACTAGCGTTCTG
ACCCCAGTTAATCTTTTAGATTAGAGTTTTTGTCTTGGTACTTCTCGTTAATATAAAACT
GGAAGTCCTAAACAAAAATATTTTTTTTTAATTTAAATTTTTCTTCCTATACAACTAAGA
ACACTTCTGATAAGATAGATGAAACAAAAAGCAGGCTGATGCCTGTATGTTAACTGAATA
GTGGAAGATTTAGTGTGATAATACCCCAAATCTGAGTTTCTTGGGCCCCAAGGAAGAGAA
AAAAAGCTATATTATGTAGTCCTTATACCAGATAGTAGTATAGTACCTGGCACAGCAGAT
ATTCAAAGTGGTTTACAATATGTAAAATTGATTATGATGCATATGTTAAAAGTGTTAAAA
ACCTTTAATTATACCTCACTGTCAAATATTAAATTTGGTGTCCATAACAAATTTTGGAGG
CCATTTTTATCTCACCTTTCAGTGTTTAATATTTGTTTAAAGCNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCCAGC
AATGCTCAGGGGTTACTCTTGGCTCTGCACTCAGGAATTACTCCTGGCGGTGCTTGGGGG
ACCATATGGGATGCCGGGGATCGAACCCGGGTTGGCCGCATGCAAGGCAAATGCCCTACC
CGCTGTGCTATCGCTCCGGCCCCTCAGGTACTTTTTTTTTTAAGAAAACTTCCATTTCTT
TGCTATGTAAGTGGTTTTAGGGATGATATATATTTTAATTATATTTAGGTTATTTATGGC
TTTGTACTATGAAGTACCACTGATTTTTTTTTTTTTTTGATGCTGACTATTGTCTTAGCT
ATTTGTTTAATTTTTCCTTTGATGATTTTTTTTTTCTTTTGGGTCACACTCAGCGATGCA
CAGGGGTTACTCCTGGGTCTGCACTCAGGAATCACTCCTGGCGGTGCTTGGGGAACTATA
CGGGATGCTGGGAATAAAACCAGCGTCGGCTGCATGCAAGGCAAACGCCCTACCCACTGT
GCTGTCGCTCCAGCCCCTTTGATGCTTATTCTTAAATGAAATTTGTAAGCTGTCTTGTCA
TGATTTATGGAATACAAAATCAGATGACTTCTAAAACTGGCTTAACTTACCTGGCTGTGG
TATGTTTGCTTAGGTACCAATTCATAAAATACTTGTAAATTGTGATTATTTAAATGTTTT
TCAAAATGGAGCAGTATGGGAGGTGCCAAAAGATCCAGGGCATACTGTATTAGGGGGTCT
GGAAAGATGGAGATATTGGTAGTAATGCAATTGGAAGGCATTTTGTGTGTTCGCGTACAG
CAGGTATAATTCCAGCATGCTACCAACCACAGTTTATTCTCCAGCAACTCTACACTGCCA
GGGAGTAGCCCCTAGAGCTATTGGGTGTGCTGCACTGCTTTTGCCCCCAGTGCCACTCTC
CCCCTGCCCCCAAAATTTTTTTGAAAAGAAAGAACCAGAATTCTAATTTAGGAAATGTTG
CTGGAAAGTCTATATAAAATTGTTGAAGTGAATTATTCCATCTATGTCAAGAAAAAAACA
ACCCAAAAAGCTCCTATTGAATTACTGTTGAAATTTTGAGTATTTTCCTGATGGTGAAGT
ACGTGCTTGCATACTTGGGGATAGGAAATTAGGAAAACTCTAAAGGTCAGGGTTTTCTTT
TCTGTGTTTTCGTTTTGGGTCGCTGCCCTCATCACTGTTTCTGGAGGTCGCTCCAGTGGT
ACGTGGTTGACCATGTGGTTCTGGGGACTGAGCCTGGGCTGAATAAAATAGTTTTGAATT
ACCGAAAGATAGAATTATGAAATTTGCAAGGATTAATATATGTCACAGAGGAATTGATGC
TTGTTTCTTTTTTTATTATGGTAATACACATTTTTAAGTCATTTGTAAGTGTACAGTTGT
AACATCACTATCATGTGTGTAAACATTTTTTCATTGTCCTTAACCAAAATTTTGTTCTCA
TTAAACATTTTAGCTTTCTTTCTCTCAGATTTCTTATTCTAGTTATCTTATAAAATGGAA
CCATAAAATATTTCTCTTTCTGGCTTATGTTTTTAAAATAAATTTAAAGAGTTTTGAACA
AATTATTCAGACTGTATTACATTTTATGGTAGGCTTAGGCTGTCTGTTTTGGAATCAGTC
TTTGTATTTTGTTGGTTTACTGAGGGACCTCCCCTCTATCATACCTTACCAGGCGATCTG
CCTGATCATTTCACTGCTCAAATCCTGGGAACAGGGGTACCAGAGTTTGAACTTGGGGCC
TAGTTTGTGCACGCTAGTCCTCAAGCTCCTTGGCTCTGATCTTAATGTTTTCTCTTCTTT
AGTTTTTTTATAGTAAGATTTGTTAAGAGAAGATATAATTCACTTAGTTATATATATAAG
ATATAATTATAGCTCATTTCTTACTACATTAATCAGTATTATGGTTATGATTATGGGGTT
CTGTAATTCTTTGGAAGATTTGAAGTCCAGTTCATCAGTAACGTTCTGATTCTTAAAGGA
CTCCTGAACTGAGTGTTTGGACCTGACATAGGTCACCCCTGCTTTGGCAGAGGCTTGCTC
CATATTGATGATTGTTATTAGCACCCTGTACAAAGTGCACTTTTGCCCTCTAATGTGCAG
CTTTGTTGGGGGAGGGAGGGCTGATTTTTCTGTTTTAACCTCCCCAGTACTTCTAGGTAG
GGGAGGTTTTCTGGTGATGTCTGACCTGTGCAGATGTGGTCGTGGTGGGACCCACAGAGA
CTGCTTTATGACCACCGGGCCACCCTGCTGTACTCTGTGGGCCAGCTCAATTCCTCAATC
TGGGAATTGAGCTCAGGACCTTACACCTGCATGGAGAGAACTCAGGCCAGCTGGAAATCT
CCTTAGTTCAGTAGAGAAGCTATTTGTAAGTGTAACATAAAAAAAAGCTAATTTTGTAAT
TTCTTTAAGATTTTTGGTCTTTTAAAACAGCAGGTTTTCATACTGAGTGATGCAATTGCC
AAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCT
AGTGAATTTGTTAGAAATAACTTTTATCTAGCTGGAAACAGGGGTTCAAGGAATGGAAGC
CATGCAAGGCAGTCTCATTTAAATCATTTCTGTATGCTTTTTTGTTTTTTATTTTTGGGG
ACAGCAGGGGTGAGAGGTGGGGGGTGGGGTGCTCTCAGCGTTTACTTCTGGTTCTGTGCT
CAGGAATTACTCCTGGCAGGCTCAAGGAACCATGTGGGATGCCATGGGTTGAACCTGGGT
CTGCTGCCTGCAATCTCTCCTAAGGCAAGGTAGTTTTTAATTGAATAAAATTTGCTTAGA
AAGATATGAGGGAAGAGAAAAAGGAAATGTGTGTTTAAGAGAGAACATGGGCTTGGAAAA
AGCAAGCGAAGATTCGAGACAAGCGAGATAATGTGTTCGAGGGGAAACACTGGCTTGAAT
AGCAAGCCTCTTTGCCTTATGATGGAATCTATTTCGTAGAAATTTATAGACAGTATGTTT
TTTTAATGCAGGGCTGCTTTTTTTAGAAAAATACTAAATTATATAGTTGAGATTTTTTAA
TGTGTCTTTTAAGGCTGCTCTTCTATTTTTACAGATCCTCAAATAATACTTCAGTTCCCT
CTTTCCCCATTGTTTACATTTAAGAATATGGGCTGAACTGTTTACGATAGCCAGAATCTG
AAAAAAACCTGAGTATCTGAGAACAGATGACTGGTTAAAGAAACTTCGGTTCATCTACAC
ATTGGAATACTATGCCGTTGTTAGAAAGGATGAAGTCATGAAATTTCCATCTAAGTGGGT
CAACATGTTAATTGAAACGAGTCAGAAAGAGAGGGACAGACATAGAAAGATTGCACTCAT
TTGTAGAGCATAAAGTAACAGAATGGAGACTTACAACCAATAGTAGAGATGAGTACCAGG
AGGATTGTTTCACAGCTTGGAAACCAGCCTCACATGCTGGGGAGAAGGTAGCTTAGATAG
AGAAGGGACCACCAAGTAAAGGGTACTTGGAGGACCCACTCGGAATGGGAGATGTGAGCT
GAAAGGAGATTATAGACTGAATGATGGCCACTCAGTATCTCTGTTGCAAACCACAATACT
CAGAACGAGAAAGAGAGCAAAAGGGAATGCCCTGCCATGGAGAAGGGTGGGGTGGAGGGA
TGGAGGAAGTGGTGGTATGGATACTGGGATCGTTGGTGGAGGTGAATGGGCACTGGTGGA
GGGATGGGTAAACGAATGCTGTATGAGTAAAATGCAAATACAAAAGTTCATAAGTTTGTA
ACTGTACATCACAGTGATTCTCTAATAAAAAATTTAAAAAATAAAAAAAGAAAGAAAAGG
GGGGAAAAATCAGTGCAAACCAACAGAGATACTTATATGCATGTAAAAATTATAACATGG
GCTGAGACTGAACATGCCAAGTATCAAATGTTTTAAACAATTTTTTGAAAATTCCCCTTT
TAAATGAAATTGGAAAGGGTGAGTACACTTGGAGATCATAAATATACATTATCATTCCAT
AGAGCCAAGGATATAATAAACCAGATATAAAGATGAAAATCAAAATATGAAACAAATGAA
TACAGACTGCATTTCTGAAAAATTGATTCTCTTTTGAGAATGTCAGATGGTTTTTGCTAT
CATTTGTACTCAAAGCAAAGTATAATTTGCTTTATTTAATAAAAATCTGAAATGAAGTTT
GTATCAAATACTCGGGTTTTTAATAGTACGTTTGATTTTTTTTTTTTTTTTTTTTTAGTG
TTCACTGATTGTCCAAGTGTGATCCCTGATTAGCAACATGATCGTTTCCTTGTTAGAACA
CAATGTCTTCTGTGTCTCTTGCAGATTTGATCAAAAATTTTCTGAGAGGGCACTGATCTG
TAGAACAACTTTTGAGTGATTCTGATGATTACTTTGCTTTTATACCCACTTACCTAAGAG
TCTTTAGAACTTGAGTATTACTTTCAGGGATCACTAGAAATCTTCCACTGCTCTATTGTA
AGACTTACCAGAAAGTGTAAGTCTGGAGCGATAGCACAGCGGGTAGGGCGTTTGCCTTGC
ATGCGGCCGACCCGAGTTCCATTCCTCTGCCCCTCTTGGAGAGCCCGGCAAGCTACCCGT
GGAGTATTCAATACGCCAAAAACAGTAACAACAAGTCTCACAATGGAGACGTTCCTGGTG
CCTGCTGGAGCAAATCGATGAGCAGTGGGAATACAGTGATACTGTGATACCAGAAAAACA
GTTTCTCTCTCTTTGTTTTACAGTAACAGAAAAAAAAACAGTTCTTTGTCTCTTTGGAGT
TTGTTAGGCCAAGAAGGTGGGAATATTGAGGATGAGGAGAATGGGGCTTTTCGAGATAGG
TTTTCTCTTCTATTAGTACATTGCTTATATTTTGCCAACATAACCAAAGATTAGAATTAT
GTTGACCTTACATTATCACTTATTGAAATGTTATAGTTGGTTTGAAATTGTGTTAGATAA
TTGTCATAGAATTGATACTAGTGTTTGATAAACCTTGGGTTTTTTTTTAATTGTTCTGCT
TCAATAAATACTTACCAATAGAGATGATACTGAAATATTGTAGATAAGAGGTTTCATATG
AAGGATCCATTCTAGTTGCCAGTTTTCTGATGTATAGATACCATTTACAAAGGCATCTGT
ATTTGTAATTTGATTTATCTACATATTTTGAATTCCTTTTAAAAAAATCTGTCCTATGCT
ACAACTCTTAATAGATTAAAATTTTACAAGGTAGTTATAATTTTAACTGCCTTCATAACA
TGCTTAGTTATTTGACTGTATGTCTAAATCTTTATGTATTGTGGGAATTTGACAAAATGT
TTTGAAGACTAACCTGAGATGACTGGCTAGGAATTTCTTAGTTATTTTCCATGCATTCTT
ACTTAAGTTATAGTGAACACCAGATGAAGTATGTATGTGCATTTATAGGTTAAGTTCTAC
TGGTGTTAATCAATGCACTAGCCAAATTTGGTGTGATCTTCTAATACACCCAAGAAAATG
ATTGTGTATTACAATAGAAAAGTAGTTAAGGTGAACTTTGATAGTATTGTAAAAAAAATT
ATATTTGTTCTAAAGATAATCAGTAATAGTTGCCATTAAGGATCTTAAATGTGCTGTTCT
TTGCTTCACATTTTGTTTGGAATCTGGGTCTGCTAGCTTGTGTTTTGCTGGATTATCCTA
GTTTAGTAATTTAGGACACAACAAGCCTCAGAATGGACAAGAATTGCAATTAAGTGTAGA
TCAGTTCAGTAGAGTTTTGTGTCTTAATGGCTTTTGAAACAGGGTGGCTTCTTTACACAA
TCTTTTTCAGTGGTGGTTTTCTAAGTCAGAATATCCTTTTATGTTTGGGTGGTCAAGTCA
GGTGCTTTATTCTCCATTTTGAGGTCACTTGCTGCTTTCAGATCTTTTTATAGAAACCTC
ATTGTAAAACGTGGTTGTTTTTTAAAAAATTAATGATTAGCAGATGTTTCCATTGACAAG
GAAAATATTGAGTTCTGTTTTCATTATTTTTCCAATGCATTAGGAAATGATTTTTTTTTC
CTCTTTCAGACTAATTTGGGTGCAGTTTTTAAGATAGATTTTCTAGACCATTCCAACTGT
TCAAGTTATTTATGGGTATAATATTTTTCATCAAAATTTTAAATGTTTTTCTCTTTTCTA
TTTAGAAATGTCATCTTCTTCATATAAGTAGTAGTTAAAATTTGCATGCCGGCATAATTG
CCTTTCATGTAGCTTTTACATTTAAAATGTCAAGTTTTAGTGCTTAGATTTATTACTCTT
ACATTAAGATTTAAGGGCACATTTGACCAATCTAAATTGGGAATGTTTATACATAGTTTA
GCTCTTGAAGCTTATGTGTACAAATGAGTGAGTCACAAATTACTATTTAATGACTCCTGT
AGAAGTAAATTATCGTTTATCTTAATGTGCCCTGTGTGTATACATATACACAAACATATA
TATGCATGTATATATGTGTACATAAATGTGAATTAACCATCCCCTTTATCGCTCCCAGAA
ATCAAGAGAAATAACTTTTCTTGCTCTCGTCAGTAACAGTATAGTAGTCCAAATTGGCAC
TTGAACTTTGTGTAGATCTTCAATAAAGTAACTGTCCATCATTTTCAATTACCTTGTAGT
CCTTGCAGTATTAACAAACCCATTGATTAGCCTTCCAATTAAAATGTTAAAAATAACAAG
ATTAGATGTTGCATATCCAACCCAATTTAGTGTTAATTTCATGGAGTTTGTTATTTGTAT
GCACATTGTGCTTTGTAAAATTGATCTTTTCTAATTTTGTCTGTGATTACAATTAGTGGG
AGAAACCTCATTATCAAGTAGTTAGACTGAACTTTCATCAGGAGGTTGGCTCTTATATTC
GTTGGTCTTCTGCAAGAAAACAGAATGCGGCTTTTGAGAGAATAAGCAGGACAAAGGAGG
CGAGGGGTTTTATTTCAAAGTTTGTTTTGGTGATGGCATAAATACATTGCAGGTTATGAA
ATCCAATTACTATATTAAATTTCATCACTTGTTTTTTAGGTATTCCAATAACTGTACCAC
CTCCAGGTAAAACTTTTTTCATGTTTTCTCCATCATTGTTAATAAACATGAAATTTGAAG
CTTACAGTTTCAGGAGGGACAGTGTTGATGTGGTTAGAATGTGGAGTAGGTAATTGGGAT
TTCAAGGTCCTATTTTCAGCTCTGCCTTTGCTTCATTCCAGTTTTGATCAAGATAATTCA
AGTTTCTGTACACCTGTCTTACTTATTTCTATAGAAATAGATTCTGAGAAAATTCTCGTC
GATTTGTTAAAGAAAAAGTATAGGATATAAAATGAAGATTTTACTAAAAAATACTTAAGA
CCCATCTATTTTTATTTGATACAATGTAAGAGAAGAGAAAGTTCCTCTTGACCATATTGT
AGCTTCTCATTTTTTAAAACCTTGGTGATGTAACTCAGTACTATGAGAATATTTATTCTG
AACTACATAATCAGGATGTATTGGTAGCTGGTTAGATGGTTGGTATTAGAGTGTTGAATA
ATTTATTTGTTGTTGTAATGGTTTGATCAGTAGGAGTTTATATATAATTGAATGTTGGCT
TTTCCCTCACTTTTCGGTAACATAGTGCAAATATGATTGTAAGTGTGTTTATTGAGTTCA
TTATTAAAAGAAAGGAGTATACAGAGAATGAGAGGTGATAACTGTTTGGAAGGGGGTTCT
AAATTCAAAATGCCCTAGACAGAAGTAGTAAAGTTTCAGTAGGATAGCATACATAATTAG
ACATGGGATAGAGAGTTGTTGATTGTGTATGAATTTGGCTTTTGAAAAAGGCTTTTATGT
GGAGAAGTCAGAACAAACTTTGTGCCTTTATTTTAGAAAGCTATGTGATTGTAAAACTGT
TTAAGGTAGGATTGTGGACTCTACGACTAATGTGATAATTGCTAAGTATTACACTTCTTA
AAGGTGTGGAAATAGAGGAATTATGGAATCTAAAACTGGATACAGTAAAGCTGAGCCTGG
TGAATCTGAAACAAATTGAAATAGGGCCAAATACTGACTTAAATGTACCTTTGAGCAGGA
CCGAGAGTACTGGAATTCACTTTTATCTGGAATACTGAAAGTTTAGTGATAGTATTTTCA
AATATATAGAGGTTGATAGAGAATCTAGCAGTGTTTTGTTTTGTTCCCCTCCCCTCCCTT
GTCCAGGATAGTAACGTGAGATTACAGTGTGAAATTGAAGTACAGTATAACACATTTCTT
AGTAGTCAGGGTCATTAAAACTCGGAAGGAATTTGTATCTTTAGGAGTTGGTCTAAGTTG
TGTTTTGATGGGGTGTGTTATTGTGTATTTGAATTTGAAAGTGTAGAGTAGATTGATCAG
TAAGGTTCCTTTTTGCCGTACCTTCCAGTGTTTCATATAGATACTATGAATTATTGAGAA
TACAAATATAAAGGTGCAATAATTTTCTTTCCAGACTGATCCAAAAATTATGTATGTTCC
TTTCTTTTGTAAAAAGTTATGTAGGATCGTGTACTATTCAAGTATTTTATAATGAATGTT
CTTAGCCATAAGCATTTATATGTTCACTGGTAAGATTTATTTATAAATTTTAAATTTAAA
GGAAATTCCTATATTTCTAAAACAAAATAATTTTGAAAGCGGTAAATACTATTTTATTTG
CTTTTCTTCTAAAACATTTCAAGTATAACATGGTGGCAACACTGCAACTGTTTTATATAT
GTGGAAAAGGTAAGGCCTTGAGATAAACCTTCTCATCCTCACAAAATGGGCTGTGTGTGG
TGCTGAAAATAAGACCGGGTGTCCTGACTCCTGTTTGTGCTCTGTGTATTAGATCAGACT
ATTCATTTAAAGTTCCTGCTCCAAAACTGTTCATAATTTTAAGTTCCATTTCTTTCTGTC
CATTATAACATAGAAAAGCACGTTTTTGTACCCAAAGAAACTTACTGATACTCAGCAACT
TTGTTTCATCCTACATCACATGTATGTTTTATTAACTTTTTTGATCTTGTGATTGAATAT
TTCAGGTTTTCCTCCTCCACCAGGTGCACCACCTCCATCTCTTATACCAACAATAGAAAG
GTAAATAATTCTGGCTACTTTAAATTTCTTTTATCATTGGCAGGCTTGTGACAGAAGGCT
CTTATACATACCATGGTCATATCTTAGAAAGGTTTCCTTTCGTAAACATCAGTAGTCACT
TTTTAAATTCATCTGATGACAAAGAAGACAAATTAAATCATAGTATTTTGAAATACCTTG
ATTTTTTTTTTTATGACCTGCTGATTAAAGAAAACATGGTAGATTGGTAAAAGCAGGGCA
GAAATCAGTATTTTTGAAAGTGACAGAGAATGGTGAATACATGCATCTCAGTTTTAGCTT
TAAGACAGCTCTTAGGATGGACAGTTATAAAGAAAAGCTGCTAATTTTTCGCCACCAGGT
GCAGGATTGGATCCTTGCAACAGGGCAATAGCTTTTTTTTCTGTGCCTTGTTCTTAGGGT
ATGTTAGTTGGAGTACTCTACAAAGGAATGTTTTCCTTGTGGGTAGCAGGGTGAGGTTTG
ACACTTATGGGCTTTAGAGGCACATTTCCTGGTTCTTATTGTGACTTCAAAGCGTTTCCC
AACTTGTCTTGCTAGGCAAGATTATTAACTACTCTTTGAGATGAGTTTCCTTTCACCAAA
TAGGGGTGATGGAGTTGTGGAGATTCAAAGAGAAGAGAAAAATATGTGCATGCATGCACG
CAACACCAACCCCCAGAGATTGAACTGAGGCTTTTTACCACCAAAGCATGCCCTCTACCA
GTGCTGTACATCACCATTTCCCACAGCCAGTGAATATAAGTGTCCGAGCAGTTGGCAGAT
AGTAATCACTAATAAAAATGGTAGCTGTCACCAGTGCTGGTGTGAATGTAGGGGAAAAGG
GATGCTCTTTCACTGTTGGTGGGAATGCCGACTGGTCCAGCCTTTCTGGAAGACAATATA
GCAAGTCCTTCAGAAACTAGAAATTGAGCTTCCATATCACCCCGCAATACCACTTCTGGG
AGTATATCCCGAAGATGCAAAAAATCACAGTAGAAATAGCATCTGTACCTATATATTCAT
TGCAGCACTGTTCACAATAGCCATAATCTGGAAACAACCCGAGTGCCCTGAAACAGATGA
CTGGTTAAGAAACTTTGGTACATCTACCCAATGGAATACTATGCAGCTGTTAGGAGAGAT
GAAGTCATGAAATTTGCTTATAAATGGATAGACTTGGAGGGACAGACATAGAAGGACTGC
ACTCATTTGTGGAATACAGAACATCACATGAGGCTGACACCCAAGGACAGGAGATACAAG
GGCCAGGAGGATTTCCCCATAGCTGGAAAACTGCTTCATGAGCGGAGGGGAGAAGGTAGA
TGGAATAGAGAAGGGATCACTAAGAAAATAATGGCTGGAGGAATCAGTCAGGATGGGAGA
TGCATTGCCGAAAGTAGATAATGGACAAAACATGATGACCTCTCAGTGTCTGTGTTGCAA
GCCATAATGCCCAAAAGTAGAGAGAGAGTATGGGGACTATTTTCTGCCATGGAGGCAGGG
GGAGGGTGGGAAGGGGGGGCTAATACCTGGGATATTGGTGGTAGGGAATGTGCACTGGTG
GAGGGGTGGGTGTTTGATCATTTTTAAGTGTAACCCAAACATGAAAGCTTGTAACTATCT
CACGGTGATTCAATAAAATTTTTTAAAAAAGGTAGCTGTCATAATACTTTTATATGACAA
ATAAATCATAGAAAAATAGTATACTTTCGAAAAATTACGTAAAATGTCAGTAAAATCATG
AGACCTTAACCAGTAACATCAAACCATGCCTGTCATTCTCATAGGAAATAGTAAAGTTCA
GCAAAGTCTGAATTGTCAGAACATAGAGCTTTTTATTTGATTTTCTATTTAAACACATTG
TTTTCTCAAAAATGTTTAAATGTATTATCTGTTGATGCTATCAATTTGAATTTTCTACTT
CCAGTCATAACTAATTTTAATACTAAATTTTAATTGTCTAGTTATTAATCTCAATTTTTC
TGTTGTCTTACCTGTGAGTCAAGCTGGATTGATAGGACTTTTAAGTTATGTTCCAATAAG
GTGCATTCTTCTTTATAAATCAGTGTTATATTAATTTTGAGGTTAAAAACCTGCATTTTT
GTGTTAAAATAAAAAATTACAGAATTGAAACTTAGAATTACATAGTAGTTACCATGGAGT
TTTTGGTTTCACCAAGCTGTTAAAATTCAGAAGTTATTTTGCAACATACGTAAGAATGTT
TTTTTCCTTCAACAGTGGACATTCCTCTGGTTATGATAGCCGGTCAGCACGTGCTTTTCC
ATATGGCAATGGTAAGTATTATTCTGAGTTGTGTAGACTGAATTTTGAAGAAGGAAAATA
ACTTAAAAAATTTCTAAACAGTAACAAAGTAGAGTGTAACAAGTATCTAAGGGCAGCAGA
AACTTGCAATTGGTCTTTATGGTCTTTAGTTAGAAGCACAGGGGAGAGAAAGGGGATAGG
ACTTGTGGGAGTGGGGATGAAGGGGAGAGACGATGACAACACTGGTACAGTGGTGGAGGC
TGTGGTGCTGGAATGTGTTCTACATAAAACTTATCATTCATTCACTGTATTGTGTACCGT
GTTGCTAAAATTTTTAAAGAATTGTATTTAAGCAATAAAAAAAATACTTCCAGGGTTGGA
AATATTTTTAGAGAAATTTTAAAATACCAAGTAACTAGGTCTCACACATTCCAGGCCACT
TAATAATTGTCTTCTGAGCACAGAGCCATGAGCAAGCCTTGAGCAATGCCAGTGTGGCCC
CCAAACCAGAAAACCAAACAAAAAATAATAAATTTGATATAGCAGTGATATTTGTACTTC
ACTGTTTTTGTAAAAAGATACAGAATTGATCAGAATTTTATGTAATTTTTCTGTCTCTTG
ACGGATGGCATTCAACTCACCTTGTTTGGATCTTTCCTCTTTTTTTCCACCCCCCTTGTA
GATCATTTGCCCGTGTCCTCTTTCATGTTCACTTATAGTAGTTTTGTCTAGTTGAAGGGC
TTCTAGTAATACTTTTATCTTGCTTTTTTTTTTTTTTAATTTGTATTTTTGTGTTTGGGA
CCACAATCAGCTTGGTGTTTGGGTGCTTCTCCTACCTCAGTATCAGAGGTCATTCCTGGT
AGTGCTTGGGGGAACTAAGGATATCAAGGTTCAAATCGAGGGCACCTGTATTTAAAGGGT
GTGCTGCACCCTGGCCCCCGGTAACGTTCTTGACTATTTAAAAGTACTGTGCAGTATAGG
AGGTCTTAGGTATATAGTAATCCAGGGGAGGTTCCCCCAGATTCATGAGCCCGTGAGGAA
ATGTAGGAGGCTAGAAAGGGGAACCATGAGAGTATCCATGAGAGGATAATTGAGGGGACT
CTATTTCCAGAGGAATGGAGTAGTAAGTGATTTGACTGATGGTACAGATTGTGTTCAAAG
GCACGGACGCCAGAGAAAAATGTTAGACTTTATGATATGCATCCATACATTAAGTTATTG
TTGATGGTCATCACTATCTTCAGCCAGCTCCAGCTGTCCTGCCTGTGCTACCTCTAGCGT
AGTTGTACAAGTGTTGGTCCTGCAAGTACACGGCCTGGATGGGAGTCCTGGCTCTTCCTT
TCTTCTGTAGTTTTTCTTAAGTTAAAAAATAATCTCCCTTGTCCATAAAGCATTTGGAAT
ATAAAATGCATAGCAAAGGACCTGTAATATGTACTGTTGATATACATTACTCCTTAATTA
TTTTTTTTTCCTCTTTCATGGCACATGCCGCTTTCCACTTCATGCATTTGTTTCAATACG
AACGAAAGGGAGCACTAGTCCATCACAGAGAGACTGACTTCACTTCATTGAGATGACCTA
CCCACCTGCCTTGTAGCTACTTGTCTTGCTTAACACTCACTATTCATGGACCCTCTTTGT
CTATAGGCAAAGATGTTGTACCTCCCTTTCAGATTCCTGCTCCCCCCCCCCTCTGTCTTT
TTTCTGTTGGTGAGACTCACCCACATAAGATTCAAATACTGGCATAAAACTCATATATTT
TATAAAATATTTTATTTTTACATTTTTACTACTAGATTTTTACCATTAGTGTTTGATAAA
CTGTTATACCAAATAAGGAAATTTCTTTCTAGTTGTTCAGGGACTTTTAAACTTAGTAGA
TTTAAAGTTTTGCTAAGTTAACTATCCCTTTTTTTTCTCTCATCTGTTCATCACATTTCT
AAATTTTTATAATACTAAATTACTGTTTATTTGTGGAGATGAACCTTATTTGTCCATTGG
TTTGATTCCTTTGATTGCTTTAAACACCTGGTAAATTGTTTCCTAATGTATGAAATTTTG
ACAAGTTCATATGTAAAATGGGCACATAATTTTCCTTTCGTTGTACTATTTGTGACTGAT
CTGGGTGTTTATTTAAGCAAATGAAATGTTGCTTGTTAGACATGGAATGTTACTTTTTTT
TGGCTTTCTGGGTCATACCCAGAGATGCTCAGAGGTTACTCCTGGTTTTGCACCTAGGAG
TTACTCTTGGTGGTGCTCGGGGGACTATATCTGGGTTGGTGGCCTCATGCAAGGCAAATA
CCCTCCCTACTTTACTATTGCTCTGACCCAGGATATTACTCTTTTGTTCTTTGTAAATTT
ATATTAGTCTGTACTACTCTAATAGAACTTGGTAAAATTCACTTGTAAAAGCTCTCTCTA
TGTGGTAAGACTTAAAATTTTAATTTGATGACACTGTTCAAGAATTTTTTATTCTTGAGT
CACTTTTGTTGTTCATTTTAGGAATTAGTTCACTATCTCACTTTTTAATGTGTTGGTACG
GTATGTGAACATATACTCTTGTATTTAATCTCTGCAACTTTTGTAGTTGCAATCCCTTTT
TTGTTCTGACATTATGTGGGAGCCCTTCCTCTCTCTCGCTCCTTTTCTCTCTCCTTTTTC
CTCCCCTCATTGTGGGAATATTTGAATCCAGAGCCTCACTCATCTAAGGCATGTGCTTCC
CTTTTTCTCCCCCTTTCAGAAATTTTATTAAAAGTTATGTTTTATTACCTAGTTTTCAAA
ACCAACTTTAAAGTTTTGTCTAGTGTACTTCTATTTTTGTCTTTATTGTTTTCTTCTGTT
GGATTATTCTTTTCTTCTAAGTGAAAGGGGAAGCTTTGTTGATGAATGTTCAGTCTTCTC
TCATACAGTATTTAAGATTTTTTTTCCAGAACAGTTTGCATCCCTATACTTGTTCTAGCT
CTTGTTAAGTTGCGTCTTTCATCTTTACACTGTCCTCTTTTCTTCCTCAGGTAATCCTTT
GATATGAGTATGTTTGTCATTAACATGGCAGCTTATATGGAGATTGGGAGATATTCGTAT
TTTCTGTCTTTATCCTCTGTAAAAAACTAAAGCATGCCATCGGGCGCGCACACTCTCGAG
CTCTCCAGGCGGCTCTGTCTCACCGCCTGCGTTNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNGAGTATGGAGCACTGTAACAGGAGTAACCCACTAAAC
CTAAACTACCTGAAGCTATGTTATCCTACAATCCTCCACCCAGTTTGTGTTTGCATTTTG
AAGGCTATAATCAGAATTTTTTTTAAGTACAAGTCAATCTTCACTTAACTGATAAATTCA
ACCTTGTTTTATATTATAGTTAACCTCCTTAATCCATGCGGGATATGGATGCCCCAAACT
GCATATTCTGAGTCCCGTGTATACCTATTATTTATACACTTATATTTCTAATAAAGTTTA
ATTTATAGACACAGGGGATTGCCCGTTACGGGACATAGCTGAGTGGTAGTGTATGAGGTA
CTGGTTTCTATCTCTGGCACAATAGAACAATTAGAACAGTATTCATTAATAACAGCTAGG
TAAATGTGAACTCTCTCTAGAACTCAAAATATCTTACTTGTAGGTTGTATTTTCAGACCA
CTGCTGCACTTTAGAAAGCAGACTAGATTTTTGAACTTTATCAAACCTATGTTCTTGGTC
CTAAGCCTTTGGTGGGGGGTAGGGGATTAAAAAATAATTCAAGTATAGGTCACATGTTTT
CAGTAGTATTCACCTGTATAGTTTTGTTGCACAGTTACCTTACGTCATGCCACCGAAGTG
CCTGAGGTACCCCACCACTGTCCTTTTGTTACTTGGAGACCACTTTCTCATTCATTTCTC
CCTACCTACCTCCTCCTTGTTTGGTATTCTCAGTTCTGTAGTTCCAGGATCAGGAGTTTG
CTGCCATTTGATATTTCATAGGTTTTCTTTCTTTTTTTTTTTTTTTCCTCTTTTCCACCG
GTGAGGGAGGTCCTGTTTGTCCTTAACATGAGTATTGCTTTTAACATCATGCTCTCTAAT
TGTATCCAAGTTACAGCATACTGCATGATTTCATCTTTTCTTATGACTGCATAGTACTCC
ATTGTATATACATGCCACAGTTTTTTTAAAATTGTTTATCTCTCATTGGATGTTTGGGTT
GTTTCCATATCCTTCAATAAGGGCTGCAATGAACCCAGGTCTCTTTAAAATTTAGCTCTA
ATGATTTTTAAAACTTTCATTTCCCCTTCTCCCCGTTCTAATACATTTTATTAACCTTTT
TTTTTTAACTGGCTGCTTTAGAAATGTATCATTTATGCATTTTATAGGGAAAAATTTCTT
TGGCCATACCTGCAGTGCTCAGGGACTACTCTTGGTTTGTTGCTTGGGGTTTGCTCTTTG
CATTGTTTGAAGTATTATGCAGTGCTGGTGATTGAATCCGGATTTCCTACGTGCCCCTTT
GGCCCTTGAGCCATCACCCTGGCCCCAAATGCTGCTTTTTTTTCCTCTCTCTTTTCTTTT
CTTTTTCTTTTTCTTTTTTTTGCAGTGCCAGGGATCGAACCAAGGGCATCACACATGCAA
GGCAAGCACTCTACCACTAAGCTACATTTCCCAGCTCTGTTGATAGAAATTCTTGTGATG
AAGTCCGTTGGTTATAACTTTTGCCTATTTTTTTAAATCTGTCATTATATTTTTATTTGA
AATGTAATTTAATTGAGTACAGCAGATTCTTGGATAATGTTTCATTCACTGTAATTTCAA
TATGACTTCCTAATCTATGTTGAGAAATGTGGATGAGAAAATTCTGGCTGATGTTCAAAT
GACATTACACAAAATGTTATTATTTAAGAACCTGTTTTTATTATATGCTCATTTAGAGTC
ATTTGTCTAGAACTTATCAGTAATGTGAAGACTTATTATACATATTTGTTTTCTTTCAAC
ACTTTGAAGATGTCCTATTATATTCTGGTTTATATTTTTGATATTGAGAAGTTTCTGGTT
CCTGTTTTTACAAAATAATCTTTATATTCAAGTTTCTGAATATATCTTACAACTGCATAT
TCACTGTTATACTTTTCTATTTTTAAAATGCATTTCTGTAATAGTCTAGTGGAGCTTTTG
GGTAGAATTTTGTCATGATTTTTTTCACTGCTTCCATTTGTATTTTTGTCTTTGTTTTTT
AAGTGCCATAACTTGTTTTTAAATTTTTTCCCTCCTTTAGTTGCTTTCCCTCACCTTCCT
GGTTCTGCTCCTTCCTGGCCTAGTCTTGTGGACACCAGCAAGCAATGGGACTATTATGCA
AGGAGAGAGAAGGACCGAGATCGAGACAGAGACAGAGACCGGGAGCGAGACCGGGACCGG
GACCGGGAGCGAGAACGCACACGCGAGAGAGAGCGGGAGCGGGACCATAGCCCAACACCA
AGTGTTTTCAACAGGTGTGTGGGGTGCGCGGGGACTGTCAAATGCATGTATGTACCGCAT
ACTCTTTTAGGGTTTGTTTCTGGTGTGAAATCAGGAGGTCCAGTTCACTTGGGAAAGGGT
TGCTTGGAAAGCAGTTTTTTTAAAAAGCAGCGAGCTGTTAACTCTGAGAGCTTGCCTTAC
CTAAAGTAGCAGTCTCTGGATTTGTTTGCTCAACTCATCCCTTAAACGATTTTTAGAAAA
CTTCCTCACCGCCTCCCATATGTTTTATTTTGCCACACTTTTTATGTTAAGTTTAAGTAT
TTGCCAATATAGAGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNACTAGACTAAAAACATTTAAAATGCATCTCGGGCTCTAGTGTTGGGAACTTTGCATTT
CCTCTTTGGTGGTTAAATTCTTACTTTGGAGCAACTTTCCTCAAACTTATTCTAGTGTAA
AATACTTTCATCTCGAAAATGCTCTTTTTAGTTGCTCATCCTACAAACTTTCTTGCCATA
CACATATGGAAATATAAAAGTGTATTTTCAAATTCATTCACATTGTAAGACTCATTTTCA
ATGTAAAACTTTTTTCTGATTTTAGTTATTGGTAATTTAGGCAGATATAAATGCAAATCC
TTAAAAATTTACTGGTACTACATCCCTTAGTAGAGGCTTCTTCTGCTCGTTTTTACTCTT
ATTAGGTAATGTAATAGATAATCATTGAAATCTTTTTTAATTTTTCAACTGATGAATAGT
TTTGTTTTTTTAATGAATCATCATGGGATACAGTTACAGACTTACAAAATTTTGTGCTTA
CGTTTCAGTCATACAATGATCAAGTACCCATCCCTCCACCAGTGCCCATTTTCTACCACC
AGTGTTCCCATTATCCCGCCCCGAGGCACACCTCGCCCCCCCACCCCAAGCTTCCCCCAA
CCTCCTCTGTATCAGGCAGATTCCCTTTTTACTCTCTCTCTCTCCTTTAGGATGTTGTGG
TCTGCAATGCAGGGTGTGAAGTGGCCGTGGCCATCATATTCGGTCTATAGTCTACCTTCA
GTACACATCTCCCATCCCGAGCGGGCCCTCCAAACCATCCTTTAGCTGGTGGTCCCTTCT
CTAGCTGAACTGCCTTTTCGCCCAGCATGTGAGGCTGGCTTCCAAGCCATGGAGCAATCC
TCCTGTTCCTTGTCTATATCATCTTTTGGTGTTCGCTTCCCATTTTGTAACTTTATATTC
CACAAATGAGTGCAGTCTTCCTATATCTGTTCCTTTCTTTCTGACTCATTTCACTTAGCA
TGATACTCTCCATGTTAATCCGCTTATATGCAAATTTCATGACTTCACCTTTTCTGATAG
CTGCATAGTATTCCATTATGTAGATAGAGCAAAGTTTCTTTAGCCAGTCATCTGTTCTCG
GGCATTCGGGTTTTTTTTTTCTTTTTTTTCCCCCCCAGATTCTGGCTCTTGTAAACAGTG
CTGCAATCAACATACAAGTGCAGACGTCATTTCTGCTATACTTTTTTGCATCTCCGGTGT
ATATTCCCAGAAATGGTATTGCTGGGTCAAATGGGAGCTCAATTTCAAATTTTTTGAGAA
ATGTCCATATTGTTTCCAAAAGGGCTGAACCAGTTGGCAGTCCTACCGTAGAGATCAGAA
ATAGAGCCTCTCACATTAGCCCTTGCCACATTCTACAGTGTGACCAAATCTAGAACATCC
TGGGACTTGTGCTCCAAAACTGTTTCTTCATGCTTGTTTCCTTACCAGAACTTGTTTAAG
ACAAGTAGACCTGAAATACGACCCCCCCCAAAAAAAAAAACCACAACCCTACAGCATAGT
TCAGGTACCAGCGAGATAGTACAGCAGATAAGGCCCTTGTCTTAGATGCAGCCTACCTGG
GTTCCATCCCTTTCATCCTGTATGGTTCTCTGAGCACAGTCAGGAGTAATTCCTGACTGC
AAAGCCAGGAATAAGCCTTGAGCATCTCCAGGTGTGGCCCCAAAACAAAACAAGCAAAAA
TAAATAAAAATAGAGCCTATAGTTCCTTGAATAAAGTAGGTTTTACTGACAGTCACATTT
TAAAATAGGTTTTATTTGATTCTGTGATAATTTTTTGTTGGTGGTTCATACCCTATGTTG
CTCAGGGCTTACTCTTGGCTCTGCACTCAGGAATGACTCCTGGTGGTGCTCAGGAGACTG
ACTACATGTGGTCCTGGGCATTGAACCTAAGTTAGCCATATGCAAGGCAAGTGCCCTACC
CACTGTTGTGTCTCTAGCCCCGCTGTGGTGATGGTTCTATCCTGAGCCAAAGTATCATTG
TGAAATTGTTGGAAGGGGAGCCTTTGTAGAGAATTGGGAGGGTGATTAAAAGACAAGAGG
TAAGCGGGAAGGGAAATACTTTACCTGCTGCTGTGTCATTAGGAAGTTCAGATTTAACAG
AGAATAAAGAAGTTGGGTATATAGAAATTGATTGCTTAAAGCTTTCTGAAGTTGAAAGGA
ATTAATACATCTTTGTTTGTGGTATTGGCATGAACTATTCTCCTAAATAATAAATTCCAA
AATTCAATTTTTGGAGTGATCCTCCCTAGTGGTGCTCCATGGCTCTGGGCACCACTCCCA
GAGATGTTGGCAAACCAGACCAGTGTGTCCATGCTAGGACGAGGACTTCGTTTTCTGGGT
GCAGCCTTCCAAGAGCACCTCTAAATCTGAAAGAAATAACTTTTCTTTATATTCTCTGCA
AACACTTGATAAATTATCTTAAAGCAGGTCTTTCTTAGTCTGTGGGACCACTGTGTAACA
CTTGTATAGTAATTCCCAATAAATGAAGCATCAGTGGATATTATTTAAACATTTGAACAA
GAGGGAGATGAATACCCCCCCCCAAAAAATGGAGAAAAATAATACATAAGGTGATTTTAA
AAATAGTGGTGAAACTGGATTACCTAGTCCGATTTTGAAGTGAAGAAAAATCAACTTTCA
TCACTATGAGAAATTGTTTGTGTGTCATTGGGATTGCACGTGCAGTGCTCGGGGACCATC
CTCGTGACACAGGGCTCCTGTATGCAGAGCATGCATTCTAGGTCCTAGAGCCTGTCCCTG
ACCCCTGCTTGTGAATCTTCTTTCTTCTTCTTTTTTTTTAATGTACTAGTCTAGGTACTT
TTACAATGTAGAAATAAAGAGAACTTTTTCCCTCAAACGAGCAAGTGTCTATGTGGGTGA
AGCAAAATAGTTTTTTTTGAAAGAAGTTTGAGATCTGTCCAGAGAAAGAAACCAGCTATT
TTCATGGGTGAGGTAAATAAATCCCTCACCCATACCTCAAGGTACAGAGTGTTTTCGGAT
TTCTTTTGGATCAGAGAAGGAGTTTTATCATTTCTGGATGTGGGCTTATGCCTGATTCAG
GAAGGATTTGTTCTTGTTAAGATATGGTAATACAACACAAATAAAGTTTATTCTTTAATA
AAATCCTTTGGCCTAAAGGCCTTCAGGGACTTCATCTCGTCCACAGTTAGACCTCTTAGA
TAAGGAAATGGAAGTAGGAAAACTTAGGCAGAGATTATTACTGAAAATCTAGTCTCAAAA
TTTGGCAGCTAATGATTTGTCACTTTCATTTTTATTTATAATAGAATAATATTCTTGGGA
ATACACATTTCTTTATTCATGTATCTGTTATTCTGATTCTGTTATATACCAGTCATAGAT
TGTGTACTGAGGATACAGAAAGACACTCATACACTTCATAACAGGTATAGCCATGTACTA
CAGTCAGCATGACTAGTAGTGATTAGTATATTAAATATTAAGCTTAACAAAGTGTGTGGG
CAGAAACTAAATAGGGTAAATCAGTCTTCTTTCATATGTTCTTAATAAATGGAACACATT
GTAGGCACTGGTAAGATATATTGATTGAGTAAAGTTATAATTTGCACACAGATTTGTGTA
TGCCTTGGTGAATGCTTTGTGTTTGTGGGCAGGATCTGTTAACTTTAGTCACTTATATGC
CTGATTCTGTTCAGTTCAGGGGCATTGTTGCTTTCTAGGTAGTTGAGTTGTTTCTGCTGT
GGTTTAGAGTGAATGTGTTAGAGTTGTTAAGGAGCCTAGTGCCACACTTGATAGAGAAGA
CTAGCATGGATTTCTCTGCTGTAACTCGTAAGTTTTAATTCGTATAGATGATGTATAAGT
AGGAATTTTTTGACTAAAATTCTGAATGCTTTCGTTTTAANNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNTTCTCTTAATTTTAATGAAGTTTAAAGTGTTAATGGTTAA
ATCACGTTTAACACTTTTGCTTTCCAAGTGGCCAAGTTGTAGGGTATCAGGAGTCAGTAT
TCACCTAAATCTGACACAGAGTTCAAGTCAGAGAGGCAAAAGTTAGAAGGATATTGTGCT
GTTCTGATCTCAGGAGTAAATAGAAGTCAAGACCTTCCCCTACCCCCGGATCCCCATGAC
TGACATTTTAGCAATATGACATGCAGTAGGTGCTGTTACAAATTACAGGGTCATTGTTTC
TGAAAATTACAGACCAGTTTTAACATCTGTTTTTTAAGCAGTTTAATTGTGGGCACGAAG
AAAGCTGTTCATTCTAGGGCGTTTGAAATGAGTTCTAATGATTTCCAGGCCCAGCAAAAC
CTTTGCAGTACAGCAGCTGATCAGGAAGCAATGGAGGGGGAAGTGGGATTTGTATTTTGC
GTATGCCTTCTACAGAAAGGTTCCCATCATAGGGTTGCCTTTTGATCTCAGAGACCTCCA
AGCTAACATGTCTGTGTTAGGGTGAGAGGAAAAAGAGAGGGCTGAAAAATAACAAATTAT
TGGGGCAGCGATTTAACTATTAATCATTTGTCACAATGCTGGAAAATAGAGCATTAAACA
ACTGAGTCTGCCTTATATGTGGTGTTGCCTACTCCTTCCTATAGGTCAGGCCTATTTGTG
ACCAACTCTTGTACCAAATACCTATGTATATATTGTTGTCAATCCTCCAGCGACTCTGGG
AATCAGCATTGCATTGCCACTTTCCACATGAGAAGATGGAGGAGAGGTTAAGGCAACTTA
TTCAGGATCACTGAGTTAGTGGCTGAGTGAGGATGCTATCCTGGGCGGACTGCCTGCTCC
ACTGCCTGGTGCCACACACTGTATATACCTTTGAAATGTAAAGAACTTAGTGATGGCGAG
AGAACCATATTTCTGCTTGCATGTGGATATTGGAGAAATTACCTTCATTTTCATATTTTT
ACTACATTAATAGACTTGCCAAATTTTTAAAAATTCATATGCCTTTAGCCATGTAGTCAT
TGTGAGTTGCAATTTTAATATAGTCTTAGGCTACTAACTTTGTATTGAAGATTATACAGT
AATATAAGAATTTTCGTTTCAGGAATATGAACCACATAAATGTGCTTTTCATTCTAAAAA
TAAAATGAAGCTGCTGATTAAAATTTAAATCAGTTATAGATCCAACATTTAGAAGATACC
ATTCTCTTAAAATTTCTATCCCATAAACTTTTAAAAGCAGAACAAAAATGGTGCTTTAAT
ATGATTTGTAGTTATTAAATATTTTATACCCTTGCATTTAGTACTAATTTGGAAACAGAA
TTGTTTTCCTTTTAATTCAGCATTGAATTTGCCACATGTCCTTTATAAGATCTACAGGAG
GCTTCTGGTTTGGCCTCAGATCCCATCCCCTCTTCTGCATTGTGAACTTACAGTCCAGTT
GTCAAAAAATAAAATGTGTTTTTGATTCCAATTTCAGTGATGAAGAACGCTATAGATATA
GAGAGTATGCGGAAAGAGGCTACGAGCGTCACAGAGCAAGTCGAGAGAAAGAAGAACGAC
ATAGAGAAAGACGACACAGAGAGAAAGAGGAAACAAGACACAAGTCATCTCGGAGGTTTG
TTCTTTAATAAAATAATGAGTCGCTGAATCACCTTGAGGCAAGGAGAAATAATTTGGCTA
CAGGAAATAAAAGCAAACACTCTGCAGTGATCAGTACAACCTATGCTTTCCTATTTGGAA
AATTCAGAATTACCTGTTGAAATATTTGATTCCTTATAGGCTTCAACAGGAAATCTTCAG
TCTTACAGGACTACATTCAATACCTATAAGTAGCATGGGATGCAAAATTATTTGACATCT
TGTTATGGGGAAGGGAATGTCAGTATCTAATGGGAAGAAAAGCAATGTTCAGTTTGGTTA
GAGAAAATTACTGGATCAGAAAAATGAGTTGGAGAAAATTCAGTAGTCTCAAAAAATCAG
TATTAAATTTTAATGCCTCTTGTTTTCCTAAAATCAGCCTAGAAAGTATTTTCCATTTTG
ATTCAGTGTTTCAATTTTTAATTGGTAATAGTCTTTCAGAATAAAGTATATGGGACTTGT
GAATCTAGAACAGGATCAATGAAGGTGAACTGAACCTGAAATGTTAATATAATGTCTGCA
TAAAAGTTAGGTAAGTGGATTGCTCCACAGACTATGTTCAAGAAAACAAAGGAATGATTT
AAAATGCAGTGTTACGTGAGAATGTACAGAACGAGTTGCTTTGTTAAATTTGTAGCCTTA
ACCATTTCTTGAGATGCTCACGTTTCCCTCTCCCTCAGTAATAGTCGACGGCGTCATGAA
AGTGAAGAAGGAGACAGTCACAGGAGACACAAGCACAAAAAATCGAAAAGAAGCAAAGAA
GGAAAAGAAGCTGGCAGTGAGCCTGCCCCCGAGCAGGAGAGCACCGAAGCTGCGCCGGCC
GAGTAGCCTGGGCATGGGTGGCCTTTTTGTGTATATCAGTGCCAGAAATGGATGCTATCG
ATCTTGTTATTTTTTCTGGATAATGTTTAAGAAATTGACCTTTAATCTTTTTCTGTTAGT
ATGCAAAGTTAGCCTCCCCACCCCAACCCCCCAAAAATAAAAGAGTGAATTTTTCATGTT
AAGTTAAAAAATTTTGTCTTGTAATATTTAAAAAATAAAGCTAGCAATGACTTTATACTC
GATAGTGATGTGAATGAGTCCCTTGGCAGGGAGTCTCCGTGATAGAGCTCTGTAAACACA
CACACAGGGTCTAAAGCAGGCCAGGGTTCTAGCTGGGCTAGTTAGTGTTTCCGTGAGCTA
ATCAAATTCTGCTCTTAAGGAGGTTGTACTGTCAAAGGGACCTTTTATTCTTGATTCAAG
GTGGTCTTTTCTACTTCCTGCTTTGGACTGTTACTTATACACAGTTTTGATAACACAGCT
TTTTGGTAGGCCTTCAGTGATCTAAATCTGGGTTCATGGTAAAACAAAATGGGGAAGCTT
TCGTATGAAACTTAATAGACGTATGCTCAGGTGACATCTGCGTGTCAGCTTGCCCCTACT
GTCATTTCTAGCAGACACAAGAATACTCATCATAGTAACAAAGTTGAGTTGCTTTCTGAC
TGTCAGTGAGCCAGGATCAAGTTAGCTAGTTTGGCCTTGATGCAGGGTTTCCAAGGCTCA
TTGGTCCAAAAGTGAGCAGAACTTAATGATAATTTTAGACAATTTGTATTGATAAGATAT
GTTTGTAATTCATTGAGGGCTAACCCTTAGATATTTTTCAGTGACTGATAACCGGAATGA
ATGATGAGGTGCTGTCAAGTAGTGATAGTAGAAAAGAAATTAGTATCACATGCTAAAAGA
CAACTAGTTTTTGAAAAATATTTATTTCTCATTTGATGAAATGAACATTTTAGCAATGCA
TTTTTAAAATCTTCTGGCTTTAAATTAATTTTGAAATGTTTAAATA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1085, 13535..13579, 13682..13721, 14453..14510, 14787..14890, 16983..17047, 17806..17913, 18828..18958, 19238..19306, 28530..28639, 50217..50324, 58461..58554, 60727..60883, 109865..109919, 112155..112210, 118300..118513, 124417..124554, 125258..125405
1001..1085, 13535..13579, 13682..13721, 14453..14510, 14787..14890, 16983..17047, 17806..17913, 18828..18958, 19238..19306, 28530..28639, 50217..50324, 58461..58554, 60727..60883, 109865..109919, 112155..112210, 118300..118513, 124417..124554, 125258..125402
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved