Sorex_araneus Locus KIF15
snOPY snoRNA Orthological Gene Database
Sorex_araneus KIF15
Sorex_araneus
KIF15
GeneScaffold_4967
SNORA36
47658..47791
68527
ACTTAGCAGATTGAGTAAATGCACAAAAAATCAATTGTTTCTTCTACTAAACCTTATGT
GACTTGAGCTTTGGATCTTGTTTTTGGGCCACATCCTGCATTGCTCCCAGTGGGTGGGAG
ACTGGGGGATACTCTGTTGGGTTCTGAGCCCCGGGTCTGCTCAGCGCCTTGAGCTGTCTC
TCCCGTCCAAGGTTTGGCCCAGGGTGCAGATGCCATCTCCCAAACACAACAGCCTTCTTA
TTGAGTGATCTCTCTCTCTTCCTGGGTGCTCTTGCACATACTCTTTCTCTCTCTAACATC
TCCCAACTCGGGTCCTCGGACTGTTTGACCTAGTGGACTCCAGTGATCTGGAAAACTGCA
CGACGCGACCACCACGCTAGTAAACAACAGCGTCGAAGCGAAGAGACGAGAGGCAGGAAA
GTGAATTAAGTATCTACCAAGGACCAGACGCTCCACCGGAGTCACCTCATTTTCCGGGAC
AATGGCAAAGAGCTTCACTGGCCCAGAGGCTGCAGCCGAGGCTGACCAGCCTGAGGTCCC
AATGTTACCCCCAAGGGGGCGGCGAGCCGGCGCGCGGGGGGTCCTGTCCATCCACACCTG
GGCTTCCGGTGCTGGCGGAAGCCGGGAAACGCGACGGGCCCAGGCTCACCTTGGTTTCTA
CGGTGGGTCCTTCCCTGTAGCCGACCCGCTCTTTGAAGCGGGCCAGGAAAGTCGGCTCGG
CGGGCCGCACGTACGACACTTGGTTCCGCTTGCTCATGGCCGCTGCGGGCATCCAGAGGC
TCGGGAGAGTCGCCTGAAGACGGCGCCGGGAGTGACGTCACGCCGCCCCGCCCCGCGCCG
GGCAACATGGCGGCCCCCGTCCCGGCGTCAACGTTCCGCCGGGCGCCAAATTTAAATACG
CGGCCATCTTGCTTGGGGCTGGAGCTCGGCGTCCGGCGCGATCGGGCGGGGGAGTGGAGG
CTCGGCTGCGCTGGACCCGGAGTCAGGCTGCTGGGGCCGCCATGGCGCCGGGCTGCAAGA
GTAAGTCAAGCGCCGCCGCCTCGTGAGGCCACGGGCTCCCCGCGAGTCGCAGGGGGCGTT
TTGTTGCCCCGCGCCGCCCCTCACGGACCTGCCGATCGGGCCTTGTCGTGCGTGGGGGCG
GGGGGCAGGGGAGTGGGGGGACGGGGCGGCCGGCGGGGAGCACCCGGGGCTCTGGGTTTT
AGGCGCTGGGGCTGCGCGGCGAACCCAGAGCCGGAGCCTCGGGCTGCAGCGCCGTCCGGC
CCCTCTGCAGGAGCGCGCTCCGGGTGCGCGCGGCAACTGCGCCGCGTCCCGCACGTTTCT
CCCGGGGCCGGGCGGCCTCCCCTCCTCCCCTCCTTCCTCCCTTCCTTTCTTCCTCCCTCC
GCTCCTTATTCCTTCCTTCCTTCCCTTCCCTCCCTTCCTTGCCATACTGACCACACATGC
GAAGTGAAAATCAACCCCACACTAACTCTTGCCCTCTTCTATAATTCTCCCCACTCGGTG
CTGGACCCTAAGGCTCAGAGTCTGGACTTCCAGCTCACTCGCCCTGCTGATCTCAAGTCG
ACTTCAAAACTCGATCTCTGGTGTCTCACTCTATGGAACCAAAGAAATGTGACTCCTAGC
GTGAGTAGGTGAAGGCCTCAACCCTGTTCTCCCTTAGGCCTGGTAAAGTGAACTGGAAGT
CAAGAAACCCCACTCAAGATGCTGGAGCAGGAGCTCTCAAAAACTCAATCTTAGTGAAGA
AAGAAGAAGATGAGGGGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNA
TGGGTCGGGCAGGTTTGTGGCTGAAGGCGAAGGAACTGGGATCCGGGCTGGGGTCAGAGC
GTCTGTTTACATCTCCAGGCAGGCAGCCGCCCCCTTTGAAGCTCCTGTGGGCTGGGCTTC
CTCCGAGCCGGGGTCGCTCCCAGGGCTGGGGTTGGGCCATAGCCTGCGATGTTCGGGGGT
TTCCTGGCTCTGCCTCTATGCTATGCGGCTCTGCGCTTTTTCTCTCTTTCTTTTCTTTTC
TTTCCTGTCCTGTCCTGTCCTGTCCTGTCCTGTGGTGGGTGAGGGTTGGGGTTGGGCCAC
AGCCTGCGATGTCAGGGGCTTCCTGGCTCTGCCTCAGGAATGACTCCTCTCATCTTGGGG
GATTGTATAGGATGCCAGGAATTGAACCCTAGTTGGCCGCCAAGGCAAGAGCCTTACCAT
TGCTTTGGCCCCAAGAAAACTTGCTATGTAAGCCACAGTCTCACCTGAGCCCTCACAGCC
AGGGAGGAAATCCTGCAGGAAGGAGCAGAGGGCGAGGGACTGTTCTGTGTCCTTAGCTGA
TGGGTCCAACTCCTGGCACAGAGAGCAGGCTCCCAGGGGAGCACCAACTCCTGGTGCTGG
GAGCAGGGAGTGATCTTGGTCCAGATGCAACCGACTTCTCTTCTGAAAATTCCTAGATTT
CTGTTGAAGAGATCTTTCTTCTTAAGAGGCTGTTTGCTTATAGGAGCACCTAAAGTTGTT
AAAATTTCACCAGTTTCAGTCCTGGGGGTGGGTGGCAGCCTCCGGAGTCACACTTATGAG
TCTGTCTTGCCGAAAGGTTGGAATGGTAACACTGTCTTTATTTGAGATGGAGAAGCACGT
TTGCGGTGGAGATGGGATCAGAAATTAGGTTTTGGGTGCCTTCAAGTAGAAGCATTGCTT
ATTGGACATCTAATTTAGAGAGGACAAGTAGGCAATTTTTAAGGGGCTAGGGCTCACTTA
GGAGAACTCTAGAGGGCAAAGGTATCAATTTGGGTATCCTCAGTGCATAAAAAGTATTTA
AAGCTTTGTATTAAATGCTTTGTAATTACAGAGTACTTAATACAAAGCATTAGAGGGGAC
ATCATCCCCATAGAGCATCTAAGGATGGAAGAGAGGGGCAGACCCAGGCGTGGATCATAC
AGTGCTCAACTGAGAAGACGGAGAGGATTGTTGGGAAACTGAGGAGCTGGCCACATGGCA
TGGGGTTTATAGACTGCACTTTTTAGCACATTAAATGACTTCTTGTCTTTTTTTCCCCCC
CACCTCCAGCTGAATTACGCAGCGCTGCAAATTGCCAATTGAACCAAGCAAGGTAAGTAA
ATACCTGTTGGTGACATAATGGATCAGGATAGCAATATTTCTAAATTATTAGCCATCATT
AGCAAGTGGTAATTGTATTAAAGCTTGGCTTTTCGCTACTTGGTAGTCTGTGGAGGGTGG
GTGGGGGTATTGCATCATTCTCCCACATTCCCCAAGCACTATCATCTCCCATTTCTTGTT
AAAAGACAGAATCAATAACATAAGTCAGCCTTGGGATGATTTACTGCTAATTAAGAAGGA
AGTCATGGGGGCTGGAGCAATAGCACAGTGGGTAGCGCGTTTGCCTTGCACGTGGCCAAA
CTGAGTTCGATTCCCAGCATCCCATATGGTCCCCTGAGCCCCGCCAGGGGTGATTCCTGA
GTGCAGAACCAGGAGTAACCCTTGTGCACCGCCAGGTGTGACCCAAAAAAAAAAGAAGAA
GGAAGTCATCTGTGATAATTCTCAAAGCAGGACTTAAAGCACTATCATCGAGTGCATTTC
AGATGGCTCTTGTGAAACAAAGCAATAAAGGGTGGGAGTCCTGTGAGATTCATTTATTTC
TTATTTATTTACTTATTTGCAAAGCAAGAAAGTTTTTATTTTTATTTTTATTTATTTTTT
TTGCTTTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCGGGGGACC
ATATGGGAGGCTGGGAATCGAACTCCGTGGGCGGAGTGCAAGGCAGACGCCCTACCGCTG
TGCTAACGCTCCAGCCCAGAGCAAGAAAGTTTTTTTTTAAATTTTTTTTTCAGAGCAAGA
AAGTTTTTATTGAAACTAGAAAAATGCGAAGGAAAAGAAAGAGAGAAGTATTTGTTCTAG
AGAGAACATAGGCTTCTCATGGGTGGAAATGAGCAAAGAAGCTTAGAGACAAGCAACAGA
GAAACATGTTCAACAGAGACCAGGTTTGAAGAGCGAGCCCGTGTGAAATTCATTCAAAGA
GGGAAATGGGGGCCGGAGCGATAGCACAGCGGGTAGGGCGTTTGCCTTGCACGCGGCCGA
CCCGGGTTCGATCCCCGGCATCCCATATGGTCCCCCAAGCACCGCCAGGAGTAATTCCTG
AGTGCAAAGCCAGGAGTAACCCCTGAGCATTGCTGGGTGTGACCCAAAAAGCAAAAATAA
ATAAATAAATAAAAAAACAAAGAGGGAAATGTTAGGGCTGGGGGTGTGGCTCAGAGTAGA
GCACTTGTCTTGCAGGTGTGAGACCCCCTGGGTTTGATCACACAAACAAAAACTGTAAAA
GAGGTACATGTTAATGCGTAGATCTTGGGTTTTATTGAGGGAAACCTGAGTACAAAAAAA
GACCTCTGAGGGCTGGAGAGACAGTACAGTGGTAAGGTTCTTGCCTTGCTTACAACAGAC
TGGGAGTTTCATCCCCTGCATCACATAGGGTACCCTGAGCACCACTACGGGTGATCTCTC
AGTACAGGAATCAGAAGTAAGCCCTGAGCACTGCCAGATGGGGCCCTAAATCCTCAATAC
TCCCCCGCCATGCCCATCCCACCCTCCCTAAAGAGAAGTATACAAGTTTTCTCTTGTGAA
CTTAATTGCATCTTTTTTATACATTTATCTATCTTTAGCAATGAAGGTGATGATGCCATC
AAAGTTTTTGTACGGATTCGTCCACCCAAAGAGAGCTCTGGACTGGCTGATGGAGAGCAA
AATTTATGCTTATCCGTGCTCTCATCTACGACTCTCCGGCTGCACTCTAACCCTGAGCCC
AAGGTCTTCACCTTTGATCATGTTGCAGACATCGGCACTACTCAGGTATGATCATTTAGA
AACTTGAACTTCCTACTTGAGACATGGAAGATTCTCTTTTTTTTGGGGGGGTGGAAGGGT
GGGGCCATATCTGGCGATGCTTGGATTACTCCTGGCTCTACACTCCAGGGATCGCTCCAT
CTGATAGTCTTGGTGGACCGTATGTGGTGCCGGGGATCGAACCCAGATTGGCCATGTGTA
AGGCAAGTGCTCCTCCCTGCTATGCTGTTGCTCTGGCCCTGAATATCGGCCTTTCTGATC
TCATTTGAATTAGGAAGTTCAGACATTCCCAAANNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTGTGTTTTAGGGGCCGGAGC
TTTAGAACAGGGAGCCCGTTTCCCTTGCAGGCAGTTGACCCAGGCTCCATCCCCAGCATT
TTACATGGTCAGAGTAATTCCTTAGCACCGCCGCCAGGTGTGGACCCTTCCCCACACCCC
GCCCCCCTAAAAAAAGAAAAAAGAAATGTCTCTTAGTTTTGGCTGCTATAAAAAAATATC
ATAGACTTAAGCAACATTGATCTATTGTAAATGAGCTTGTAGATGGTTCATTTGGAGTCT
TTGACAGTCCAAGATCAAGTCAGTAGGTCGGGTCCATGAGAGTATGTTTCCTGGCTTGTA
AAAATATATCTTCTTGCTGTGTCCTCACGTGGATAAGAGAGAAAGCAAGTTCTCTTACAT
TCCCCTGTTTGTAAGTGTACTGCTCCCACCTTGAGGCCTCCACACTCAGCACTTAATAAC
CTTGGCCATCTCCATCTTCAGATAACTTCACTTTGGGAATGAGTCTTTCAGCATGTGAAT
TTGGGGGGAGAATGGTCCCTTTATAGCAGAGAGATACATAACTCTGGTTTCAATAACTGC
TCCTCTATTTAAGGACAGTTTAGTTAAGATCTAATACTAGCCAATAGGATTTGACTGTGA
GTGGGGCTGGAGCGATAGCACAGTGGGTAGGGTGTTTGCCTTGCACTCGGCCAACCCAGG
TTTGATTCCCCGCATCCCATATGGTGCACCGCCAGGAGTAATTCCTGAGTGCATGAGCCA
GGAGTAACCCCTGTGCATCACTGGGTGTGACCCAAAAAAGCAAAAAAAAAAAAAAAAAAA
TTGGCAGTGAGAAAATTTCCTTTATCCATATTGCCCGCAACAATAGCTCCTAGCCTCATG
TGATTATTTAATAGTAAATCAAATTTAGAACTTAGTTTTCTCAAATGCATGAACTGTATG
TAGCTGTTGAGCGCTGGAATTGTGGCTGAATACATGACGTAAGCTTTAGTTGTTTTTCTT
GTTTTTGTTTGGGGACACACCAGACTGTGCAGGATCACTCCTTGGTGGGCCTCAACATGG
GTTGGACCCAGGCGTCTTACTGCTGCTATACTATCGCTTTGGCCCTTACAATTTTTTTTT
GTTATATTGCAGAATGTGGCTTAGGAAAAATATTTTTATTTTTTAAAATGTTAAATAACA
GGTTTATTGCCAAGCATGTATTTTTTATTGTTACTCTGTAGAATAATTAAGGAATATTTG
TTTTGTCTTTGTGACTAGTTAACATATGTGGTGCTTTTCTAGGAGTCAGTCTTCTCAACT
GTGGCCAAAGGCATTGTGGAGTCCTGCATGAGCGGTTACAATGGGACCATCTTCGCCTAG
TAAGTTGCCTCTTCCCACAAGGGGTGCTTCTCTTTCTTTTCTGTGGCTGATGTAACAAAT
TAGATTTAGTGTTTTGAAGTGATATGCATTTATTATAGTTTTAAGTCAAGCGTGACACCG
ACTTCACTAAGCAGAAAATCGGCATCTGCAGATCCATGTTCCTCTCTGAAAACTCTAGGG
AAGAATGTGTTTCCTTGGCTTTCCATGTTCTAGAGATCACCCAGACTTCTTGCCTTGTAC
CCCATCACCTCTCTGCAAACCAACAACATTTAGCTCTGATTCTTCTCCCCTAGTCACAAC
TCCTCTAATTGTTAGCAAGGACAGATACTCTGTTTTAAGGATTTACTCAGGGTTCCATTG
TTTAGCCTGAGGCCACACGACTGATTAAAGTGCAGATGGTTGAGTTCGATTTTGTGGACA
ATATCTGCTTCGTATTTGAAATCATTCTATGAGAAGGATTTGTCTCTTATTCCGGATTTA
TTCATTTTTATGTCGTGGACTTACATTTTATACTTTGGGCTATATAATCTAATACTGTAT
AATTAGTAATTTCTCTTCCTCAGATTGATCTGGTTTGATCATTGGGAGCTATTCAGAGTT
GGTTTCTGTGTCCCTTTGACATGTTAAATCTTATAGTTTGAGCACTTCCTTTATCATGCT
ACAAGGTGCTTTATTTTTTATTTATTTATTTAGACTCACCTTGTATTTTCCCCATTTCAG
ATCTAGAATTAAATGTATTCCCCAGTGAACTCTTACTCCTTTTTATTGGAGGAATGACAT
TTAGAAAGGAGATTAGGGCACTGTATATGCTTGTTGGCTTCTGNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNGGGGGGGCGGGCGCTGCTGTGTTCAGGGCTTACTCCTG
ACTCTTCTCAGGGATCATTCCTGGTAGTGCTCAGGGGACCATATAGGATGCCAGGGATCA
AATACAGGTCGGCTGCTTGCAAGTACTTGATTTACTATCTTTCTAGCCCTCATGGGATCA
TATGTGGTCCTGGGAATCAAACCTGAGTCGGCTACATACAACGCACATGCCTTAACATGT
ACAGTTTCACCATCCCTTTTTTGTTTGGGGGCCACACCTGGTTGTGTTCAGGGCTTGCTC
TTGGCTCTGTGATCAGGGATCACTCCTGGTAGTGCTCAGGGGACTGTATTAGGGTGCTGG
GGTTTTAGTGGGTTGAGTATGTGCAAGCGTCCTACCCACTCACTGTACTCCACTAGCCCT
GTTTTTGAGTAATTTTTGAGGGGGAGCATGCAGTGCTGTGTATTGAACCCAGAGTCTCCC
ACATACAGAAAATACCCTGCAGCCCTTTGAGCCATCTCCCTGACAAACTGAGGGTTTCAC
ACACAGGATATGGGTTCCACCGCTGAGCTTCATTCTTGGCTTTAATTTTTCTTTACTTTG
GGCCACACCCAGAGGTTCTGCACTCATCTGCACTCAGGAATACTCTCGAGAGGTTTGGGG
GACCATACAAGATGCCGGGGATTGAATGTGGGTTGGCTGTGTGAAAGGCAAGTGCTTTAC
CCACTTTTCTCTCTCTCTCTAGCCCCTATTCTTGGCCCTGATTTTTATTTTAATAGCTTG
AAAATATATTTCTTTAATATTTGTTTTAAGAGACAAAGTGAGTAAGATGTTAGAAAAGAA
TACAGAAAATACCAGCAAACCTTTTGGCATATGCTATTTATGTGATATATGTAGCATGTT
TGGTGGTACTTTTTTTATTAGTGAATCACCGTAGGGTACAGTTACAAACTTATGAACTTT
TGTGTTTGCATTATAGTCCTAACAACGATGGTTTACCCATTCCTCCACCAGTGCGTATTC
TCCCCCGCCAATGTTCCCAGCATCCCCTCCCACTACCCCTACCCCATCCCCAACCACCCC
ACCCTTTTTATTCTCTCCTTTTGGGTGTTGTGGTTTGCAATAGAGGTATTGAGCGATTGG
CCCTGATTTTTAAACAGAAAACAAGGCTTTAGTGCAGAAGTTTATATATTAGGTCATTCA
TGTTTACATTGGATAGTAGTTTTCTAAACTTATGTATAAAAACGAGATAAAACTTTTTTT
TTTTTAAACAGTGGACAGACTGGTTCAGGAAAAACATTTACTATGATGGGTAAGTAAACG
ATTGCTGACCTAATATACCTTTTCTATAATGATAGCATGTGGTACTCTTTTGGGGAGGGC
TTAATTACTGTGTAAGATGAGTGATATTTCCTAGCCCTCTGTGAGACTGTGAGTTCCCTT
ATTGGAAGGTCCCTATTTGCAGCCGTGTTCCCAGCTCAATGCTTAGCCCAAAGAAAGTGT
GCAGTAAAACAGTTTTGAGTTGAGCTAAATGAATTTTTATATATAATGTAAATTCTTAAT
GGCCACAACACAAACCAGAATTTCTTGTCGGTAGATACCCACCACCACCATCTTCTGAAG
TCTTTAGTACCCTGCTTCTGTCATTGATTTCTGATCTACTCTCTGGAATATTTGTTAACA
TTATCAGTTGAGAAGTCTGAGAGGTTATGTGATTAGCCTTTGGCCACACAGTCAGTGTCT
ACAGTTCAGCCTCAGAACAAATGTTGTAATGTGAGAAGTTAAATTAGTTGGTATTTGTGC
TAATTTTGGTGCTGGGCAGATGGAAAGGTTTCAAGTTTATTTTATTGGCTTTTTGGGTTA
TACCCAGCGATGCACAGGGGTTACTTCTGGTGTTGCTCGGGGGACCATGAGTTGCTGGGG
ATCAAACCTGGGTCAGCCGCGTGCAAGGCAAACGCCTTACCCACTGTACTATCACTCCAG
CCCATCAAGTTTGGTTTTTAACTTATAAAATAACTTTAAGAATTGGCTTATGGTGGCTGT
TCTCATTTTCTTTAGTAGATTCTATTATGCGATCTTTAAAGACAAAAACTAAATTCATTT
GGGGCACAGAGAGGAAACTGATTTTACGATGTGTTATCTTATTGCAGTATAAAGTAGTCT
TGTATTAACATTTTGCAGTACTCCTGTAATAGTATAAAAATGAATTTATATGTAATTTTT
TTTATCATTTCTTTTAGGACCATCTGAGTCTGATAATTTTTCTCATAACCTGAGAGGGGT
AATTCCACGAAGTTTTGAGTATTTATTTTCCTTGATTGGCCGTGAAAAAGAAAAGGTAAA
ACTTGAAGTAGCAATAAAATGTCTTAGGCAGATGGGCAGTAAAAGTTGTAGGGGCCGTGT
TCCTCTAGCACTTTGGTGGTGTATGAATATGTCTGATACATAGTCCACAACACTGTAAGC
TGGAGACCCAGACTACAACCAGACTTAAAAATCTGTTAAGGGACCGGAGAGAGTAGAGCG
GGTAAGGCACTTGCCTTGCATGCTGCCAACCCGGGTTCTGTTCTCAGCATCCCATATGAT
TCTTTGAGCCCCCAGGAGTGATTCCTGAGTGCAAAGCTGGGAGCACTCGGCACTGCCGCT
GTTTCCCTTCCCCGTCTTTCAAAAAAATGTCTGTTAAAGAGGAGTGGAAGAGAACCAGAC
AGTCAGTGGAGGGAGGTTCACCCTGGTGGTGGGGTTGGTGGAGGAATGCTATATGCCTGA
AACCCTATAATGAGCAGCTTTCTAGAAATAACAGTGCTTTAAACTAAAAAAGAAAATAAA
CATTAAAATAGTTTTAAATGTTTTATGAAATAACCTATTTTTGAGTGGTTAACTTTTGAT
ACACAGGTGCATAGGTGTTACTTAATAGTATGGATTGGTTAGTATATAAAAAGAAATTTT
TGAATTCATAAGATAAAATTAAGCATTATTAGTTTTTAGTTTTTAATAAAAATTTTAAAC
CATGTCATGCTTGAACCCAGATTGTTGGTTTTAAAAAGAAGACTGGAGAAAAATTTCAGC
GGGTAGAGCGCTTCCTTGCACTTGACAGATCTGGGATTGNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATGTCCCATAGTTCCGGGCTTC
TTACCTCCTTGGCTGCACTGATTATAATTTTACTTCACCATGGCGTGCCAGCCTTTCCTT
CTTAGGGTCATTTTCCTTCTTAGGGTCACTTTCCTTCTTAGGGTCATTTTCAGACTTATG
CTTCTGTAAAACCACTAGTGTTATTTGTATTATTGCATGTGCACCAAAAAAGCATGTAGT
TTTGAGTGACTGTTTACTTTTTTTGGCAGAAACTCCCTCGGATTAATCAGCTAGGCATTC
TGAACATGAGGCTGGAGAGATAGTTCAGGCTTAAAGTACTTACTTACCTTTCATTCAGCC
AGCCCTAGTTGGAGTCCTTGGCACTGCGTATGGTCCCTTGACTGCTGCAGGAGGTCACTC
TTTAGCGCAGAGCCAGGAAGAGCCTCTGAATAGTGCTGGGTGCGTGCCCCCCCCAAAAAA
AAAGGCATAAAAATAATCACTTGGAGGAAAAAGACAAGCACAACATGGACCACAAGTAAT
TATAATACTATACACTTTCTGTGGCTAAAACTCTTACAGAAAGCCTCTCAAAATCTTCAG
TCTTTCAAAGCGTATGGCACTTTCTTCAAATATAGCTTTATGAGGGTTCCTAAACGGATA
AGGCAGACAAAAATAGGATTGCTCATCTGAACTGCCCGATTTCTGTCTTCCTGTTTTGGC
CCTGAATACCTCTGCAAACCATTGGTGGTCCTAGGATTAAACTGATACTGCTTTTTTTTG
ATGGTACCAGCAAAGATCTTTATTGGTTGCAATGATCTGCAGTGAGGAGACACGACAGCT
TTAGCTCTTGGGTCCAGGTAGCACCTGAAAAGCAGACTGATAACTGTTTTAAATGTAATG
TTATTGGGGCCAGAGAGTTAGTACAGCAGGTAAGGCATCTTGCCTTCCATGTGACCAAGC
TGGGTTCAAAATCTGGCACCATATATGGCCCCAAAGTCCCTCCAGGAATGATCCAGGTAG
CCAGGATTAAGACCTGGGCACTGTTGGATGGGGCTCATTTCCCTCCGACCTGCACAACAA
AAAGCTGTGTTACCAATTACATAGCTTCGTTTTATTATTTATTTATTTATTTATTTATTT
TGCTTTTTGGGTCACATCTGGTGATGCAAAGGGTTTACTCCTGGCTCTGCACTCAGGAGT
CACTCCTGGCGGTGCTCAGGGGACCGACCATATGGGATGCTGGGAATCGAACCCGGGTCG
GCCGCGTGCAAGGCAAACGCCCTACCCGCTGTGCTATTGCTCCAGCCCCTAGATAGCTTC
ATTTTAATATTTCTTTAGTTATCTTTAGGTTTTTAAACTTTCAGATGTTGCATATTGTGT
AAAGGCTAATGTATGATGACATTTTCACCTTGTAGAACAAATCAGATATTAATTCTCATG
AAAGATAATGAAGAATACATGAAAATCATTTATCTAAAGGAGACTTTTATTTTTGCAGGC
TGGGGCTGGAAAGAGTTTCCTTTGCAAGTGTTCTTTTATTGAAATCTACAACGAGCAAAT
CTATGACCTCCTGGACTCTGCGTCAGCTGGACTGTACTTACGAGAACATATCAAGAAGGG
AGTGTTTGTTGTTGGCGCAGTGGAGCAGGTGGTGACCTCAGCTGCCGAAGCCTATCAGGT
GCTCTAGCTTGAGTTATCTGGTCTTTAGGCAACTAGCATAGCATCTGTGAAAAACATCTT
AATAAAAGCAGTCATTGAGGTACTAAAAATATTCTGTAAAGGCATGATATGCTCTCTCCT
TCCCCAGTTTTAAAGTTTTTCATTACTTATGAATTTACATATGAAAAAATGCCACATACA
TTTAAGTTGCTAATCAAAATATTGAAATGAACTTGCTGGAGTCCATTAGACAGTTATAAG
ACCCAGATATCACCAATATTACACTAATGAATGTACTTTTTTTTTTCTTAAATATGGAAC
GCTTCACGAATTTACGTATCATCCTTGCGCAGGGACCATGCTAATCTCTGTATCGTTCCA
ATTTTAGTATATGTGCTGCCGAAGCGAGCACTGAATGTACTTCTTGCTCATATCCCTGGT
TCCTGAACAGAAGCATGCTTGTTGTCATTACTACTTTTGAATTTTATGTATATTTTTAGC
ATGTTGGTTTTACTTGCTTTGGAATTTTATTTGTATCAATAGATAGTTTTAGCTTTCTAT
AATGAGGTTGTAAAACAGGATAATTTAGGAAAAGTATGTATGTTGTGATCTTTATCACTG
TTGTGACCCTTTTCACTGCTATATAATATTCTGTTAGCTGAACATATGTGAAAATTTTTT
CTCAGTTTATTCTTCCATCAAGAAGTCTCATTAAAAATTTTAGATTGTGACTATCACAAT
AGATTCACATATAAGCCTATGTATTTTTTTATACATACTTAAAAAATCAGTTTCGGGGAC
CAGAAGTTAGGGTACTTGTTTAGCACACAAGTAACTGGTTTTGATCTAAATGCTTCCCAG
CTCCCCATTCCTTTGGTCCTCTGAGCTTGCTGGGAGTGATCCCGGAGTATAGATCCAGGA
GTAAACCTTGATCACTGCCAGCTGTGGCCCCCAAACCAACAACAACAGACAACAGTTTTG
GGATTTTGATTGAAAATGCATCACACTGATAAGCAGTGATTGATCTCTTAATAATATTGA
GTCTATACAGAGAAGTTGTATCTATATCTGTGTTTTTGTTCTGGTGTCACATGTGGCAGT
GCTCAGAGCTTACTCCTGGCTCTCTGCTCAGCGTTTATTCATGATGGGGCTTAGAAGGCC
ATATGGAGTGCAAGGGATTGAACCCAGGTTGGTCACATGCAAGGCAAATACCTTACTCTC
TGCTATTGCTCTAGCCCTGTCTTTGGTCAATGATTATCAACATAAGGTTGTTTCGTTTTG
TTTTGTTTTTGGTAAGTTTTTTTCCAGAAAACTTATTCTTTAATTCTTTTTTTTTTTTTT
TTTTTTTTTGGCTTTTTGGGTCACACCTGGCGATGCACAGGGGTTACTCCTGGCTCTGCA
CTCAGGAATTACCCCGGCTGTGCTCAGGGGACCATATGGGATGCTGGGATTTGAACCCGG
GTCGGCAGCGGGCAAGGCAAACGCCCTACCCGCTGTGCTATCTCTCCAGCCCCTATTCTT
TAATTCTTATTGTTAATTTGCTTGGTTTTACAGAAATGCAGTTGAACCGGAGATCTAGGC
TCAAAAAGGCTGGACTCATGTCTGCCATATGTAGGTCCTAGCTTCAATTACAGGCGCTGA
ATGGTGCCCCCAGAATACCACTGGGCTGACTCTCACGCCCCGGGGTCTGAGATATCTTAC
ATTGCCAGAAGGCCAATAAGAAATTCCATAGTGAGACTGGAGCAATAGTACAGCCGGGAA
GGCGTTAGCCTTGCCCGCCCCCAGACCTGGAATCCGAGTCCCAGCCTCCCATATGGNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTG
AACTTCAAGGGTAGTTTCCCAGGTTTAATTTTTGTCTAATATATTAATCTAGAAAAAGAA
CAAGTTCTGAAGGCTGTATGGTAAACCCGAGCAGACAGTGATAAAACCAGTTTTTAGGTC
CTGTGTTTCTGATTTTACAATTATTCTCCTTTCATAATATGGGGAAGGTCCATAAAAGAA
AGGGGAAAGAAAATGCGTATACAGTATTTATTCTCCCCGGTCTTGGACTACTTACAGATT
TCTTTCTCATACTCTCGGCTGCTGTGTACCACTTGAAAGTCATGGTGGTAAATGTTCCTG
TTTCCTAGGTGCTGTCTGGAGGATGGAGAAACAGGCGCGTGGCCTCGACGTCCATGAATC
GGGAGTCGTCTAGGTCTCACGCCGTCTTCACCATCATAGTGGAGTCCATGGAGAAGAGCA
GTGACGTTGTGAACATCCGGACCTCTCTGCTCAATCTGGTGGATTTAGCAGGGTCCGAGA
GGCAGAAAGATACTCATGCAGAGGGGATGAGGTTGAAGGTAAGAGCGACGTGATGCTCTT
GTGCTCGGTGCATAAGGAATCTCATGAGGTGTCAGTGCCAACCTGAGTGCAGCAAGGGCC
AGAGAGTGCTCAGATCGCCCCCAGGAGGGTCTGCTTTGTGCACTGAGGGGAGGATTTGAG
CCTCCCAAGGGCTCAGGCTCTACAGCTTGCGCTCTTAACTGTGGCTGACTTTGTGGACTT
GTTGCCTCTCTGTACTTCCTCCACACGGACCCACATACTAAAATACGTTACCGACAGCAA
AGGTCCACTCTAACTGTTGGAATAATGAAGTGCCACTGACTTCTAAACTTTTTTTCCCTT
TTTCTTGTTTTTCATATTGGATTGCAATGTGTGGCAAATTGGAAAATGTTAGGAAATAGT
AGAGGGTGTATTTTTGATGAAATGGTCATAATTTTTAAGTCGTATTATTCCTTACTTGCC
TTTTTGTTCAAATTGTTACCAAACTTAAATACCAAAAAGAATAGTGGTGTTGCTGAATTG
TATTCTTTTTCCCCCCAACATTTTAGGAAGCAGGTAACATAAACAGATCACTGAGTTGCC
TGGGTCAGGTGATCACAGCACTTGTTGATGTGGGTAATGGAAAGCAAAGACATATTTGCT
ACAGAGACTCCAAACTTACCTTCTTACTTAGGGTAAGTTGATTTCTTAGATTCCTGGGCT
GTTATTTGGTTGTGCTCGCCATGCCATGATTGATAGTTGACGGTCTCGGCTCTGGAGACA
GAAGATTTTATTTTCTTAAAATAGTTCTTTGCTTTCTCACCTGAAAATCTACCTTACATA
TCATTAAACAGGACTCCCTTGGAGGTAATGCCAAAACAGCCATAATTGCAAATGTTCATC
CAGGATCCAGGTGTTTTGGGGAAACCCTGTCAACGCTTAACTTTGCTCAGAGAGCTAAGC
TAATTAAAAATAAGGTAAAAATAAAGTAACACTTTATTAAGTAAAATATAAAAGTACTTG
AGCTTACTAACCTATCTCACTTTTGTAATTGTCCTAATGCTTTTATTTATTTTTCTAAAA
GCCTAAGTATAAATGAGATTTTAATTCCTTCTTTTCCAGTCTTCTGTATCACTAACGTAA
TTTGATACGTAGTCTTTTTTTTTTTTTTGAAGTTTACATCGTTTATTTAGAAGTGAAAAC
GAGGAAGATTCACCCGAGACATCGGGTATTGCAGAGAATTACCGGGTACTTTAGGGGCAG
GAAGCAGCTTTCCTGCTACCGCAGGCCTGGCTTTGACGGCAGGGGGTGTGGGTGACCAAG
CGACTGGAATCGCAGGGCCGCGCGGATGGACGTCTCGCACGGAGTTGATACGTAGTCTTA
ATGGTTGTTATTTTTATAAGTGAAGTCAAAGTTTATTATTTTGTAATTGGATTGGAGAGA
AGGTAACAGGTTATGGTGAGTTGACAGTGCGGGGGACAGGAATTTTCTAGGAAATAATCT
GATAGTATTGACAAACACTGTCTTTCAAGTTGCCTACACAGTTCCTATGATTCTCCTTTT
TTTCTTTATATAAGAATTTTTCTTGACATTAGTGCTTTCCAGGGTCAGAAAACCTTTGGT
TTGAAGGGCCAGATGGTAAATATTTCAAGCTTCTGATATGGACTTTGCCTCACCCACTCA
GTTCTGCTTTTATAGTAAGAAAGCACCACAGAGAGATAGCTCAGTGAACTTCCTGCGTGC
TTTGTGTGTAGAAGTGTGGGTTTGATCTGAGGTACTCTGTGACTCTCCAGGCACAGATCT
GGAAATACTCTGAGCCCTGCCAACTGTGTCATCCCCACAGCCCTACTGGCTATGAAAGCA
TCAGTGTATTAACAGGCACGGCTCTACAGTGTGGCTTGATTTGTGACAGCAGGCCGAAGA
CTACATTGCCCAGGCTGTCAACTCACCAAGGAGTCCCCACTTGTTTTGGTGGGGTGTAAG
TCCCTCTAATTCTAGATTGAGGAATCATAGTTCCATAAAGTGGCAAATTGATACTCATAA
GTTTTTTCTTTTGGGTCACCCGTGGCAGTGCTAAAGAACTGTTCCCAGCTTGCTGTTCCA
GGATTGCTCACGGCCATGGTGCCTGGGCGCTTACCCTGGCTTACTGCATGCAGAGCAGGT
GCCCCAGCTCTTTGAGATACCTTCTTAGCCTAATTTCCTCTCTTGAAAGAGAAGAAATTT
CAAAGAAGAAATTGGTCATTCATTATCTAAGGGAATCTCTTGATTCCCAGGTCATCGTAT
GGTAAGAATTAAAGAGTGACATATTTCTTCTTGCGTAGACTGAGATCAGTATAGATCTAN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGAG
ATTCAGACCCTGAGAGAACAGGTGAGTACATGCCATTTGCAGGATTTCTTTTGTTTTGGT
TGGTTTTAGTTTGGGGATTTTTTTTTTCTGTGGTGGGGGCGGGGGCGGTAATACACACCT
GGCAATGCTTAGGGGGGTACTCCTGGCTCTGCACTCAGGAATCATCACTCCTGGTAGTGC
TCAGGGGACCATATGGGATGCTGGGAATCGAACCCGGGTCAGCTGCATGCAAGGCAAATG
CCCACCTCTTTGTACTATCGCTCTAGCCCCATATTTCTGAAAATAAGTCAGTGACTTGTA
CTAGGTGTTCCGCTTGTCCTTCTCAGCATGCTGATCTGAGCATTGCCTTTGCATGAAGAA
TCTGCCTCAGTTTCCAGTGAGCCTGAGTGAGGATTGCAAGGGTGCAGACCCAGACACAGG
TGACAGGAAGACACGCAGATTTTTCATCTGAGCACAGTGGCAGTTGCTTTCATGGAGTTG
GCAGCAGTCCACCACCAGGCATGGGGAGCATGCGTGACGTTTTCCAATGGCTTGTTAGGA
GTTGTTCACTTGGAAGCTATTTGTCAGTATGTAAGTGTTAGTCTTTTCTGTTGCAGGTAG
AGCACCACCCCAGAGTTGCAAAATATGCAATGGAAAACCATTCCCTCAGGGAAGAGAATA
GAAGGTTGAGGTTATTAGAGCATGTGAAAAGAGCTGAAGAAATAGATGCCCAAACCATTG
CAATACTGGAGAAAGCTTTTTCTGAAATGTCTGACAAAGAGAAAAACGAAAAAAGTAAGA
AATGATTGTTGTTTGTGTGTCACAGGGGTACAGGTCTGGTTTATATTTATTTAACTTTGC
AAGAACAGTACTTTAGCATTTAGACCTGGCATGCTAATTTGTGGTATACATTATGTTATC
TAAAAGGTATCTAAAATTTTTTCTGAAAAAGAGTTGATTGAGCTAACGGAGCAAGGAAAT
CCTATTCTGTTTCAATGTTGTCGATTCAGTCATTTTAATTCTTGGTACATAAGATTTTTC
TGTTTCACTGTTGATGATAAATGCTTAAATAACCACAGTTTGCGTAGAGGTGAAATAATT
TCAATCACCCAATTAAGGGTTGTAGAGTGTCAGTGAGATCATGATGGGATTCATGGTCCA
TCTGCCACAGTATGTGCCTGTTCCTATCACGATGCATGATCTGGTCCCTGTGTCATGGTT
GCTTAGCCTGTGTGTGTTCTGTTAGCTGTATCTAACTCCTGTCAGTTTACTTCTGTGCTC
CATGAAGTTTTCTTGTTTTTTTTTTTTTTTTTTTTGCTTTTTTTTGGGTCACACCTGGCG
ATGCACAGGGGTTACTCCTGGCTCTGCACTCAGGAATTACTCCTGGCGGTGCTCAGGGGA
CCACATGGGATGCTGGGAATTGAACCTGGGTCAGCCTGGGTCGGCCGCGTGCAAGGCATG
CGCCCTACCCGCTGTGCTATTGCTCCAGCCCCCCATGAAGTTTTCTTAATACTGAATAGA
ACTTTAGTCCTGACTTTTTTTTGGGGGGGGTCACACCAAACAATGCTCAGGGGTTACTCC
TGGCAGTGCTCGGGGGACTGATCAGATGGGATGCTGGGGGTTGAACTTGGGTCAGCCGCG
TGCAAGGCAAACACCCTACCTGCTGTACTATCTTTCCAGCCCCATAGTCCTGACTTTTTG
TTAATGCTCTATTATTTGTTACACAATCAGTCTCCTTTTGCTCTATGGACTGAAATTTCT
GCAGCCTTTCTCAGCTGTTTCCCCCCCGCCTTTTAGGGTGAAATTAGGAAAACCTGAGTT
GTTTTTGGTTTATATTGGAAAGGGAGGGGCATAGGAATCCAGAACCTCATATATTGAACA
TTTTATCACTGAACTGCATTCCAAGAAAAGGTGCTAATATTTTTATCCTATACTCATAAA
GAAGCCTGTTTTTGTCTCTGATTTGGGGTCATTTTTAAAAGTTTGTGTTTTGGGGGCCAT
GTCAGGGGTGCTAGGGTAGTGGGGGGTGATCATGTGGTGCTAGGGATTGAACCTTAGGTT
CCATCATGCTTCAAGGCATGTGCTTCAGCCCTTTGAGCTGCCTTCCCAAATTTCACTTTC
CAGAACTTTCTATCTTTCTGTTATTACTTAATAAGAAAATAGTTCACAGTTTTGGGTTTT
GGAGAGTCAAGATTTTTGATGCGAAGACCAGATTTCTGTACTAAAGTCTTTTCCAGTCTT
TATTTGTAGAATGTTCTATTTTGTTGGCCTCAGTAGTACCTTGACTTAGCTTAATTGCAA
AAGATACTTGCAGTCCTGGGGAAGTGGCTTAGAGGGACAGCATATTGCCTATGTGCATGA
GGTCCTCAGTTTGAGCCTCAGCTTTCCACACTAGAAGAGAAAAGATGCCAAGGGAAATTT
CTAGATCCCGCCATTTTATAAACACACCTTAGTTTTCCCATTAGATTTTTGGTCCTAACC
CTTGGGCATGCAATCTCTAAACAACTTTTATATGTTACTTTCCCAGAGTAAAATTAAGTG
GAACTCTCCTTAACATATTTAAGTTAAGAATCCCCCCAAATTGTTCTCTACCAAGTTCTT
TAAATCTATTGCCTTTGTTAATTCTTCTTTTCTAAGTAATTCACCAATCATTTGGACCAG
CAAGATGGCCCAGTAAGTTGAATGCATGCTTTGCATGCAGGAGGCCTGGGTTTGAGCCAC
AGACCTGCATGGTCTCCCTGAGCATTGCCCGGATTAGCCCCTGAGTACAGAGCTGGAGGG
GCCCCTGAGCATCGCCTGGCTCATCCCAATCCCACCGCTTCAAAACTGTGTCTAAGTTAG
CTGCTAGCACTAATACCCACAAAATGTAATTGTTGTTTTTTCTCCATTCAGCATCATGTG
CATGATGCTTTAGTCGTTGCTCTTTCAGCGTTGCCTTAAATGTGCTCCATTCATCCTGTG
ACTTCTCAGCATCTCAAAATCAACCTCTATTCTCTTGACACACTGTCTGGCTTCTTGTTG
CATTATAAAATACTCTTGGGTTTTAAATTTCACCTTCCAGTGCATTTCTTGTTCTTTCTC
CTTGTGCTCCAAAGTGAAACCTGGCAGACAACGTTAAAAAACATATTCTATTATTTTTTT
GGGGGGCGGGGGGGTTGTGGTTGTTTAGTTTTGATATGGGAGCACACCTGGTGGTGCTCA
GGGCTTATTCCTGGCTCTGTGCTCAGGAATGACCTGGTGGAGTTCAGGAGACCATAGGGG
TATTAGGAATTGAACTCAGACCAGGTGCATGTAAGGCAAGTGCCCAGCCTGCAGTACTGT
CTCTCTGGTCCCAGTGTTAAGGTTTTTAATGTGTAAACATTCTAGCACCACACCCTCCCA
AATAGGTTCTGCTTTCCTCTGCTGTTGTCCCAGATTCCTCCCCGACCTCCTATTTACCCC
CGATTCCCCTCTCCCCCATGGTAAGCTTCCTTCTGAAGGTCAATTTTTCAGTTTCTATTT
TAGTTTTGTCTTTTAAAGATCAGTTTCTTTCCCTCTCAGGTCAGCAGGGATTCTCTCCTA
AACCTCTGAAGGAATCAAGTTCATTAGCGAACACTGAGAAGTTAAAAGCACAGCTTTTGC
AAACTCAGAAAGAGCTGAATAATTCAAATCAAGAATATGAAGAATTCAAAGAACTATCTA
GGTAAACATATTCATGCTTACATATTTCTAATACATTTAACTGTTGATTTTAGTGTTTTA
ATAAAGACAATTGAATGTTTTAATATTAGCAATTTAGTAGTAATTAAATCTAATTGTTTA
TATTCTCATAGCAGGCAACAACAAAATGCTTCTGATTTTTTTCAATAACATTTAATTAAC
TGAATGTGGTTATTTTAAGCAATACACTTATAAAGGTCTCTATTGAATTTCTGAAGTAAA
TTCTTCATATGACCACTTTATCAATACTTAACATGAGTCATGAGTTCTCAAAAATTACCG
GTTAATGTTCCTTTGGAAAAGAAAGATAAACCACATTTGTAGCTAAGATCAATTCTGTCC
TTTGATATAAAGAAGTGACCTTGGGATTATATCCAAAAGTTATTTGGGAATGCGTGCAGG
TCACAAGATCAGGCTTATAGTAGTAGATTGTACACTTTGCACATAAGAGGCCTGGTTTGA
TCTTGGGTATCATAAAATAAGAGCAGTAACTCATTTCCCATCACATTAGTTAGCCCACAT
GAATCGGAACCCAGCATTTACTAGTTAACTGCCTTGAATAGTTCTCAGTCTCTGAGTTGT
ATTTTACCCCACTAGAAAATGAGAATCTTTCAGGAGTATAATCAGAGTTCTCTGATTTTT
ATTTATTTTATTTTATTTGCTTTTTGGGTCACACCCAGCATTGCACAGCAGTTACTCCTG
GCTCATGTACTCAGGAATTATTCCTGGTGATGCTCGGGGGACCATACGGGATGCTGGGAA
TCGAAGCCCAGTTGGCCGAGTGCAAGGCAAATGCCGCTGTGCTATCACTCCAGCCCTGGC
TCTCTGATTTTCAAATAGTCACTGGAAAATAAGTTGTAAAGAACTCCAAGATGTATAACA
TTACTCATTACCTGAAATATTCAACTTTCTTGTCTCTAGGAAACGGCAGCTAGAATTAGA
ATCAGAACTTCAGTCTTTGCAGAAAGCCAACCTCAATCTCGAAAAGCTTTTGGAAGCAAC
GAAAGTCTGTAAGCGGCAGGAAGTTTCTCAGCTTAATAAAATTCATGCTGAAACAATCAA
GGTAAGAACTTGAAGCGGTGTTTCAGCCTTCAGTGCGTACTGTCTCATTTTGTTAGGATT
GGAGAGAAAACATAGACAGTTTCCCAGTACAGATAATCTCCCTTGCAGACCACTGCAGAC
CATTAGCCCCAGGTTGAGCCTGGTCATGAAGTTCTGATGTATACAACCCACAAAGACTGT
GTGGTGTAAGAAAGTGTGTGTGTGGAGGGGAGAGATAAAAATGGAGCTAAAGTGCTTGCC
TTGTTTGTGGCCAACTTGTATTTGGTCCCATCATTACATGCGGTTCCTGAGCACTCAAGG
AGTGATCCTTGAGTACAGAGCCAGGAATAAGCCTTAAAGATAGCCAATTGTAGCCCAGGT
CCCCATAAGTATAGAAGTAATGCATTTCAAGTTGAGCTGTGGGGAAACTCCAGAGTGAGT
GACCAGGGCTGTGGGTGACTGCAGAATGGAGTGTGCTGTGCTCCCCAGGAGACTGGTTCT
AGGGACCATTCCAAGCTGCCTAAGGTCAGAACTTAGCACAGCTGGCCATCTTCTGTAGAC
TGCTGGCTTTGTTCTGGCTCCCTTGAGGGTCCTGTCTTGTGTGGAGCCTGGGGTTGGCAA
CAGTAGATCTCATTTTAGGTTGTATCTTGGTTTTATAGCTTTGTGAAATTCCTTGCTTAG
GGACCCTTCTACCTACCGGCCTACTCTAAGCTGCCTTTTTATGCACTGGCTTCTGGTTGC
ACCAGGAGGCACAGTTGGCAGGAGGCATTAGAGCCAGGGAGGTAGTGCCCACAGCGGGGA
GTGCTGCTACCCTCCTGCTCGGCCAACCTCGGTCTACCCAGAAGTGCTTCAGAGTTAGGA
CTGATAAAGTATGCCTGGAGTGCCCCTAGGTGTGGGCCCTAGAGTCCCACTAGCCCCCCA
AGGCGGTCATGAGAGGTCGTGGGCCCTTGAGGCCCTTTAGATTGTGCAGCACAGGAACTG
GTCCTGCCCATCCAGAATGACCTGGGAGCCGCGGCCCCATGCAGGGGTGATGGATTGCTC
TTTGCTGGGAAAGAAGAGTCAGTCCTGACCTTAATTATTAAGGGGAGAGAGAAAAGGTAA
ACTAGCCAAGGGCGACCGCAGGCTGCTTTAGAGGGTGGAGGGCCCCGTGGAATAAAAGAA
GTCAAAGGAAGGGATGGCACACCAATGGATGCCAGCAGTTCCTCTCCACGTTGTAAAACT
TAGCTTCCGCTGTGGGACCACTGTGCCTTATGGGGGTGGTTTCCACTGCAAGCTATCTAT
TGAGCAGATTTTTTTTTTGAAGTGGTAAGAACATTTCTTATGAGCTTAGGTTTCCATTCT
GCTCAGGTCCCGAAGGTGGTGACATAGTCTGTCAGACTCCTGTAATTGATAGTTTCTGTC
ATCCCGTTGCTCATCGATTGGCTCGAGCAGGCACCAGTAATGTCTCCATTGTGAGACTTG
TTACTGTTTTTGGCATATCGAATACGTCACAGATAGCTTGCCAGGCTTTGCCTTGTGGGC
AGGATACTCTCGGTAGCTTGCCAGGCTCTCCGAGAGGGATGGAGGAATCGAACCCAGATC
AGCCACGTGCAAGGCAAAAAAAAAACCTACCAGCTGTGCTATTGCTCCAGACCGACAGTT
TCTAATTGGTGAAAAATAAGATCTTGTTAGGGGTTTGATTCTCATTATCCTTATTGCTAG
TGAACTATTTTTCGTATGTTATTTGTTCATATATTCTTGTCTACAAAGAATAATTTAATT
TTCTATTTACCTCTATCTTTTGACTTAACCTTTGATTTTTGTTTTGGGGCCACACCTGGT
AATCCTCAGGAGATAACTCCTGGCTCAGCACTCAGGCATCAATCACTCCTGACAGTGCTC
AGGTGACCTTACGGGGAACTGGGTATTGATTCCCAGGTGGGCCAGGTGCCAGGCAAACGC
CTTATCTGTTGTACTTTCTCTAGCCCTGTAATTTATACTGGTTGTTCGTTTTTTTTCTTT
TTTCTTTTTTTTTTTGGGATGGGTGGGCAGGGTTGAGCCACATCTGCCAATGTTCAGTTT
ACTCCTGGTTCTGCACTTAGGAATCACTCCTAGAGGGGCTCAGGAGACCATTCGGGGTGC
TGGGGGTTGAACTCGGGCCAGTTGTGTGCAAGACAAGCGCCCTACCAACTGTACGGTTGT
TTATAGTTTTAAAAGTTACAGATATGACTAATAAATTCTGTCATACTGCTTGTCTTACCC
ATTTGTATTTGATGCTTTTCCTTTATAGAAGTTTTAAGATTTTGAGCAGGCCAAGTTGAT
TGACATTTTTATCTTTGTGATTTTTTTATGTCCATTTGAAGGTCCAGAAATCTCAAGGTA
ATCAGTTTACTTTTCTTTTTGCTACTTTTGTAATTTTGTTGAGGTATTTAATGCATCTAA
TTTATTTTTTAATGAAATCACATGGAAATTTTTATCAAAACAATCCATGTTAAAAAAAAT
AATCCAGGGGCCAGACAGTGTAGCCAGTAGGGTACTTGTGTTGCATGTGGCTGATCCTGG
TTTGATCCCCGACATCCCATTATGGTCCTCTGCGCCTGCCAGTAGTCACCCCTGGGTGTG
ACCCAAAATTAAACAAAAAATTAATATATAAAAATGGATTTGTTAGCACAGTGGGTAGGG
CGTTTGCCTTGCACGCGGCCGACCCGGGTTCGATCCCCGGCATCCCATATGGTCCCCCAA
GCACTGCCAGGAGTAATTCCTGAGTGCAAAGCCAGGAGTAACCCCTGAGCATCGCTGGGT
GTGACCCAAAAAGCAAAAAAAAAAAAATGGAATTGTTACATATAATGTAAAACTGTATGT
GTGTGTGTGGTGGGGGAGGAGTCCAGAGGTCAGAGCCTCTCGCATGCAAGGCAGGTGCTC
TACCACTGAGCCTTAACACTACCCTAGAATTTTCTTTATCATCTTTTCTGTTCACAAAAT
GGCATGATGCTATTTTGTTTTCTTGTGTATTAATGTTTTCTCTGCTCTTTTGTTATTGCA
GACTATAACAACACCTACAAAGGCTTACTCGCTTCGGTCTCACCTGCCCCTTGAGTTAAG
CCCTGGCTCCGTACACCCTGGTGATTCCAGCAGAGGAGAGAATGACATCATGAATGAACC
TGTCCCGCCCGAGATGAACGAACAAGCTGTGGAGGCACTTTCCGAAGAACTGAGAGTGGT
GCAGGTAGTGTTTCTTTAAGGAAAATCTTTGCGTGTTCATTTACAATTTTTTTGTTTGAT
CATCTTGGTCATGATTTGCTATTTTCAAGATTGTTTGGTATTAAAATTATATGTGTATGT
AAAGGTTCCCTGACTTGGATTAGCTTTCTTGGATTGGCCATTGCAGTCTTTCAGCAGTCA
CCTTTATCTTAGAGGGCTTTGGCTTTCTTGAATTTCAGATGACCGGTTTGCTGCCAGCTT
CATGTGCGAGAAGAATTGGTTTATCTGGCACAGTGTTGTGCTGCTAAGGAAAGTCAGGTC
AGGGTGGGGAGAAGAGGCTGAAGTGCTGGAATGTGAGGCTAGTGCTAGTTTGATTCCCGG
CATCATGCCCTGGGCACCTGCAGGGCTCACCCTGGTGGCTCCTGGGCACAGCTAGGCCTG
TATAGTGCGGAAAGGCACAACAAATGGGGAATAAAATTAAAAGAAGTGAAAGAATTGAAT
TACCTGATTGAAATTAGACAGGTCTTGTTATTATGCCAGTAATATTAAAATTGTTTATTT
TGGGGCAAGTGTTCCTTCCTTGCACAAACTTGATCCCCAACATCCCGTATAATCCCCTGA
GTTTATTTGGAGTGATCCCTGAGCACCGCCAGAGTAAGCCCTGAGCACCACTGGGTATGG
TATCCCTCTCCCATTTTTTTTAAATTTATCTTGATTTTAGTGAGTTAATAAATAATTTAC
CTCACTACTGTACATAAAATTTGACTATACAAAATCCTTTAAACTCTCCTTTTCCAGAGA
ATAGGAACCTTTCTGGGAAGTAAGTCCATGGAATTTGTAGAGCTTCTGAGCAGTTTCAGG
ATGGTTGTTGAATGTACCAGGAGTTAAAGTTTGACACTTTCTTTCCTTAAAATTTTCTAC
TTTGCTAGTCTACAAGTATAATATTAAAGCTGAGAAGTCGTAAAATAGTCTTTGACATTG
GCTTCTGGTCTCACTCTCACCTGTGATACCTTTATTCATAGATTTTTTAATTTTCTTTTT
ATGTGCAGATGAAATAGGGTTTTGTAAAGAGTTCTAAAATAATTTTGACATGTTTTTGTG
TTCCAGGAAAAAATGAGTACCCTTCAAGTCAAGTTGGATGAAGAAGAGCATAAAAACCTA
AAGCTTCAGCAGCACATTGACAAACTGGAACATCATTCTTCACAAATGCAAGAGGTGAGT
GAGCTCATGGACTCAGAAAAAGCAAGAACGTTTCCCTACCGTGAGAGAATCACAGGAAGA
AATGATGTCCCAAAGCCTTCGTCAAGACTACTTCTGTTTCCTTCTTTCTTTGGGGATTGC
TCTTATGATAATGAGAGACAGACAGACCTACCTCATCTGAGTACTGGCCCACTTAAAATT
CACTGGCTCTGTTGCTGTTTGTTGAGAAGTGAGACTCTGGCCTGGTGCCTGCAGCGGCCC
CTCTCCTTTCTTTAGCATGGTCTGGGGTCATTCAGTTTTCCTCTACTTGGCAAGATTTTG
TTTTTAAATTAATTTTTCTGTTTTGGGGAGCAAGATAGTTTTTATTGGAACTTATTTAGG
AAGGTGTGATTGGAGAGAAAAGCAGAAATATTTCTGTTCTCAAGAGAAAATACGGGTTTC
TCCACAGTAGAAGGAAACAAGCAAAAGTACATAGAGACAAGCAAGTGAGATGCGTGTGTA
AGAGATAACAAGGGTTGAGGAGTGAGCCACTACATTTTACTGTTTAAATTGCAAACAGAA
ACAAGTAATTAAGTGTGTTTCTCAGCATGCCAGCCTTCTTTTTCCAGTAAAAATGTTTCC
TTCCCAAAGCTTTTCTCATCAGAAAGAACTGAGTGGACCAGGCAGCAGCAAGAACATCTC
TCAAAATTGAATCTTCTTGAGAAGCAGCTTCAGGACACTCAAATCAAGAATGACTGTAAG
TTGGAACAACTGAAACCCCGAAACCCTTGTCATCTTAGTGAGTTTGTCACCCGTTGTCTT
ATCCACATAGAATTCACGGTGCGCCATAGGTTTTGATTGGGTATTTTTAAAATTTCATTA
TTAGAGGTTCATCCTTTTAAGTTTGCTATCAGTGGCAATGGTGATATAAAGGAAGATTTT
TTTCTCTTGGACTGGTCATAAACACAGACGCAAGTATGTTGAATGTGCTAATGCTACTTT
GATAATGAAGTGTATGTGTTCATAGATGAGAGAGTATCATTTCTAATACTTCTCTTCTCC
TTGAAAGTAGCACTGTAGCACTGTAGCACTGTCGTCCTGTTGTTCATCGATTTGCTCGAG
CGGGCACCAGTAACATCTCCATTGTGAGACTTGTTACTGTTTTTGGTATATTGAATATGC
CACGGGTAGCTTGCCAGGCTCTGCTGTGCGGGCAGGATACTCCTTGAAAGTTTGTGCAGT
AATTTGTAAAGTGATAACAAAGCAAACTAAACAGAACAACCCAGCTGTTCCCTGGTTTTA
ATTTAAAAAGTTGCTGGGAACCAAAGCGTTGAGCCTAGTTCAGGGCTGCTTCCCTGTTCT
GGTAATAAGACTTTGGGACATTAAGACAAGGTCTGGGAGAGATGATTGGATAGAAGGTAT
GTCTCTATTCATTTCCCTCCCAACCTACAAAAATGAAAAAAGATGTTACTGGGGAAGAGA
GACAGTAGAATGGGAGAGGCACTTGCCCTGCATGTGTCTGAGCTCCGGATTCGATCCGTG
GCACAGCATATGGTCCCTTTGGTACTGCCAAGAGTGATCACTGAGCATCGCCAGGTGTGG
CTTCAAAAAATGAAACCAAAGAGAAAAGTTACTAATTTCTTATTCTAATTGGTGTTTGCA
CAGTTTCCACAGTGTCTAACTTGTAGGAGAGGCTGGGGAAGGTGCGTAAAGGACTGGGCT
CATGTCTCTCTGCAGGGCGTGTTGGCTCCCTCTCTGGCACTGCCTTTTCCTCCAAGAGCA
CCACAAGGAGCAAGCCCACTTCCTATCCCCAAACAGACAAAGTTGTAATGATATCATATT
CCTAAGGGATCATATCACAATTCTAAGGGATTTTTCAACATGAAATGTTAGGTCATTAAA
AACAAACACTTTATTTTTGTGTTGTTTTGGGCCCACATCTTGGCAGTGCTCAAGGCTTAC
TCCTGGCTCTGGGGTCAGGGGTCACTTATGGTGGGGGCTCAGGGGATCAAACATGGGTGG
CTGTGTGCGAGTGAAGTGCCCCACGTCCTGTACTCTCCGCAGCCCTTCTTTTCCCTCTTA
TATTGAGATTTTGATGCATTGTGATGAAGTATAGAAAAGCCCAGTAAGCTACAGTTCAGA
AACATACAACATTTATTTGGTAGACATAAGCCAGAAACCCATGAGCAAGAGTTTCCGGTA
TGTGTTCCTCAATACCTGTTAGTCGTTTAACTTAAAATTATCTCATTAACTTTTTCTACC
AATTATGTCAAAAAGACTTGTCAAAATGATTAACTCACTTTGTAGAATAATCTATTAAGA
CTTTATTTTTTATTTTTATTTTTATAGTTTTGGAAAGTGAGGTGCATGATCTGCGAGTTG
TTCTTCATTCTGCAGACAAGGAGCTGTCTTCAACGAAACTGGAATACAGTGCATTCCGAG
ACAGTCAGGAGAAGGAGCTCAACAGCCTCTCTGAGAGACACATGCAGGCTCAGCTTCAAC
TAGATAATGTCAGGTAGAGCTGTTTTATGACGGTCTCAAGTTGACTGATTCGTTTTCAAT
CCAGAACTTCTTGAAGTACAAGCGTTAGAAACCCAATTGAGACAAGTTAAATTAACAGAA
GGAAAGTTTATTGGCTCCCAACACCAGAAGCATCAAGGGCTAATTTTGGTTCCAAGGACA
GACTGGATTGAGTCTCAGTGTTGTCAAGTGCACATCCTCTCCCTCTTCTTTCCCCTGCCC
CCACCACTTTCTGCTCTATAGTTTTAGTTGGTATTATAAGATTATGTGTTATGCTGTGCT
GTCTAAGTCTGTCAGTCTAACTTTAGCCACTGATTGATATCACCTGGAAATTTTCCCCTT
CTACTCTTGCTTCGAGATAGATCCGTGTCTTACAACCTTCTTACACATGCTGTCACATCT
CTTTTGGAGCCTCAGAGGCCAAGTGATTGAAGAAGAGTTCTTGGCTGAGCTCTGGTCGTT
TGGGCATGGCCTTGTACGTCAGTGAAGGGACCAAGAGGATAAAAATGTAGAAAGTAGTAA
AGAATACTTATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGATTTTC
TCTCCTGTGAGATCAATCTACACGTGTAATTTAATAAAATAAAACGCTCTCTCAGGAAGG
AAGAGCATGTGCTGAATGCTTAGATGAGCTGTCACCAGTACTAACTAACTGGGGCCCGAG
AGAAGAGCTCAACGAACTGGGCTCCTGCTCTGCATACAGGAGGCCTGAGTTTGAGCCCTC
AAACCACCTGGTTCCCTGAGCACTGCTGGAAGTAGTTCCTGAGCACAGAACTGGGAGTTG
CCCCCAAGCATTGCTGAGTGTGACCCCTAAACCACAAGACCAACAAAATAGTATGTAATT
GCCAGTCCCTAACATGACAGTCTAGAACCCTCCCAGTGGGTCTCAGTGCTAATCTACTGC
AGAGGATTAAGTACGTGATGGGCGAGAGAATGAGGAAGCTTATGGCACCAGACTGCTATG
CCCACCCTGTCTTCCCACTGTCTTGTGGTCTAGGGCTGCCATGTTGAGCACCATGGACAG
TTCCCAGTACCACTAGGAATTTAGTACTTCTCTCGGTTGGAAGTAGTCTACTGATGGGAA
CTACATTCAGATAAATTGAATAGTAGAACTACACTTAATGTTTGTAATTACCCTTGTAAA
AATGTTTTCCTGATAAAGATTGGAAAATGAAAAGCTTCTTGAGAGCAAAGCCTGCCTGCA
GGATTCCTATGAGAACTTACAAGAAGTAATGAAGTTTGAAATTGACCAACTGTCAAAAAA
CCTCCAAAACTGCAAAAAGGAAAATGAAAATCTAAAATCTGATCTGAATGTAAGTTAAGA
AGGTTGCGGGGATTGGAATATAAATCAGTGCAGAATGGTTTCTTTGCAAGTGTGACACCC
TGGGCTTGATTGCTGCCACCTCAGAAGATTGCTTATCAGTGGATTTGTCCCAGAAGTGTG
ACTGGCACTGGGAAGCAGGGCCAGTGGTGTCACTTTCTGTGTCAGTCACATAGAGTGTGT
TTGTTTCTTGGCTATGTTGCTGTTAATAATCACTTGAAATTTAATGTGTTTTTTAGAATT
TGATGGAACTTTTTGAGGCAGAAAAAGAACGCAATAACAAATTATTATTGCAATTTGAAG
AAGATAAAGAAAACAATTCTAAGTGAGTACTAGTTATATTTTCTATTAACTGATTAATAT
CATTACTAGCTTATTGTGTTTTTTTTCCCTATTTCCTAAAGTTTTCTAATGCAGCCCAAA
TTGAGTATTAGATTATTTTGTGTAAATAGTTATGTAGTTTGGCTAAAACTGTGTGGGAGA
GCATTTGCCTTACACACGGCCGACCCAGGTTTGATTCCTCTGTCCCTCGAGGAGAGCCTG
GCAAGCTACCCGTGGCATATTCAATATGCCAAAAACAGTAACAAGTCTCGCAATGGAGAC
GTTACTGGTGCCCGTTCGAGCAAATCGATTAGCAATGGGATGACAGTGCTACAGTGCCAT
TATGTAGTGAATTAAATTTTTTTCCTATGGATTTTTTTCCCCCCTGTGGAATTTTTAAAA
TGAGTAACAATTATTGGTGCTCAACTTAAGGCTACCTATAAACAAATCACAGTATGTCTA
CTAAGATGCTTTATAATGATTTGTTGAAAGTATGGACTGATTTGTAGCTCTGTTGTTGAT
CTCTACTTATTTTCCCTTTGTCCCTTAATAGAAATGCCATTGTCCTTATTCCCTCTCTCT
CCACATTTCTTTCCTTGGCCACCCCGTCCTCTTTTGGCTTTGACCAACAGGATGATTATT
CAGAATCTGTTTATTCAGTGAACACATACAGAGTTTTTACTATGAGAGCACGTTTCCTCT
CAGTCTTAGCAGTTATTACTACATGATCTAGTGAATGCACAAATCTCATTGGGAAGTGGA
TAGTGGACATTTAATCATCTATTCAAACATTTTGTGATAATCTACAAACCAGGCACTGTT
TTGTAAATTATGCCATAACATTTGGAGGAAAGAGTGAACAAGAATCCCCCGTTTTGTCCT
AGCATAAAGCTAGGTAATACACAAATTCTGTATGGCATTTGGCATGTGTTATGTTAGGGA
GTCCTAAGTTCTCTGAAGAGAAACTTGTGCCACAAAATACTTTCTTAAAAAATTGTGAAG
CAAGCAGGTTCAAATTTTCTGACAAGAACATAATACCTCACTTGCCAAATAAAGCTCAGT
TGCATAGCCTTGAATCCGAAAATTCTTCTCTTCCAGAGAGATCTTAGAAGTTCTTGAGAT
CGTCCGTCAGGAGAAACAGAAAGAGATGACCAAGTGTGAGCAGCAGGTACTGAATGCTCT
CTCTAAAACTGGGAGAGTCTCACAAGGTTTAGTTTAAAATTTTTTCCAGTGTTTGTAGGC
TTAAAATTGGTAATACAAAGGTGAACTTCTAATTGGGTATATTGTGTATCAGCTTCTGCT
GTTCTAACGCTCAGATGTGTATAACCATAATTTATTGCTGGTCTCCTGTTAGGACCTCAA
AGTCTGTCTTTTAACCCAGCCTGTCATTTATAAAGTATAGAAGTATACTTCTAGTGGATA
CTGTATAATTTGAAGATCAGATAGCAGTTGCTTCTTTAAAAATATGCATATGTGTTGTTT
AATTTTGTAATTTAATTATTTTTTGAACATATTTTTCACAGACGGCTAAAGTACAGAAAC
TAGAAGAGAGTTTGCGAGCCTCAGAAAATGTAATCAGTTCTCTGGAGAAGTCTAGAGACG
CTGACAAGGTAAGTGGAGGTGAAAGCTGCCTTTTCTCTCTAAATGCAGCTTCAGTGTTCC
AGTCCCTGTTTCGGGGCAGTGGGTGGTTACCATTTCCATAGTGCGCTCAGCTGTTCATCT
TCCGTGGATGCTTGAGAATGCCTCTTTATTTTATCCCACCACACATTGGTCTATCATTGT
TTCCAGGACACACCCTGCCCTAATGGTTAGTGTGACCCTTTCTTACTGCCTGAGTCCCAT
GGTTCAAATTCTCAAGTCCCAGGGGTTGACTTTACTTAGAATACTGAAAATAATCTTTAT
GTGCAAGAATAAAATTAGGTATAAATTCCTCATGTCTAGTATTAGTAATAAGTTAAGCAA
ATGACTACACGTACAGAATTATTAAAATATAAGTTGAGGAACAGGAGAGCTATTAATTGG
GGAACCTTGCAAGAGGCTGACCTGGGTTTGATTCCATGGCACCCCACACTGTCCTCCAAG
CCCCACCAGTAGTGATCTCTGAGCACGGAATCAAGAGTAATCTCTGAGCACTGCTTTGTG
GTGCCTCTCTGCACTCCCTACACCTAACAGTGATCCTTTTGGAAGCTAGAGAGCTAGCTC
AAGAGGCTCGAGCACGTCTTTTGTATGTAGGAGGCCCAGTTTTAACCCCCAGCACTACGG
TTCCTTGAACACAGACAGGAGTGGTTCACAGGCTCAAAAAACACTTCAGCAAAAAGGTTT
CCTCCCTGGGGCTGCAGCAATAGCACAGCGGGTAGGGCGTTTGCCTTGCACGCGGCCAAC
CCGAGTTCGATTCCCAGCATCCCATATGGTCCCCCAAGCACCGCCAGGAGTAAATCCTGA
GTGCAGAGCCAGGATTCACCCCTAAGCATCGCTGGGTATGACCCAAAAAGCAAAAAAAAA
AAAAAAGTTTCCTCCCATTCGCTTTCCATTTATTCCTCTTTTAGTTGTTACTCAGTGCCC
AGGAGTCCCACATTTGGTTCCATTGCTCACATTCAGCTGCTTGGGATACAACAGAGAGGT
CTCTTCACATGTTTTTGTGTGGGGCAGTGATCAAACGCCATGTTTTTTGTGTGGGGCCGT
GCCAGGGGTCTAACTTGCCCCCCACATGCCAGGCAGACACTTTATCCCTCAGCCGTAACC
CCAAGCTCTAGCCTAAAAGTCACTGGGAGTAATCGCTTTCTTTACTCATCAGGAGTATTT
AGCTGACCTCATGAGCCAGATTCAGGAGCTGCGAGCATCCGCCTGTGAGAAAGCGGAAAC
GACAGAGGCCACGAAACAAGAACTGAAGGACATTAATGTAAGTACTGCTTCCGACAAGAT
GAAACATTGGAGGGTGAAGTACATGTCACAGGCTCTGTCAGAAAAAAGAGTCTGTGTTTA
AAAGGTTTGGAAATACTAGTGCAAGTGCACCAGATTTCTGCATCTATGGGATTTTTTAGT
CTTGCCTTGCCCGCCTTCTGGGTGCATCTCCAGAGGAAGCACTAGCTGCTGTGTTTCCAG
ATTTTACTCACTTGGGCCCAGTACTGGCTCCATCATGTGGGAGTGGTTGGTCCAAACTGA
AGCCAAAACAGCAATTGCACCTGTGACAGCTAAGTTTATCTGGTGTTTCCTTCAATATTA
AAAAAAAATTATTTAGGTTCCTTTAGAAATGACAATACAGGGGCTGAAGCAATAGCACAG
TGGATAGGGCATTTGCCTTGCACTCGGCCGACCCGGGTTAGAATCCCAGCATCCCATATG
GTCCCCCGAGCACCGCCAGGTGTGATTCCTGAGTGCATGAGCCAGGAGTAACCCCTGTGC
ATCGCCGGGTGTGACCCAAAAATCAAAAAAAAAAAAATGATAATACAGAATTTTTCTTTC
ATTGGACATTTTAGTTTCCTAAAGTACTTGTTTCTCTTGCGTATATCTAAACGATAATGC
TTCTACCTTCCCTTGGGTCACAATGAAGGTTTCTGTCACTGCCCTTCATTCCTCAGCCTT
GGAACTCGTGGCACCCCATAGGTATTCTGACGGGGGCTTTGTCACTGGTACCTGTGTGAG
TTGCACACTCCCTCCCCCCTTCAGACTCACCATCATTTCAGTCTGTGAACAGTCATCAAG
CCAAAACAGCTTTTGTTTCATGACTTGTTCTCTGCAGTGCAAATACAACTTGGCTTTGGC
GGACAAAGAAGAGAGCAAAGAGTTGGTTAAGAAACAGGAAACAGAGATCCTGGAACTGAA
AGAAACCCTAAGACTGAGAATATTCTCTGAGGATATAGAGGTAGATGTTAACATATCATG
ACTCTTGTTTCACTTTGTAAATTATCACTGTGTCTAAGTATATATGGAAGTTATTACTAA
AGAAATCAGAGCCCTTTTCCTGAGAGTAATTGGAAAATGATAAAAAGAAAATTTGAGCGT
TTATGGATTTCATATATTTTTATTCTGTTCCCGCAGCATGCTAAGTTCCTTTGAAGGATT
CTCTTTCTAAAAGGAGCTCAGTAGAAAGTGCATTGACTCAGATGCAGTCTTGGCAGTGTG
GAATGGCTGGTTATCAAATATCTCAAGCTTGCTTCTTGTATGTAGGGGTTTTTTTTGTCT
TGTTTTGTTTGAGCAACATGCCCTCATGAATTTGGGCTTTGCAGAATAGGCCCTCCCAGA
GATTAGTAGGTTTTAAAGGTTTTTTTAATGGTTATAAATTTATCATTTTAAAATTTTAAA
AATTAATCAGTACTGTTAAATGATGGAGGGAGCGTAAAGCTATATATAATATATATATTT
ATATATTATGTATTCCCTTTTGTGAATTCTCTCTAGGTATTTTCAACAGACTAAATACTT
TTATGTTGCTTTCTTTTTTTTTTTAATTTTTAAATTTTTATTTTCATAAGATTGTTCACA
GGCTGGAGCGATAGCACAGCGGGTAGGGCATTTGGGTTCGACCTGGGTTCTATTCCTCCG
CTCCTCTCAGAGAGCCCGGCAAGCTACTGAGAGTATCTCGCCCACACGGCAGAGCCTGGC
AAGCTACCCGTGGTGTATTCGATATGCCAAAAAAAAAAAAAAAAACAGTAACAAGAAGTC
TCACAATGGAGACGTTACTGGTTCCCGCTCGAGCAAATCGATGAGCAATGGGATGACAGT
GATACAGTAATGTTGCTCACCATTAATTGATTACATTCAATATTCCAGCACCAATCCCAC
TACCATTACACCTTCCCATCACCATTATTTTGAATTGTTTCACCACCATTCAATCCTGCC
TACCACAGGCAGATGCTAGATAATTTATTTTCTATTGCTTATTAGGAATATCATGAGAGG
TCATGCAGCCACTTTCGTGGCCATGCGCTCCTGGAAAATTCTAAAATTGTAAATGATTTG
GATCTGGAGACATCTTTGTAGGGAGCTGATGCATTTTGTGATTTATCTGTGAATCTCTGG
ATCAAGGCCAGTGACGTTCTTAAGTCATGCCCTAAGGCAGTTCATGGGCATGACAGCCAA
GACCCCAAGGGGACGGGGAGACGGGAAATGTTGGTCCATCCCTGCCTCCGGCAGCCTTTT
TTCTTAGTGGTGACCCAATAGATTTCCTAATGGCAAATCTTTATTGAATTCAAATACTCT
AAGACCTATACTTAGATTGGCATTTGGGAGTGAGAGAAAAATTGAAAATCTTTGCCTCAA
ATCACACCATGCAATTTAAGAAATAACTATTATGGTGATGTGAGAATACGAAAGTGTAGG
AGGGAGATGATTGTCAGACCTGGGGGATTCCAAGCGCTTCTCTGAGGAGAGTACTTGAAC
AGAACTTGGCAGCTCGGGGTGTTCGTGGAGTATGCGGCCAGGGGCACAGTCGGGAGTGGC
CAGTCTGGTGCCACTGTTGAGGTGGAGACACTGGTTTCTGTGTGTTGGGAAGGTTCTCGA
GGATCAGCTGTCTCTTAGAAACCACACAGTGGTACAGTGTTACTGTCCTCCTCATAGTCT
GGTCGAGGCAGGAGAGAAGATGAGCCTCAGGTTCTTCTTGTGGATGACAGAGCCGAGCAA
TGTGGCAGGCCCACATTTGACAGAGGTGATCTTTCATGTGCGGTCGAGTCAAAACTACCT
ATGAGCCCAGTCAGGTATCACCCCCTAAAAAATTTTACTGCAATAAGAGCAATATTTAAA
GATCATACCAGTGATAACTATTTCAACGAGCAGATACACAGAGAAGATCAAAGTACTTAA
ACCTCTACTGAAGTTTACATTCATTCTTTGGGGAGGTTCTTTGGAAACACAGCCTTCAGT
CTTCCATTTAGGCTTCCCCTTTTAGAAATTTAGCCTGAAGAAATAATTTAGACTGGGAAG
GCCGAGGGGAATAGCACAGGGCCGCAGATCCCTGCTGGACAAGACCAAGTGCCCAGCGGC
CTCCCATGCTGAGCAGCTCCAACGCCTGCTGTCCTGGGTAGGAACAGCAGCCCGAAGTGT
GAGTGCCACACAGGGTGCCACAACGGAAGAGCCAGTGGGCGCCATGACCAGCACCTGTGA
GCACTTTGTGAGCACATGTGGACACCACAGCCTCTGCTCATTGTGATAGTGACAGCAGCA
ACAGTGGGCGGGGGCGGAGTTAGGAAAGAATAGAGCTGAGAATTAAGTGCCCGTGGTAGG
AAATTCCTCATCAGCCAACGTGCCAGGACATTTAATGATGGCTCAAGTTCCGGGACAGCT
GTGCTGTGAAGTCGAGTTGCTGCTGAAGTAAAGATGAGGCTGATGTGCTAAGCCTGAGTG
TGCAGTGCTGCACTGGGCTGTGTCAAGTGATGGGTATTTAGACACTTGAGTGTATGTTTG
CAGATGTGTGTGCACCTTTTAAATAGTTAAAGCAAATAGGTTGTGCTCTGATTTGGTAGA
TTATATATGCTGCAGACATAACGGGAATTGTGTGTACAGCCTACCAGAATTGAGTCCTTT
GCAATTTTCCATTGGTTAGTCCCCCTGAAATTTGAATGCCTGATGACAGTTTATCATAGT
CTGGTAGTTCACAGCTGACTGAGGCACTCATCAAAGGTAGAGACCTATGCATTGATTTCC
TGAAGGAAAGACATATAAGCTTTTAGATTCTGGGAAAGGGGAGGGGAGTATGCAGTTAAA
CAGAATGGGCTACATAGACTATTTACTGTAATATTAATCTCTAAAAGTTTTACCTAAAAA
TTAACTTTTCAGGTGGCTAGAGAGATAGTACATCAGCTAAGGCACTTGGCTTGCACGCAG
CTGACCTGGGTTCTATCCCCAGCATCCCATATGGTCCCCTGAGCCTGCCAAGTGTGGCCC
CAAAACAAAATAATATTCAGGGGGCTGGAACTATACTACAGGGGTTAAAAAGTGCTTGCT
TTGCACAAAGCTGAACTTGATTGGATCCTGGCTGGCACTGTGTATGGTCCCCTGAGCCCC
ACCAGGAATGATTCTTGAGTACCTCCAGGTTTGCTCCCCACTAAAAAAGTAAATTAGCTT
TTGAAAATCATACCTAATATTTTTTGTGAATCTTTATTAGAGGACCCTAGTTAAATTGTT
TTGTGGATCTTGTCACCTTCAGAGGGATATGCTTTGTGAGGACCTGGCTCATGCCACTGA
ACAACTGAACCTGCTCACCGAGGCCTCCAAAAAGCACTCGGGGCTAATGCAGGCGGCTCA
GGAGGAGCTGAGCAAGAAAGAAACTCTGATTCAGGAACTGCAGCAGGAGGTGAGGTGCAC
GGATGCGTGGTCAGGACTGGAGTCGGGAGGGGCAGGAGAAACTAGATATGTATAATTGTT
AAGCATGTACTTTTTACCTCTGTCCTAAGATAGATGACATGAAAGGCAACTTCAGTTTTT
ATAACTTACTACTTTAAAAATTGACACAGCGGGGCTGGAGCAATAGCACAGCGGGGAGGG
CGTTTGCCTTGCATGCAGTCAACCCAGATTCGATTCCCATCATTCCATATGGTCCCCCGT
GCACCACCAGGAGATTCCTGAGAGCATGAGCCAGGAGTAACCCCTGTGCATTGCCGGGTG
TGACCTAAAAAGAAAAAAAAAAATTGACACGGTGCCCAGAGAGATAGTGCAGCGGGTAAG
GCGCTTGCCTTGCACATGCCTGGCCCAGCTTTGATCCCCAATACCCCATATGGACACAGA
GCCAGGAGTAAGCCCTGAATATCTCTGGTGTGGCCCCAGAAACCAAAATAAACAAACTTA
AATTTGCCATGGTTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTGCTTCCGTGTCTCGGTT
CAATTTTCCCCCCTCCACCAAAAAGACAAGGAAGTAGAACAGAAAAAGAATGAATATAAC
TCCAAAATGAGGCAACTAGAATATGTAATGGATTCTGCTGAGTATCCCCAGGTATTTTCC
ACTCTTTTAGGTAAAGCACATTTCAGAGAAATGGTTTTGTGAGTGACAAACATTTGAAAA
TTACTGAAGTCTACTGAAAAATTCTTTTCACGAATATCTTTTCTGCTTTTCACTTGATAA
AAGATGTATCTACCATCCTCTGTTTGACTTGGTCAAGAATTAGAATAATAAGCTAAGTAC
CCTGAGTAATTTCTATGTGCTTAGCATAACTATTAAAAGTGAAATGTTTATGACATGACT
TAATGGATATTTGGAGAAAATTTGATTTTTATTTTAGAGCCCTAAAACACCACCTCATTT
TCAAGCACATTTGGCAAAACTGCTTGAAACACAAGAACAAGAGATAGAAGATGGAAGAGC
TTCTATGATTTCATTGCAACACCTCGTAACAAAGCTAAATGAAGAGAGAGAAGTGAAAAA
TGCTGAAATCCTCAGAATAAAGGTAATTTTTCCATAAATAAAATGGGGCAGGCAGTGGGT
GGGGCTTCCAGCAGTGGTGGGGGCCACGCCAGATGAGTGTGGGCCTGGCGGTGCAGCTGG
ACAGTTGGGCCGTCCCAGCAATGCAGTGCTGAGGCCCGCCAAGGCCAGGCCTGGCAGATG
TTGGAGCCATGCAGAACTGGGTCTCAAACCTGGGACCTGCGCCTGCGAAGTTTCTTGCCT
CCCTGGGAGCCACCTCCCTGGCCCTAGACTGAAATTTCTGAATAAGCAGTATTTTCATGT
TTATTGAGAATACAGAATTGAAAAAGCACAAAATCCCATAGGTAAGGTGGGAAAAGCCTT
CCTCTTGCTGCTGGTTTCAGTTCCCTCATTTGCTGACCCGGAGTCCATGTCTGACATGAT
CTCCAGAGCATTTCGGTGCATGTGGATCCAAGTCTATAAGCGTTTGCTCCCTGTACCATT
TGTTTTTCACACACAGGAGTCAGGTCATGCAGGCAGGACCAGTTTCCACTTCATCAGCAG
AGGGCTGAGCCCACCTCCTTGGCCTCACCTCACAGTGCTGCCCAGCAGTTCTAAAGCATG
TTAGGCCATTGTACTTTTTAGTTTGTATTTCTCATGTTAGGCGTGGAAATCTTGGTTTTC
TAAAAAAAATTTCTATGAATTCTTCACCCATTTTTCTATTTACTAAATGGATGACCTTTT
TTTAAAAAGAAAAAAATTGATTAGTAGGCACTCTATATGTAAAAGACTTGATTTTATCTG
TTAGTGAAAAATACTTCTCCAATGGCTAGAGAGACAGTATTGGGCGTCAGGCTCTTGCCT
TACCTTGATTCGATCCCTGGCACTGCATCTGATCTCCTGAGCAGTGCAGACTGGCAGCCT
GGTTGGGTGGAATGATCCTCCTTAACCTGTTTCCCACATGTGTGCATGCGCGCGCGCGCG
CACACACACACACACACACACACAACAAACCTTTCTCAAACCAAGGTCTTTGGGATGGGT
GTAGTGGGAAGTTTTTGGATTAACCCATAGTGGCGGGAGGTGGGTGAAGTTGTCCCTGAG
GAGTTCGGGGGGCAGGGGGCATGGCAGGGAGGATGTGGTGTCTCACAGAGGAGTGCAGTG
AGCTTGTGTGGTCATTGTTGTGCAGTTTCTGTTCCAGAACATAATTATTCATCAAAGCAC
AGTGACACCAGGTATTGGGCCGCAGTGGGAAAGCCATGTGTGCCAGGGATTGAATTGGGG
TTGGGTACCCTAATCCCCTTACCTTCCCGCCCCTGCTCTTGGCCTTTCAATTTAAGGCAG
CTCCCAGTGTGCTGCTACCTTTGGAATGTGGCTGTTATCCAAACCAGCATAACTTAGGAG
AAGTTGGGTCAGGTTAAAATAAATTAATAGTAGACAAGAAGATTGTTGTGGGGGCTGGGG
GGAGCAGGGAGGACACTCATTGTGGACAAACATTTTTTTTCTAGACGAATTTACCCTTGG
TTTTCAAGTTCAGTTAAGTATTCTGAAGAATGAGCTGTAGTATATTGTTTTGTTTTTAGT
TTTTTAATGAAAATATACTAAGAATCAAATTACCAAAGTGAGACTTTGTCATTTCCCATA
CAGAAGAAATTGTGCAATACTGAAAAGAGACTATTAATACACTGTGGATATAAAAATGAA
TTAAAATTTCCTCACACAGGCACAGATCAGGCCCTCACACGGGCCAAGACTTCACACAGG
CAGGCCCTCACACAGCAAGACGTCCACTTCTCTTGGAGCCACACCTCTGGTCCCTGGGTC
TATGTGCAGTGTAGTGTTCTGTGCCAGGGACAAATGAACACAGACATATTTGCTTCAGTC
ACCTTCCTGGACTAAATGTCATTTTCTGAAAGGATGTGATTTGCTGTATCATTAGGAACA
GTTGTGTGAAATGGAAAACCTCCGCCTAGAAGCTGAACAGTTGAGAGAGAAGAACTGGCT
TCTGCAGGGCCAGCTGGATGATATTGAAAAGAAAGAGGACAGCAGGTGAGGGTGAGCTGG
ACTCTCGGCTGCCTGGAGAGGGCGTCAGTGAGGGAGGTGGAATGGGGTGACAGTTTGTAT
GTCCTGTGTTTCCCACTTCCCCAGGAGACTCTTTCCATGGCTTGTGAGGCCAGTCTAATG
CAGTCATTGGTTTCTCCAGAATGTGAGCTTTTACAGAATAGGAGAGATCTGGGGCTGGAG
AGACAGTACAGTGGACAGGCCTTGCAGTAGGCCAGCCCAGGTTTTATCCCGGGCAATCCC
ATATGGTCCCCTGCTCCATTCCCCTGCACCCATTGGGGTGTGCCAGGTACAAATCTCAAA
TGGAAAGGGATGATTTTCTATAATCCTCGACTTCTGGGCAGGGGTTTCCAAAGAACATTT
GTCTCTGTGTGTGTTAACTCAGCGAGGGCAGTTTCCTAGTGGCAGGGACAAACACATCAG
ACTATCTCCTCTGTCTGACATTTAAAAGTCTGATGACTGTGGGCACATAGTTTTGAATGG
TTAGTGTCTCAGTTTTCTCAGAATAAAGCAAGGGGAATGGTCTCTCCTGCAGGTGCTTTA
TAGACTGAACCTCCTTATAACGTGCTCCTGACAGCGTGTCAGTGGAGAGTCACTCCAAGG
GCAGTTGTAAATGTAGTGGGTAGAATAGGTAGGTCTGTTTTCGGTTTTTCATTTGATTGG
GGGCCACACCTGGCAGTGCTCAGGGCTTCTGTTTTCAGAGATCACTCCCCGTGAGGTTTG
GGGGTTTAAGAGGAACCAGAGATCAAACCTGGGTTAGTTGCATGCAAGGCAAGTACCATA
TCTGCTCTTACTGTTGCTCCAGCCCCTGGAATACTGGGTCTTTTTTTTTTTTTTTTTTTT
TTAATGTGGTAGAAGAGTTTATTGGAAAGGAGAAGAGAAAGGGGAAAAAAACCTTTCCAT
GTGGGGAGGAACTTGGTATAGGACTAAGTTGACAGGTGGGTCTGATTCACTTTCTGAATG
AGGGGTCGGAGTTATGAATTCTGTAACATGCAGCTGCTCAGAGTGACTCCAAGGGTGTCA
GTATTCGCTCGAGGCCTTCCTCAGTTCCGCTTGCCAGACCAGAGATGCTGCTGTTCTGCT
GTTTCCAGGTCTTAGAGAGCAGCCCTCCATTTCTGCCCTCCCCATCTCTGTCTGGAAGCA
TTCTGTGACACACAGTCCAGTGGCCTTCCGAGGGCAGTCATTTGTGACCTGCTAGTAGTC
TGCTCCTCAGCGCTTCTCCCGGGGTGGGAAGCAGACATGCTGGAGTAGCTCCACCGTCTG
GCGATGCCACTTCCTTTTCTAGGTTGTTTCGGTGCGGGCAGCTCAAGTCAAGGTACAGCC
TATCCAGACTTGTTAAAGAAAGGCATTTGACTGGGACTGTATTTTATCAAGAACTAGAGC
ATGGGATAGAATCCGCTACCAGCTCATTTATAGAACCATAAATATTTTTATACTCTGATG
TTCCTCATGTGAGAAGCAATGCATGACCTTTTTCATGAAAGATTACATTAATGGAAAACT
ACAGTCCAGAAGTTAAGTGGAGCCCACGGCCTGTTTAGTAATAATAAAATTCTATTGGAC
CATTGTACATCCTTCAAATAACTGGGACGAAGACTGGTGAGCTTCCAGTAGTCTATTGTG
CTTCTATTTCTGTTGGGTCTTGACAGAGTTTGTTCAGCTCTGAATTAGAACACAGAAAAC
ATTTACCCCCTTATGAGTTTAAGTGTTTTTCCCATTGAGGTCTCATTACTGTTTTTGTTA
GGTTGCCAGCTTCATTAAAGGAAAGAAACTGTTCTATTTTCCTTCAGGAATTGATCTTTC
CTTACTGGTGAGAGAGATTTCCTCAAGAAGCGTATAATAGGGCTGGAGTGATAGCACAGC
GGGTAGTGCGTTTGCCTTGCACGCGGCCAACCCGGGTTCGATTCCCAGCATCCCATGTGG
TCCCCTGAGCATCGCCAGGTGTGACCCAAAAAGCAAAAAAAAAAAAAAAAAAAGGAAGTG
TATAATAGGTTCTCTATGGGATGTGGGGGTTAGCTGCCCACATAAATTTTTGATCTATTA
TTCTGTGGTGCTGAGGATTGAACCCTGGACCTCATGTGTGCAGGGCAAGTGCTCTCTCGC
TGAGCTACATCTGTGGCCCAGAAAGTTGGTTCATTTTCCTCACCTGGTCAGTATCACTTT
AATCTAGTTCACATAAAACGGCCAGAGAAATAATGCAGGGTTAAGGCGCTTGCCTTACAT
GTGGCCAACCTCAATTTGATGTCCCCAGCACTGTATGGTCCCCTGAGCACTGCTAGGTGT
CGCCCACCCCCAAATAAAACTAATTCACACGAGACTAATTTATTACCCAGAATATAATTT
TCTTAGTTGTGGGACAGGTGAGGACTCCCAGTTAGTGGCCAAGAGGAATAGGGACCAGTT
CCAGTAATACTTGGCTGGGGTGCTTGTTCGTGACACAGTGACATATGGGCCCAGCTAATG
GTGGTGCTCTGGGAGGCCTAGTGGAGCTAGAGATAAACTAGGGGTTTTTCTCATACCCAA
CATGAACTCCAGTCCCTGTGAGCTATCTCTCTGACATCCAGAATATAATTTTCTTCGTAC
AAAGGAATGTTTATTTTTCATGAAGAGATTTTTATGTCTGTTGCTTGGGAACCATCCTTC
CTGGTGTCACTTGAGAAGCTGCTCATCATTAGAAAATTACCAACTATGAAACTCCGGCAG
GTGCAAGGGGGTATTCAGGGACTCGGGGCCGGACCAGGCTGAGGGACCCTCCTATCTCCA
GAGGTGACCACTGTTATCTTCACACCAGACTTCTTTTTTTTTTNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGTTGATAGTACTTCTCATCTTTCCTTCC
TGATCTGCAGTGAACAGAATCATCCAGCTTATCATCAGCTGAAGAATGAACTAGAAGAAG
TTATGAAAGAAAAACTTGCTAAAGTATGATGTTTTTAAGTATAACTTTCTGTATTCTTCA
TCCAAGTATGTAGATTATATTTAACATTTATGGCTATGTATTTTTAAAATTTTATTTGTT
TTTTGCTTTTTGTGTCACACCCAATACTCGTGTTATTCCTGGCTGTGCACTCAGGAGTTA
CTTCTGTGGTGCTCAGGGGATCATATGGGATGCTTGGGATCGAACCCAGGTCGGCTGTGT
GCAAGACAAACATCTTCCCCACTGTACTATCACTCTGACCCTGGCTATGTATTTTAGAAG
TTATTTAGACATCTTTTTTCGGTATTTCCATTTGGCAAGCCACGTGTATTTTGACATAGT
GGACAGTGACACTCATAACTGATAAACAGCTTATGCTCAGCATCTCCACCACAAAACTGC
CCATTTGGAAGCAAGTGTGAAATGACTTGAAGCCATTCACATTGACTTGGGGCTGGGGGG
CTGAGGAGATGGGGTAGGGTACACCTGGGATTGTAGAAAGGATATTGGTTTAATTGATTT
TATTACCATGAGGGCTGAAGCGATAGCACAGCGGGTAGGGCATTTGCCTTGCACGCGGCT
GACCTGGTTTCGATTCTTCTGTCCGTCTCAGAGAGCCTGGCAAGCTACTGAGAGTATCCT
GCCCACTGGCAGACCCTGGCAAGCTACCCGTGGCATATTCGATATGCCAAAAACAGTAAC
AAGTCTCACAAAGGAGACATTACTGGTGCCCACTCGAGCAAATCGATGAGTAATGGGACG
ACAGTGCTACCATGAGGAAGAGTAGTTATTTTCAATCTTTTAAAAAAATCTTTTTAAACT
AATATTTAAGAACTAAAATCAACCTTAATTTTTTTATTATTATTATAGGATAAGTTGATT
GAAGAAATGCTGAAAGTGAAAGCAGAGTAAGTATCCTGTTTTGTAATTAAAGTTCTCGAT
GATCTTTATTTAATTCTCCTCTAAGGAAAGTTAAATCCACATGGTAAGCAACTTCTATAG
TACTATGTGCATATAATACATGCTGACAAAATTATTTTCCTAAATACCATATTAAATTTG
GGGGTTATTGCTTAAAGGGTTTTGTACTTAAAATGATGCTCAGGGTTACTCCTGGCTCTG
CACTCAGGAATTACTCCCAGTGGTGCTCGGGCAACCATATGGTATGCTGGGGATCAAACT
TGGGTCGGCCACATGCAAAGCAAACGCCCTCCTTGCTGTACTATAATGCTGGCCCCTTGG
GCTCAACCTTGGGTCTCCTTATGCCTATACTTTTTGTTTGTTTTGGGGGCCACACTGGCA
GTGCTCAGCGCTTATTCCTGGCTCTGTGCTCAAGGATCACCCCTGGCAGGGTTTGGGGGA
TTGTGTGTGATACCAGGGATTAAAGCCAGGTTGCCAGCACTACATGGTCCCCTGAACAGT
GAGTTGGGAGTAACATCTGAGCATCACTGGGTGTGGCATAGAAACAAGAAGTTTGAGAAT
TTTGTCAAGATGGAAGTCTTAAATGAAGCAACTCAAAAGGGCATTATTATTTGTTCTTTC
TATTTTCCCATGCAGTTAGTAGCAGAAGATACTTTCAAATCACGATTCTGGTGGAAAATG
TCTTGAGTACTGATTTATAATTATGTTAATGTGGATTTCCATAACGCCATGTATACTTTT
TTAGCCTAGAAGAAGTCCAGCGTGCCCTTCTGAACAAAAATATGGACTGCTTTAGAATGA
GTGAGGAAGTAGAACGAACCAGGAGTTTAGAATCTAAAACATTCCAGGAAAAGGAACAGC
TGAGATCAAAGTTGGAAGAACTGTATGAAGAAAAGGAGAGAATTGTCCAGGTGCTTTTAT
GTGTTGTTTTTGTCCATGAGTTAACAGAACCAGACAGTTTAAGACATTTGTGACTGGGTT
TCTATGTATTGGAGACGTTCTAGCACACCTGGAGATGTGTGATCGTAAGGGCTTGAAGGT
AGATTCTGTTTCTTGCGTTCTGTGCTCTTGGAAGACAGGAAATTACGTTACCGTAAGTGA
AAACTAAAAGTTTTCTTATTCCCTGGGCTGATTTACCTGCAGGAGCTGGAAATGTCAAGG
AAGCAGGTGGAATTTCTTGCTGAGGAAAATGGCAAGTTAGTTGGTCACCAAAACCTACAG
CAGAAGATTCAGTATGTGGTACGGCTGAAGAAGGAAAATACCAGACTGACTGAGGTAAAG
CAGGAGCATTAGTCTGAATAAATTCTTTCAGGTTTTTTTTTTTTTTTCTTTTTGGGTCAC
ACCCAGTGATGCTCAGGGGTCACTCCTGGCTTTGCACTCAGGAACCACTCCTGGCGGTGC
TTGGGGGACCATATGGGGATGCCGGGGATCGAACCCAGGTCGGCCGCGTGCAAGGCAAAC
ACCCTACCCACTGTGCTATCGCTCCGGCCCCTAAATTCTTTCAGGTTTTAAAATGATCCA
TTAAAATTTGATTTGATGAGAGCCTTGCTGTCATCAAGGAACTTAACTGGATTTTAAAAA
ATCCCAAATTTGAGGGGCTGGAGCGGTAGCACAGCGGGTAGAGCGTTTGCCTTGCACGCG
GCCGACCCGGATTCTAATCCCAGCATCCCATATGGTCCCCTGAGCACCGCCAGGGGTAAT
TCCTGAGTGAAGAGCCAAGAGTAACCCCTGTGCATCGCCGGTTTGACCCAAAAACCAAAA
AAAAAAAAAAAAAAAAAAGTAAAAATCCCAAATTTGAGTTAGAGATACACGTCAAATTCT
TGTTTAATGTTAAGTAGTTTAGAAATTAAAAGCTGCTGTGACTTTGAAAGATAAGCTTAA
TGAATGCTACAAGTAACTCTTCGTCTCTTCCTGTAAGAATCAGACTTAATTATTCTTTCT
TTTCCTTTTTCTAAAAATCACTTATCAGGAGACAGAAAAGTTGCGTGCTGAAAATGTACT
TTTAAAAGAAAAGAAAAGAAATGAGCCATAGGATCTTTATCAGCTACCTAGGTATCAGCC
TGTTTGGAGAGTTTCTTTCCTTGTCAAAGGAACACTTTCTAACGCACTTATCAGCGCTGA
ACTGTGGGCGGTGATCCGGCTGTACAGAGGGGCCTCCTGGATGGATGTCCTGCACGCCTA
TCCCTGCACTCCTGCAGTAGCCAGCAGTGTGTCTGATGGATGTCCTGCACGCCTATCCCT
GCACTCCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1019, 3129..3171, 4838..5024, 6942..7018, 9791..9828, 10757..10854, 13618..13797, 16808..17017, 17546..17671, 17831..17953, 36568..36691, 36792..36868, 36969..37154, 37257..37280, 37856..38033, 40779..40920, 41859..42000, 45001..45183, 46266..46373, 46989..47094, 48687..48852, 50118..50268, 50516..50601, 51696..51765, 52121..52207, 53392..53496, 54337..54459, 57742..57888, 58692..58790, 59077..59241, 61135..61244, 64510..64582, 65448..65485, 66244..66409, 66642..66773, 67468..67527
1001..1019, 3129..3171, 4838..5024, 6942..7018, 9791..9828, 10757..10854, 13618..13797, 16808..17017, 17546..17671, 17831..17953, 36568..36691, 36792..36868, 36969..37154, 37257..37280, 37856..38033, 40779..40920, 41859..42000, 45001..45183, 46266..46373, 46989..47094, 48687..48852, 50118..50268, 50516..50601, 51696..51765, 52121..52207, 53392..53496, 54337..54459, 57742..57888, 58692..58790, 59077..59241, 61135..61244, 64510..64582, 65448..65485, 66244..66409, 66642..66773, 67468..67527
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved