Sorex_araneus Locus STATIP1
snOPY snoRNA Orthological Gene Database
Sorex_araneus STATIP1
Sorex_araneus
STATIP1
GeneScaffold_3642
SNORA31
3804..3925
53854
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAA
GAAAACTCACAAATACCTCAGAATATCAGGGACTCAGAAGGTCCTAGAAGTTCAACAATA
AATTCTGGGTTAGAACCATCATTTTGTGTAGTTGCTTTTCATTTATTTATTTATTTAGTA
ATTTTTATTGTTTTATTTTATTATATTATTTATTTCATTTAGGCACCATAATTCATAAGG
TTTCATTTTTTATAACAATTCCAGGCATTCTCTGCTTTTACCAAATCCTCCGCCAATGTC
AGCATCCCTCCACCAATTAGCTAGGGATCTCTCCCTTTATCCACCCTGTTCATAAATCTT
TGATGCCATTTCAATGCTGCATGACTGACCAATCCGGCAGCATGGTGGCCCCCGCGCTGC
AGACGGCGCACGTGTTCTGCTGCCCGAACAGGGTGCGGGGGGCGCTGAGCTGGAGCTCGG
GGCCCGCGGGGCTGCTGGCCTTCGGCACGTCCTGTTCCGTGGTGCTCTACGACCCTCAAG
TAAGCGCTGCGGCCGCCCCTGCCGGCCTGTGAGGCGCGGCCGCCGGGGGCGGGGGACGCA
GCCGTCGCGCGCCGAGGTCGGGCCGGCGCTAGGACGCGGCCCCCGACGGAGGAGGCCGGG
CTGTGGGCCGTCAGCCCACCGGCTTCGCGGCTCTCGTCGTTGGCGGGGGCCCCCCGGGCA
GCGTCCGTGGCCGCCACGGCGCTGACGCCCATCCGGAGTCCCTCGGCCCCGGGAAAAGGG
GCAAACGTGCGCGTTCCTCAGAGGGGCGGTCCCGTTTGTGCATTCAAGCCCTTGTCGTAC
ACACGGTGCTCTCACGTCACTGTCTTTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNGACCACACCCTGTGTTGCTGGGGGTTACTCCTGACTCGGTGCTCA
GGGATCAAATTCCCCTGTCAGCCACATGTAAGGCAAGAGCCTAGCCCACTGAACTATTTC
TCTGCTCCATTCTGATCTCTTAATTAGCATCCCGCATGGCAGAGCCTGGCAAGCTATCTG
TGGCCTTGGAGTATTCGATATGCCAAAAACAGTAACAACAAGACTCACAATGGAAGCGAT
ACTGGTGCCTGCTCGAGCAAATTGATGAACAATGGGATGACAGTGCTACAGACAGTGCTT
AATTAGCATAAAAAGGTCTGGAATCTGCATCCACTGATAGACCTTGAACAATTTGCTGTT
TGTTTGATTTGCACTATGATGCAAAGCAAAATCATCCCAGTGCTTTCTGTCTCTGTGGCT
GCCAGATTGAATAAGGGAGAACATATGAAAAAACAAAACTCTGGAATCTGATTTTTATTA
TTTTATTGTTTTCTCTGTGGGGTAACTTCTGATTTACTAACTGATGTTTTCTTTTCTTAA
GAAAAGGGTTGTTATAAACAACCTCAACGGCCACACTGCTCGAGTCAATTGCGTACAGTG
GATTTGTAAACTGGATGGTTGTGAGTATTAATACTTCATGTTCCTAGTCTTACTTTATGA
TAAAAGATCTTACTTTTATCGCATTTGTTAATTTAGCACTAGCTTATCTGATATTAAGCA
GATGAGATAAAAGAGGGGATGCCATCTGACTGCTCTGACCTCTTCTTTCCCTTCAGTTGA
ATCCTGGGTAATGTAACACAGCAGGGAGTAGGAGGAGGGTAGAAGCAGCTCCTTGAATGA
TAAAACCCTTCTCCCTTGCTCATGGATGTCTTTGTATCTGATGTTAGAATCTAGCCCAGG
CTCTCAGGATACAAGGGATACACTCTGCCACTGAGCCACTTTCCTGGCATACACTCTGCC
ACTGAGCCACTTTCCTGGCAGATGGGGTTCAGGCTAGGATTTGGAGAACCAGCTTATGGG
TCTATTTCTGCCATGGACAGATTGCCTCTTATTTATTAATTTTTGTTCTTGGACCACATC
TGGCAGTGCTCAGGTGTTACTCCTGGTTGTGCACATAAGGATCATTTCTGGCAAATTTGG
GGGACCATATGGGATGCTGGGAATTGAACCTGGGTTGGTCGCTTGCCATAAAGTCAGTTG
TTACAGATGTTAAAGATTTAAGAAATGAGAACTGGCTCTTGTTAATCCACACCTTTCCCT
TCCTCTGCCCCTTTATAATTTTTGGTTAACATTTAATGAAGTTTATTGTCATTAAACAGA
AACATTAAAATTTTTACTTTAGGCCTAGAGAGATAGTATAGCAGTTAAGGCACTTGCCGT
GTATGTGGCTGACTAGGTTTGTTCCCCTGTACCCATATGGTCCCCCTAACACTGCAAGGA
GTATGTCCTGAGTACAGCTAGCTGTGGCTCAAACCACTTTTCTCCCTACAATTTTTTTTT
AACCTTCAAAGTTAAAAACTTAGGGCCAGACAGAGAGTACCAGCAGGTAGGGTGCTTGCT
TTACTGACCCCAGGTTTATTTCCTGGCACTGCTAGGTGTGGGCCATAAACTAAAAAATTT
AAAAAATTACTTAATGTTTGTTTAGGGCTACGCCTGGTCATGCTCAGGGCTTGCTCCTGG
CTCTGTGCTCAGAGGTCACTCTCGGAGGGCCTGCGGGACTATATGACGTTTGGGGATTGA
ACCTGGCTCCTCTGTATGCAAGACAAGCATGTTACCCACGGTACTATCTGGCCCCCAAAT
TTACACTTTTTGTTGTTTCTGGTCACACCCAGTGGCAGTACGCAGGGTTTCTTGCTGGCT
CTGTGCTCAGTGATTACTCCAGGTGGTGCTCAGGGAACCGTATGTAGTACTAGGTATCAA
ATCCGGGTTGGCTGTGTGCAAGGCAAGCGCCCTATTACTGTACTGTTGCTTTGGCTTCCA
CATTTACATTTTAAAATAAACTAATACTTTTATTTTCAGCATATATTTTTATTAATTTTT
AAAACTAAATCACCATGAGATACATAGTTACAAAGTTGTTCATGATTGGATTTCAGTCAT
ATAATGTTTCAACATCCATTCCTTCACAGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNGAGGATGAAACGCATCAAAGAGGAGAAGGGAATAGAGGATTTAAGGGAATGGGCTGC
ACATCATAATCTTAGGGGCTTAAAGGTTTCCTTTCCATATGTATTTCCATACACACAGGT
GTTTAACACACCTTGAGGTAAGGAAATAGTTCTAAGCCGGTGTAATAAGAGGTTTGGTTC
TTTGAATAGTGAATGTTTTTATAAATGTGAACTTGAGAGATTTTAGTTTTTCAGATTCTC
TGGTGATTGAAATAGAACCCTTCTTAAAGATGTGAAGTGTTTTCCACAGAATTTAACTTT
TAGGAGATAGTAATACTTGAAAAATTTAAATATAGAAGATTTTAAAGAAGGGGAAAACTA
CAAAAATCTTCATAAAGTTGACATTATTTTGGATCTTTAGTTATATATGCATAAATACAT
ATATGAGATCTCACTGTAGCTGAGTTTTCTTCCAGTTTGTTTTCTTCCACTTTTTTTTCT
GTTTTGTTTTGGGGCCTCATGTGACAGGGCTCAGGGGTTACTCCTGGCTCTTATCTCAGG
GATTACTCCTGGTAGTGCTCAGGGGACCATATGAGATGCCAGAGATTGAACCTGATCGGC
CACATGCACTGTATTATTGTTCTGGCCCCAACCTGATTTTCTTGTTTTTTTAAGTCAGAA
GTTAGTGACTCAAGAGTTATTACAGGAACCTAATGTACACCGATTAATAACCTGGTAAGT
GGCAGAATTCTGCTTGAGGTGACAACCAAGGAGGCATTGGGAGAGTGATAGAGCAGCAGA
TAGGGAACTTGCCTTGCAGGTACTGACTTGGTTTAATCTCTGGCATCCCACATGGTACCC
TGAACTCACCAGGATTGATCCCTGAATTCAGAGCCAGGAGTAAGCCCTGAGCCCTGCCAA
CTGTGGTACCTGAAACAAAAAACCTAAAAGCAACTGAAGAGGCATGTAAATGATACTCTG
TGTCATCAGACAAGTTAGAGAAGATACTTCTGAGAGAAAGTGCTAGAATCTCACACATTT
AGGAGCCAGAACAATAGTGTAGCAGGTAGGGCTCTTGTCTTGCACAGTGCAGACCTGGGT
TTGATCCCTGGCACCCCATATGGTTATGGTTTCCCAAGCCCTACTAGGAATGATCCATGA
GCGCAAAGCTAGGAATTATCCCTGAGCAGTGCCAAAAAAACCACACCAAAAAAATCAAGA
ATCTTGCACATTTAGAAGTCTGAGTCAAGTTGGGGCCCGAGTGATAGTTTGGCCCATAGG
GTGTTTGCCTTGCACACAGCCGACCCAGGTTTGATCACCAGCATCCTATATTGTCCCCTA
AGCACCATTCGGAGTAACTCCTGAATGCAGAACCAGGAGTAACATCCAAAGCATCGCCAG
GTGTGACCCAAAAGCCAAATAAATAAGAACTAGACTAAAATTAGCGTAAGGGGCTGGAGC
AGTGGTACAGTGGGTAGGGTGTTTGCCTTGCACACGGCTGACCCAGATTCAATATGGTCT
CTCATCACTGCCAGGAGTAATTCCTGAGTGCAGAGTCAGGAGTAACCCCTGTGTATTGCT
GGGTGTGACCCAAAAGCCAAAATAATAAATAAATAAAATTAATGTGAATTATGCCACATG
GATTTATTACCTAATGTATGACAGGTAGACCATCTTAGTAAGTAAATGGGATTTCCTAGT
TTTTCCATTTTTTTCCATGATACAGTTGATTTGTCCGACAGTGTCTGGTGACCTGGTTAC
ATGGAGCCAATTCCGATGCAGTCTATAACTGATGGTTTGTGACTGATGGACTACAGATTG
ATGGCACTGTAGACAGTTTTATTCAGGACCAGCAGTGATTATATAGGGGCAAAGGGGATT
CAGCACATGCAGGATGAGGGCAGGTGGTAAGTGGGAGACAAAAGTTAGTTCAATAATTAT
ATGGGGAAGATCGGTATAAGCAGAAACAAAATTATTTATTTAGATTCCATCACTATGGGG
CTGGAGCGATAGCACAGCGGGTAGGGCATTTGCCTTGCATGTGGCTGACCCGGGTTCAAT
TCCCAGCATCCCATATGGTCCCCTGAGCATTGCCAGGGGTGGTTCCTGAGTGCAGAGCCA
GGAGTAACCCCTGTGCATTGCCGGGTGTGACCCAAAAAGCAAAAAAAAAAAAAAAATTNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNCAGGGGTTACTCCTGGCTGTGCTCAGGGGCTACTCCCATCTTTGTGCTTTGGGGTCA
CTCTCAGTGGTGCTCACGAGGACTGTGTGTTGCAGGAGAACAGACCTGAACCTCCTGCAC
ACGCAAAGTTTGTGATTAGTTTGTTGAGCCATCTTGCCAGTGCTGGGAATTCCTTTCTAA
CCATGTCTTCCTCATTCTTTCTGACTTAGCTTTTAAAAGCTGTCTGTCTCCAAGGCCATG
AAGGACCTGTTTACGCAGTCCATGCTGTATACCAGAAGAAGGCATCAGATGTTACCTTAC
ACACACTGATAGTTTCTGCGGCTTCAGATTCTACTGTTAGAGTGTGGTCTAAGACAGGTT
CTGAAGGTAAGTTGAGAGTCTTTATAATCCAGACAATGGAATAGCTACAGTTAAACGAAC
AGTAACTAGAAGAGTTTTCACAATTTTTTTCAATTAATTTTAAAATAATATAATGTAATT
CTAATCTAAGTGTCTCTGTTTCACCTTTTCAAAATTTATTTTTAATCAAATTGTGGGGGG
CGTTTGTGTTTTTTTGGGGGGGAGGAGGGAAGAAGGTTTGGATCCCATTTGGCTATGCTC
AGGGCTTATTACTGGCTCTGTGCTCAGGGATTGCTCTTGGTGGTTCTCCAGGGGACCATT
TTGTGGTGCCAGGGATCGGGCATGGCAAGCGCCTCATCCACTGTGGTATCTCTTCAGCCC
CTGTACCAGGTTGTTAATGTCAATTCCTTCTCAAATCTTTCGTGTATTTTTTTTTTTTAA
GAATTTTATTTTGTTGGGGGGGGGTGCGGAGAGCGTGGACATGGGAAGTGGTACTGTGTG
GGAATTTTTTTTTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTGTT
GTGAAGAAGATATGAGGTTTGGATTTCTGTACTTTAGCAACTGAGTCCAGAGAGATTTCC
TCCCAATAATTGGATCATTGCAAGCTTGTAAACCCCATCTGTGGTCGTCATGATATGGCG
GTCACCACGCCCTTCACCCTGGCAAGGAAGAGGTGAGAGAGAGAGAGAGATACCTTTTCC
CTCCTGGGCTGGCATGGGGCCGAGGCTTAGTTCTCTGTCTGGAAACAATCTGCGAGGAGC
TGCCCATGCCGAAAAATTTAGCTGGCATCTGGAGTCACGCTCGTGCAGCTGCAGAGAGGC
CGCACACACGTGCGACCCCCAGGATCACATCTCTTTTGTGTATTTTTGTTCTCTGTTTAA
ATTCACCATTTAAATATACATGGGCAGTTGTGAATTTAAATCACAACAATCCTGAGCTGA
TTTCTCTCCCAGCTGACATTTAAGATATGATACTCTGAAAATGAATATACTCTTAAGCTG
TCTGTTTTTTATTGTTTCTTAGTGACATGTCTGCAGACCTTGAACTTTGGAGAAGGAGTC
ACTCTGGCTCTCTCTTTATCGTTTTTGCCTGAGACTGATAGTGAGTATTCTGTTAAGTAT
ATATGAAATGAGCACTATGTTTTTTTTTTTGTTGTTGTTGTTGTTTTTGCTTTTTTGGGT
CACACCCGGCAATGCACAGGGGTTATTCCTGGCTCTGCACTCAGGAATTACTCCTGGCAG
TGCTCAGGGGACCATATGGGATGCTGGATGCTGGGATTCGAACCTGGGTTGGCCACGTGC
AAGGCAAACGCTCTACCCGCTGTGCTATCGCTCCAGCCCTGAGCACTATGTTTTTTATAT
CTACAGATAATGATGTCTAGAATCTCAAAGAACTGGTCTTAATATCTGTTTGTTTTGGGT
TTTTGTTCTCAATGATGCTCAGGGACCAACCTCTAATGAAGGAGCCTGGGGATTTTGCAT
AAAATTTGTGCACTCAGCCTGTTGAGTTACCTCCTCAACCCTTTGGGTCTCTAAATATCT
CTATCCCCGTGGCCCCCTCCCCCCCACACACACATTTTTGGGCCATACCCAGCAATGCTT
ACTCCTGGCTCTGCACTCAGGAATAACTCTTGGCAGTACTTAGGGGACTATATGGGATGC
CAGGGATCAAAACCTGGGTCAGACACATCCAAGACAAATGTCCCACCCGCTGTACTATCA
TTCTGACCCATCTGCATCTAAGTGTTTTTTTGGAGTGTGTATATCTGTGTGTGTGCGTGT
GCGTGCGTTTGTCCAGGGGAGGGAGGGGGGGAGAGGGGGAGATATTTTCATGAAACAAAG
TGAGACATAACATACTTTTACTTTTAATATGTGTGATCTCTGAGTGTTGCACATGACATT
TAGAAGTATATGGAAGTTTGGTAGATGTACAAATTTTGTGACTTTNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACAG
AATGTTCCTATGTAGTCACCTAATGTGGGAACATTAACTACTTATGTAGAAGATGAGATA
ATCTGCGAAAGTACTGAAGGTGAACCTGTGAAAATCTCTCAAGATATCAGCCTCCTTTTC
CTCCTGTATGGTGGTTTGTCCAAGACTGCTTAAAATCTTAGAACAGAAAGAAATCCTTTT
ATTGTTGTGAGATTCTTTTTTTTCCTGTCTGATTATCCTCTAAAAGATGATAGCCACTAA
AGGTCAGTTCCTTTGCACTAAGTGACCTAGAGGACAGATTTGTTAGACAAGAAAAGGGTG
GAAGTGTGCCCAGTAACCACTAGTCTCTTGGCCTCTGTGACAGAAATGACAGCTTAGTTT
CATATGATGCTTCACTTTGTGTGAGGATCCCAGAGTTGGGCAACTGCTTCCCTTTTGGTT
TCATAACAGACTTTTAGTTCATATGCATCTGTCTTGAGGCCTACTGGAGTTTTTTGTATT
TTTGCTTTGATTTGTGGAGGCTGATTTCATAACTGCATCTTTCCCACTTTTGAATCACAT
GTTTATTTACATGCTTTGTGATTTGATATCTGAACTGTTTTATGAAGTTTGTTCCACTGT
TGAATTCTCAGACGAGATGTGTAGCTCTCAGAGCAACAGACATACCCTTAAATATCTGGG
CAATAACCATGTGCTGTGCTGATAATAGCTCTTCTATTTTATTGTTTAGTCATGCTTACA
GCCGTTCATATTCTCTAGGCTCTTTGAAATGCTTCCAGCTCATTCTTGAGCTTCTCTGTT
ATAAAATAATGGGAGAAAGGATTTTCACTTAACGGTGGCTCTTTGCCTTGTGACTTTTTT
TTTTTTTTTTTGCTTTTGGGTCACACCCGGTGATGCACAGGGGTTACTCCTTGGTCTGTA
CTCAGGAAGTGCTCAGGGGACCATATGAGATGCTGGGAATCAAGCTTGGGTTGACCGCAT
GCAAGGCAAACACCCTACTCTAGAGCTGTACTATTAGAGCTGTACTAATAGAGCTGTACT
ATTGCTCTAGCCCTGCCTTGTGACTGTTTAACAGAACATCTTAAAGTGTTTATTCTTACT
GATTGATAGAACATTTTCAGTTTGTCTGAAACTAGAACTCAGAATCTTTCCCTAGAACAT
AGAATCTAGCATAGGTGATAATCATATGTATTGTTTTTTGTTTTGGGGTCACACCTGGCG
GTGCTCAGGACTTACTCCTGACTGTGCTTAGGGATCACTCCTGGTGGGGCTCGGGAAACC
ATATGGGGTTCTGGAGATTGAATCCAGATTAGCAGTGTGCAAAGCAAGCACCTTACCCTC
TGTACTATTGCTCCATCCCTGATAATGTTAATATGTGATGAGATTCTTACAGCCTCTTGT
TTCTCTCCAGTGCCTGTACTAGCATGCGGTGATGATGACTGCAAAATTCACTTATTTGTT
CAACAAGATGATCAGGTAATTAATGATATTATTTGAGACTACAAATATTATGTTCTGTTT
AATTGTGTGTCTGTTCAGATTTTTAGAATATGGGGGATGTTGTAATCAATTAACATAATC
CGAAGTGATTACAGCAGGTCTTGAACTGTTAGGCAAACAGCAGCTGTTAGGTTAGAAAGG
AGACGGAAGATGGAAACATTTAGAGTATTTGAAATTTGCAAATGTTTCCTGTTCATACTT
AGGTAATACAACATTTTCATTTCCAAACAAAAAAATCTGTCTTATATTTCATTATGACAT
TTTCCTCGGTAAAAATAGTTGATGCAGGGGCTGGAGCGATAGCACAGCGGGTAGGGCATT
TGCCTTGCACGCGGCCGACCCGGGTTCGATCCCCAGCACCCCATATGGTCCCCTGAGCAC
TGCCAGGAGTAATTCCTGAGTGCAGAGCCAGGAGTAACCCCTGTGCATCGCCATGTGTGA
CCCAAAAAGCAAAAAAAAAAAAAAATAGTTGATGCAGGGCCAGAGCGATATTACAGCAGG
TAGGACATTTGCCTTGTACATGGCCAACCCAGGTTCATCTCCAATATCCTATATGGTCCT
GGGAGCACTGCCAGGAGTAATTCCTGAGTGCAGAACCAGTAACCCCTGAGCATAGCCAGG
TATGACCCAAAAAAGCAAAAAAAAAAAAAAAAAAGTTGATATTCTAGGATAGTGACCAAA
TGAGATCACTGATACAAGTGGTAAATTCTTACATCAAGTCTAATGAGTTTTATCTTTCTA
GTTTCAGAAAGTGATTTTTCTTCGTGGCCATGAGGACTGGATAAGAGGTGTGGAATGGGC
AGCCTTTGGTCAGTATAAAGTTTTACTAAAGTCTATCTGATGGGTACAGATATGGGTAGC
TTAGATGAAAACCTCTTTTAATTTTATTTAATTTTGTGTATTTGCTATTTCCAGCTAGGA
AAGGGGACACCTTTCCCCTCTTCTGTCTTTTAGATATTAATATAAATACCTAAGGTATAA
ATATAGTATAAACGGACACGTGATTATTACACATAAAGACGTCCTTGTGATTATCTTCAT
TTTGAGTACTGGGAGTGTTTTGGGTCACATTTGGCAGTGCTGCGGGGCTGCCTCCGGCTC
TGTGCTTCCGAGGAGGTGGTGAGTGGCTGGCTTGGGATGACTCACGAGACACTAGGAGTG
TTCGGCCAAGTGGTGCTGGGAATAAAACTGTTGGCCACGTGAAAGGCACGTACCTAGGCT
CCCGTACTATCTTCCCACTTCTCTTCTTATTTGGAGTTTGGACCATACCTGGTGAAGGGC
TCTGCACTCAGGAGTAACTCCTGGCAATGCTTAGGGTTCTAGATGGGATTCAGGGATTGA
ACCTAGGTTGGCCGTGTCCAAAGTAAATTCCCTGTCTGTTGTACTATCGCTCTGGCCCTA
ATATTACTATTTAAAAAACCTTTTTTGGCCTTTGGGCCACACCTGGCAATGGTCAGGATT
TACACCTGACTTTACACTGAGAAATTACTCTTGGCAGTACTCTAGATCATGTCTGATGCC
TGGGATGAACCTGGTCTGCTGTGTGCAAGGCAGATGCCCTACCCGCTGGACTATCTCTAC
ATCCCTCCTCTTGTGAAGTTCTTTGTAAAACATAGTAGGCTGTATATTAGAATACGATGA
GTTATAAAAATTTACTAACATTATATAGGTAATCATTCTTAGTTGAAAGATAAGGATGCA
AAATCTTTTTTTTTTTCTTTTTGGGATAAGGGGGCAGGATGCACACCCAGTGGGTCTTGG
AATATTTCTGGTTCTATGCTCATGAGTAATCTTTGGTGGTGTTTAGGGTACTATATGCCA
GGGAGTGAACCAGGGTTGGTTACATACAAGGCAACTAACTGCCTTACCACCTCTATTGTC
TCCCTAGTTTTTTTTTAGAAAAACATTTTTTTTGGCAAGTCTTACAGCTATGTTCAGGGC
TTACTCCTGGTTCTGTGCTCAGGGGTCACAACTGGTAGTGCTTGGGGGATCATCTAGTTT
GTCAGGGATCAAACCTGGATTGACCATGTGCAAGGCAAATGCCCTACCCACTAGACTGTT
GCTTTAGCCCCAAGTCTTAACTCTTTCAGGAAAACCGAAAATGGGCATATTTTAGAGGAG
AAAGTCTTATACTAAATTTAATAGTATAATACTTTAAAATCATAAAACTTGTTTTTTAAT
TAGGTAAAGATCTCTTCCTAGCAAGCTGTTCACAAGATTGTTTGATAAGAATATGGAAGC
TCTACATTAAATCAACATCTAAAGAAACTCATGATGATAATATAAGATTGAAAGAAAATA
CCTTTACTGTGGAAAATGAAGGTAATTAATGAAGATAGTTGAGCTAACAGTACCTTAAGT
ATGAGTCATTTTTCATGTATGAAACGTTTTTTCTTCCAGTTCCTTCTATTGAGAAAGTAT
TACTGAATTTGCACAAGAAATATCTAAAGGATCAATGTGAATTATGATTTCTTTGTTACA
GAACATATTCATGGGTGTGGCCTAAAAACACATTGGAATAGCACCTCAGAGTATTGTGGG
GTTTTTGATTATTTTGTTTTGGGGCCACGCCTGGTAATGCTAACGGGTAACTCCTGGCTC
TGCACTCAGGAATCACTCCTGGTAGTACTTGGAGGACTACATGGGATCTTAGGGATCGAA
CCTGGGTTAACCAAATGCAAGACAAGTGCCTTACCTGCTGTACTATCTCTTCACTCCTCA
ATAGCACCTCAGAATATTGTGGAATATTGTAGAGTTGTTTTTGTTTTGGGGCCACACCCC
AGGATCCTCAGGACAAGTGCCTTACCACACCTCTACTATCTCCCGAGTCACTTTTTAAAA
GGAGATTTTCTTTTTTTCAAGTCTTTTTATTTTTGGTGCTGGTGAGGGCAAGGTGTGGGG
GGATTGGGGGCCATACTCGGCTATACTCAGGGCTTACTCCTGGCTCTGCACTCAGGAATC
ACTCCTGGTGGCGCACGGCGAACCATATGAGATACNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNGTACCTGCTGTACCATCTCCAATTAAGACAGTATAATTGCATAAT
GCTCCAAAGCTGGGGTAGATGAGGGGGGAGGAACGGGGAGAGGGGGAGGAAAAACAGTGC
CTGCCACACAGGCAGGTGGGGTGTGGGGTGGGGGTAGGGTGGTAGGAGGGAAACTGGGAC
CATTGGTGGTAGGAAATGTGGTGGAGGGAAATGTGATGAACTGTCTGGTGTTGGAACATT
GTATGACTAAAATCCAATCATGTTCAACATTGTAACTATCTCACTGTGATTCAGTTAAAA
ATATTTTTAAAAAGACCTATCGTCTGCATACTAAAGATATGATACTTCCTAGATAGAAGT
TATTTTACTGTGTTTTATGCTTTTTTTCTCCTCTCCCTTCATTGTTTTCCTTGCTTATGT
TGTTGTAGAAGTAATTACATTTCATACCATTTTTTTTTCTCCCTGTACCCTTTGTTTCCC
TATCTGTGTTTTTGTTACTGCTGCTATAATGACTCGGAGTCACAGAAGCTCCTGGTCCTT
GTACATTTAGTTGTGCTTACCAGGAGCCAAATAGATTTTTGGGTAAGGAAACTGAAGCAC
TCCTTACAGATTTTTTGCTTGCAACACATTTTGGTTATAGTGCTTGCCAGGAGCACATCT
TTGTTTTTGCTTTTGGGGTCACATCCGTGATGCACAGGGGTTACTCCTGGCTCTGCACTC
AGGAATCACTCCTGGCGGTGCTCAGGGGACCCTACGGGATGCTGGGAATCGAACCTGGGT
CGGCCGAGTGCAAGGCAAACGCCCTACTTGCTGTGTGTGTAAACACACAAAAGGGGGCAC
ACCCGGCACAGGGCAGCGGCGCTCTTATCTCTCCCGCCACCCGAGTTCGGTAGTCTCCAG
CCACTTCCCCCACCCCGGGGAGGTTGATGGCGATGATGAGGCAGGTGAAGGAAGGAACGA
GGGCCAGGCTGGTTGGTCTCAGCTGCAGTTTATTCCCATCTCCTCTCTATACACTCCTGT
CTCTCTTTCTGCTTCTTCCCCAAACCTCGTCTAACAGCCTCCTTAAATCCCCCAGCATGA
GGGGTTGGGGCTTACACATAAGTGTGGTCACAATCAATAGGGGTAAAATTCTTTCCCTCA
GGGGATGCTTCTTCTAGGACAGATTCTCTTTCAGCAGGATGACCCGCCCAAGAGCAGAGT
CCCATGGGTGTGTTTCTCCTCTCCTTGTCTAACTAACATATAAGTATTCATAATATTAAT
CATTTTGAATGGACACAGCAAAAGATGCATTAAGCTTGTAGAATTGCTCTCCTGGGGCCA
TCTCGATCTCAGACTACAGTGCTCAGGCCAGATTAGTCTTTCCTATCCCTAGCAGGGTCC
TAGTCTTGTCGTTGCTTTTGGATCATGACAGCATTTGTCCATGACCAAGCTCTTATAGTT
AAGCATTAGGCACTTTGGCCAGGCTCATCTTGATGCCAGGGTAGCACATAACTCACCGCT
TGCCCTGGGTCCATCCCGTCCCTCGTCGGAACCCCGTCTTTGGGGGTGCTAGGAAGTAAG
GGCAGCTGAGACTTAAGTCAAGAAAGCAGATGCCCAGGAGTGAATAATATTCGAAGCCAA
TTAAGTCCCATGTTACAAAAGCATATTAACAACTGTCTTTCTTTGTCCATACAAAAAGGA
CATTGCTTTAAAGTAAACTATTAAAAAGACATAAGGAGAGGGGAAAGGCGATATTAACTT
ACAATACAAGTTCTGTGTCTTAGAAAGTTCTGACCTTACAAATTAACAGAGTCTGATTAG
GGGGAAAAGCTGATTAACTGGTTGGTGAGGAGAGCATAGAAGTGGTTACAGATAGACAAA
GGAATGGGAGTGACTCGGGAGCACTTTGGTTTTTTTTTTTAATTCTTTAATTGAATCACC
ATGTGGAAAGTTACAAAGCTTTCAGGTTTAAGTCCCAGTTATACAATGCTCGATCACCCA
TCTCTTCACCAGTGCATATATTCCACCACCAAGAATCACAGTATACATACTCCCCCTACC
CCCCCCCACCTCCCCAGCCCCCCACCCTGCTTGTGTAACTGGTAAATTTCACTTTACTTT
CACTTTACTTTGATTGCATTCAATATTTCAACAACAAAAAACCTCACTATTATTATTTGG
ACTTTCTCCCCACTAAAGTCGGACCTGCAGAAAAGGAAGCATTTGATAATTTGTTTTCCA
TTGCTGAGAATGAAGAGATATGAGGTCAAGCGGCCACACTAGCTGCCGCACTAGCAGCCA
CACTCGGGAGCACTTTTGATGGGTGTGACCCGATATATCTGAGCTGCTTGTGGCAAGGAG
AACAGGACATACCAATGTTGTCTAAAATTGCTTAGAGATTATAACAGATAAAGCCAAACT
CCGTGGCAAGGGAGAAAGGACAAACCAATGATATCCTACACCAAGCACTTCCAGGGGTAA
TGAGTGCATGAGCCAGAGTAACCCCTGAGCATCTCCAGGTGTGACCAAAAAGCAAAAAAA
AGAATTTGATCTTGGGCCAGAGCTATAGTACAGCAGTCAAAGAGCCCATATGTCCTCTAA
ACACACAGGGTAGTACTGAGTGCAGAGCAGATACCCTGAGCATCCTGGATATGATCAAAA
GTAAAAAAAAAAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTGT
GGCCCCAAACCAAATAAATAAGTTTGTTCAGTGAGTTTTCTTCATCCAGAAATGCTTTTG
TTATAAATATAAAGTCTGTTAGAATTGAGATTTTGCTAGCATAATTTGACAAGGAAAACC
AGTAAATAAATAATAGCACTTTTTTTTTTTTTTTTTTGCTTTTTGGGTCATACCTGGCCA
TGCACAGGGGTTACTCCTGGCTCTGCACTCAGGAATTACTCCTGGCGATGCTCAGGGAAC
CATATGGGATGCTGGGAATCGAACCCGGGTTGGGCGTGTGCAGGGCAAACGCCCTACCCC
CCTACCCGCTGTGCTGTCACTCCAGCCCCAAATAATAGCATATTTTGAATACCTCTTTCT
AGAAATGAGGTTGCTGCTGTTGTAGTGCCGAGGGATTACACTCATCCTAAGGATTGTGCT
AGTTGAGAAAGAAACTGTCCACAGTGAATTAATTGCTGAATTAGTGAAACTATGTGTTTT
AGGGACTAAATTCAGCCTCATACACATGCAGACCACCCATGTGTAACCACACAGAACTAC
ATTAGTGAACTTGTGTGTATGTCTTTTTGTTCGTATTCTTTTATATTTTTAAAATTTGAG
TCACTATGAATTTACAGTGCTGTTGATGATGAAATTTTATGCATGCAATGTTCTAGCTTC
TCTATTCTGCTTCCCTCTGCTATTGTCCCCCCACCACATATCCCCCACCTTTTATGTGCA
CGTGTGTTTTACTGGGGATCTCAGATACCTAAAACATCTCCTCAACCATTGATCTACTTT
CCTGGGTGGGTCCTTGGGTAGGGGTTTTGGTGTCATTTTCATTAGTGACTTTAAATTAAA
AAGACCATAATATTTGCTGACTTCCTTTTTTTTTTAATTAATAGTTTATTTTTAATTAGT
GAGTCAACGTGAGGGTACAGTTTCAGATTTATACATTTTTGTGCTCATGTTTCTCCCTTA
CAAAGTTTGATAACCCATTCCTTCACCAGTGCCCATTCTCCACCACCAGTAAACCCAACA
TCCCTCCCCCCCTCCCCAGTCCCGTCTCCCCCCATCCCGCACTGCCACTATGGCAGGGTA
TTCCCTTTTGTTCTCTCTCTCTGATTAGGTGTTGTGGTTTGCAATAAAGGTGTTGAGTGG
CCATTGTGTTCAGTCTCTAGTCTATATTCGGCCCGCATCATCTTTCCCCCACATGACCTC
CAACCACATTTTACTTGGTGTTCCCTTCTCTGAGTTGCCCAGAATGAGAGACCAGCCTCC
AAGCCATGGTGACAACCTCCTGGTACTTATTTCTACTATTCTTGGGTGTTGCTGACTTCC
TTTTTTAAAAAAGATGGTAATTAGACTTTTACACTCTTACCATGAGTGAGTATATTAGGA
AGGCAAACTTAATTTGTGTTTACTTTGTAGTTGCAGTATAGTAGTAGCCATCCCCCAAAA
TGAGTGAAGTGGAACATGTTTCTCATATTTATTTATGGCTAGGAAGAAAAAAATGTTACA
GATATTTAGAATTTTTTTTTTTTCTTTTTGGGTCACACCCAGCGATGCACAGGGGTCACT
CCTGGCTCTGCACTCAGGAATTATCCCTGGTGGTGCTCAGGGGACCATATGGGGTGCTGG
GAATCGAACCTGGGTCGGCCGCGTGCAAGGCAAACGCCCTACCCACTGTGCTATCACTCC
AGCCCTACAGATCTTTAAAATTTTCACTTGTGACTTTAAATAGGGGGAAGGTTAATAATG
CATGTTCTTTCTATTGACCAGATATTATTTTCTAATTTAGGTGGTGACAAATTGCACAAC
TGAGTTCTAAAGAGGTGTTTTGTTTTGTTTTGTTTTTCTTAACAGCTTTAAAGAGGGAAT
ACTTCTTCCTTTTGTGTTACAGGTATTGAAACAGCATTTGCAGTTACTCTGGAGACTGTA
CTGGCTGGTCACGAAAGTTGGGTAAATGCAGTTCATTGGCAACCTTCATTTTACAGAGGT
AGGAAGAAAAACAACCTCATTTCAGATGAATTTTTTTTTTCTTTTTGGGTCACACCCAGC
AATGCTCAGGGATTACTCCTAGCTCTGCACCCAGGAATTAGTTCTGGCGGTGCTTGGGGG
AACCATAAGGGATTGAACCCTGGTCTGCCACATGCAAGGCAAATTCCCTACCCACTGTAC
TGTTGCTCTGGCCCCAATGAATCTTGCACGTGGAGTTTAAGCTGACAAGGTGAAGTGAAA
GTATTTTTTGAAGTGAGGATGCCACATATGATGGTGCTCGGGGGCTATACCTGGCTCAGT
GTTTAGGGACTTGCTCCTGCTGCTGCTTGGGGAACCTGTGGTACCACAGATTGGACACAG
TCCTTCTGCATACAAGGAGCATGTGTATTCTCCAGTCCATGCACTATCCCTGCAGTCCTT
GGATTATTTTTTTAAGTATGATTAGAAATCCCAAACCTAAGATTTCAAGTTGGCAAAGAT
TAACACTGCAGCATTGTTCTGCTGTACACTTTAAAATTGTGTGTGGCCAGACTGATAATA
TAGCAGGTGGGATGTTTGCCTTGCACACGGCCGACCCAGGTTCTATCCCTGGCACCACAT
GTCGTACCCCCTGAGCTTGCCTGGAGTGATCCCTGAGCATAGAGTCAGGAGTAAGCCCTG
AGCATAAAACGGGGTGTGGCCAGAAACCAGTAAAAAAATGAAATTGTGTTCCTGCAGAGA
TGCATGTAACCCCTGACCACTGTTGGGTGTGGTGACCTGAAAAAAAAAGTTGTGTTCTTG
AGTGGGTAAAGTAGGATGCTATGATGCTTAAACCACTACAGCTGTTAACTTTTGCTTGGA
AGTTTCCGCCTGGTCTTTTTGTTTCTTCGTACCGTACCTGGCAATGCTCAGGGGTTACTC
CTGGCTCAGTGCATGGGGACTGGTGCTGGTGATGGAATCCAGGATCCCTGCGTACAAAGC
TTTTGCACTACAATCTGTTGAGCTGTCTCTTCCGGGACAATCTACCTAATCTTTATAGGA
TTTAGATGAAATAGACTTAAGCTGGAACTTTTAGTCCTGGTTAAAAAATTAAACAAGCAA
AAACAACCCACCCAACTCCCAAAACGGCTCCCTCTTTATTTACCTCATCCTTCTCAATTT
CTGGCCATGACAGTTCTGTGTATGCCGAAATTGATGCTGAAGAAGAAAGAGCAAGGTGCA
GTTTCAATTCTCCCTTCAGACTCTTCCCCAGGATAATAGAGTGGATGGCCGGAGAAAGTA
CCAAGATTAAGGCATTTGCCTTGCACCTTGGATATGTGCATACATAACCTAACTCACCCC
CTCATGCCCTTAGTATTGCAGGGTCACGCCTGAGCACAGAGCCAGGAATAGATGCCACAA
CTGGGTGTGACTCAAAAACCAAAAAAGTTTTAAGAGAATAGAGAGGACCTGCAGAGAGCA
GTTTAGATGCATGCTTCATATCTGGTCAAACCTGGTTTAATCCCTGGCGACATGTGATCC
CCTGAGCACTACCTGGTCCCCTGAGCACTGCCAGATGTGGCCCCAAAACAAACCAAAAAA
ATACTGTATTGATTAATCCGAATTTACTTTTCTTCTTCTTTTTTTTTTTTTTGGTGTACC
AAAATTCTTTTTTAACTTTTCTTCTAATTGTAGACATTTGTGTTTCAAAATGTTGCTCAT
TTGGGCAGTGGGTAGCTGGTAAGGTGTTTGCCTTGCACATGGCCTACCCAGATCTGAACC
CTGCCATCCCATATGGTCCCCTGAGATCACCAGTAGTAATTCCTGAGTAACTCCTAAGCT
TGGCTGGGTGTGGTCCCTCCTGCTCCCTAACCCCAAATGTTGCTATTATAAGGATTACTA
CAGTGACTGTTTTTGCCATTCCAGTCTTTTTATGTTTTTATCTTATTTCTTATGGACATG
CTTATCACCTAAAGAAATTTTTATTTTTTAGATGGCATTCTGCAGCAGCCAATGAGATTA
TTGTCTGCCTCAATGGATAAAACCATGATTCTCTGGGCTCCAGACGAAGAGTCGGGTGTT
TGGCTAGAACAGGTGAAAATTTGGAAATTTTTTTTTTTAATTTGGAAATTTAAGAAACAG
AAAATTTGGTTTCACATCTAAATATTTTAATCCCAATTTTATATTCCTAGAGCTGAAATA
TTTTACTTTTTTGGGTATGTTTAGTAAGTGAAAATTTAATACCTAGACGGTTTCTGTTGT
TAAAAAAGCGGCTGTTAAGAATTGCTTTTTTTTTTGGCATAGGTTCGAGTAGGTGAAGTA
GGTGGAAATACTCTGGGATTTTATGATTGCCAGTTCAATGAAGATGGCTCCATGATCATT
GCTCATGCTTTTCATGGAGCTTTACATCTTTGGAAACAGAATGCAGTTAACCTGGTAAGA
CAAGCCCTTATATTTTATTTTTCGGTCTTTGGATCACTTCCAGTGGTGCTCAGGGATCAC
ATCTGGCAGTACTGGGGGACCGTAGATGCAGGGTCAGGATCGAACCAGAGTTGGCCACTT
ACAAGGCAAATGTCATTCCTGCTGTACTGTCTCTTCAGTCTCCAAAAAGGCCCTTTTAAA
TAAAATATTTCTTCTTTGTTATTAGGGCCACATCCAGTGGTACTTGGGGCCTACTCCTAA
CTCTGTGCTTAAGGATCACTCCTGGCAGGCTTGGGGGACCATATGTGTACTGGGAATCAA
ACCCCTATTGGCCACATGTGAGGCAAGGGTCTTGCCCTCTGTACTATCTCTCTAGCACCT
TAAATAAAACATTTCTGATCAAACTGGTAGTGCTGTTTTACTCAAATATAGTAGATGTTT
CTAAGTTTAAGTTACATCACTTTTTGTGCACATTATACTGTAATTATACAAGGTAGAAAC
TCATGCTTTTCTAAGAATAGAATTCACTTGTCTGGCATTGTTGAGATATTAAAAGTTGCA
CAGAGATCAATTTTCTATATGAATAAAATTTTGTTGTTGCTGTTTTTGACAATACCTGGT
GTTGCTCAGGGGTTACTCCTGGCTCTGTACCCAGGAATTAGTCTAGGTGGTACTCAGGGG
ACCATGTGGGATACAAGGGATCAAACCTCGGTCAGCCGTGTATAAGGCAAATGCCTTATC
TGCTCTACTTATTGCTTCGACCCCTCAGTTACATAAATATTACACTTTCCCTTTAAACCT
TGTAAGTTTTTTTTTTTTCTTTTTGGGTCACACCTGGCAATGCACAGGGGTTACTCCTGG
CTCTGCACTCAGGAATTCCTCCTGGCGGTGCTCAGGGGACCATATGGGATGCTGGGAATC
GAACCCGGGTTGGCCTCGAGCAAGGCAAACGCCCTACCCACAGTGCTATCGCTCCAGCCC
CAAACCTTGTAAGTTTTTGTTGAAAGTAACCTAAAACATATAATTCAACTTTTTAAAAGC
TAGCATAAATTGATAATCCACTTTTAATTTGATTTTTCTACTGTTGTTGTTATGACCACA
TCTGGTGGTACTTTGGCCACTCCCAGTGGTGCTGTTGCCATGTGGGACTGGTAACAAACC
CAGTGCCATGCCCCTGCCATATGTGTCCGCTACCACTTGAGCTGCATCCCTGCCCCAGGT
GCTGATGAGAGGGCATTAGGAGCATCTGTTATTTTGTAATGAAAAATATTGCCTTACTTG
GGTACTTTTTTGGTGTGGGGAGATTGGACCACATCTTGACTCTGTGTTCAGAGATTATTT
ATGGTGTGTTCAGCACACCATATGCAGTTCCAGGAATCAAACTGGGGTCAGCTTCATGAA
AGGAAAGCATCTTAACCTCTATAATCTCTCTCTCGTTCCTCTCAGTGGTTGTTAGTATCG
TCGTGCTAAATGGCGCCTCAAAAAATGGATGCCATTTTTTATTTTTCTTACAGTACTTGG
TTTCTTCTCAAAGAGGAAAGGTCTTCCTTGGTCATGTAGATACCTTTTGAGTAGTATTCT
GTTTCTTTTACTCAGTTGCTTCAGATCATCTGTTTCTTTGTTTGGGGGATGTGAGATACT
AAAAATAGACTAGCTAAGGAAACAGTCCCTAAACTGAGAAGACTGGGGCTGGTGGTAGTA
TGTGTGTCTATGGCTCTTACTCCTGGCTCTGCGCTCAGGGATCACTCCTGGCACTGCTCA
GGGGACCACATGGGTATACTAGACTTCAAACCCCACTCAGCCGTGTACAAGGCAAGTGCC
TTGCCTGCTATACTATGCTCTTGGGTGTGATTTTAAAAATCAAACCAACCCTACACTTTG
GGACCATTACAGTGGAAAACTCATAAGTCAAAGTGCTGCCCTTTGTTCAGAACTTTTTTT
AAATGTCTTTTTGTGCTAACCTTGGGATCACTTTTTATATCCCAGGGTAAATTAATAACA
TTCCTTTGTTAATAATTTTCAATAAGTTAAAAACTATTGGCCAGAAAATAATACAGTTTA
TTTTAACCACTTAACCACACTTAGCAGCCTTGGTTTTGAATTTTTTTTTTCTTTTTGGGT
CACACCCGGTGATGCTCAGGGGTCACTCCTGGCTCTGCACTCAGGAATTATCCGTGGCGG
TGCTCAGCGGACCATATGGGATGCTGGGAATCAAACCCCGGGTTGGCCTGCTGTGCTATT
GCTCCAGCCCCTGAATTTCTTTTTTTAAGCTATTTGTTTTTCTAATTTGACTTTCTTTTA
AAGGTGAAAAAAATTTTTTTTTGTTGCTTTTTTTGGGTTTTTGCTCAGGGTTTACTCCTG
GCTCTACACTGAGGGATCACTCTTGGTGTGACTCAGGACCATATGAGGTGCTGGACATTG
AACCTGGTTGTTTCTGAAAGCAAGAGCCTTACACACTGTGTTATTTCTCCAGTCCTAATG
ATGAAGTTTTGCTAATACTTACAGTTGTTTAAAAAGACACTTTGTTGGGTTTGAGCGCTA
GCACAGCTGGTAGGGTGTTTGCCTCGCACACAGCCAACCCGGGTTCGATTTCCAGCATCC
TGTATGGTCCCCTGAGCACCGTCAGGAATAATTTCTGAGTGCAGAGCCTGTGCATCACCG
GGTGTGACCCAAAAAAGAAAAAAAAAAGACGCTTTGTGGGCCAGACATATGACATTTTCC
CATTTCATTGTCAGTACAGAATATGCAGAGTATATTTGCCTGATTGCTGGTGAAGACTCC
CTTAGTGGGGGGTGAATGAGCTCGGGCTTATAAGGCATCTTTCCTGTATCCCTGCAGCTG
CCTCTGAAAGCTTTCTGGGAGCTGGAGGGATTGTACAGAGAATAATACATACATGCCTTG
CATGCAGCTGACCCCAGTTGAATCCTTGGCACCATATGTTTCACCAAGCATTGCTGGGTA
CAACCCTGAGGCCCTCCAGTATGGTCATTGTGTTCCAGGTAATCCTAGCACTGCAGCATA
TTCTCAGGCCTTTGCGTTGAACTTCTGGCCTGATTGGCCAAGGACTTGGCTTTAGCTCCC
AGGCTTCCTAAGAACCCTCAGCTTGGGAGGTCAAATAAAAAAGAGAGGCTGGAGCGATAG
CACAGAGGGTAGGGCGTTTGCCTTGCACTCGGCCAACCTGGTTTCAATTTCCAGCATCCC
ATATGGTCCCCTGTAGCACCGCCAGGGGTAATTCCTGAGTGCAGAGCCAAGAGTGACCCC
TGAGCATCGCCAGATGTGACCCAAAGAGCAAAAAAAGAAAGAAAGAAACAGAAAGAAAGC
AAGAGAGAAAGACAGAAAGAAAGATAGATAGAAAGAAAGACAGATAGACAGTAAGTAAGA
AAGAAAGAAAGAAAGAAGGAAGGAAGATCTTCGGGTATCTCTCAGAATCTTTTTTTTTTT
TTTTCTTTTTGGGTCACACCTGGCGATGCACAGGGGTTACTCCTGGCTCTGCACTCAGGA
ATTACCCCTGGCCGTGCTCAGGGGACCATATGGGATGCTGGGATTTGAACCCAGGTCGGC
CGCGTGCAAGGCAAACGCCCTACCCGCTGTGCTATCTCTCCAGCCCCATCTCTCAGAATC
TTGTAACTCATTGAATAATTTTTTGTTTTGTTTTGGTATTGGGGATTGAAGCTAGGGTCT
TATACATGGGAAGTAGGAACTCAGACCTGAGAGACATCCCCTAACAAATAAATACAGCAT
ATATGATACCATGTACCTTGTATATACTTATCATTCTTTGTGGTTTCCAAATTGAAAAAT
CATTTATTTTTTTACCTTGACCATATGAGCTTGGTCTGAACCTTTTCTTAAGGTTATTTG
GGGTACAGTAAAGTTAAATGTCTTTAATAAAGTTAAAGTTCTCGGAGGCATTTGGTAAGT
GATAGATGGAGGTGAATTACAGTTACTGTTTTAAAGGATGTGACTATTGAATGCATAAGT
TCTAATATGCTTGATTCTCTTTTTTTTTTAATTTTTATTAATTTATTAATTTACACGGTA
AATTATTTTCGTAATCTTTTTTTTTTTAATTTATTTTATTGAATCACCAAGTGGAAAGTT
ACAAAGTTCTCAGGCTTATATCTCAGTTACACAATGCTCAAACACCCATCCCTTAACCAG
TGCCCATATTCCACCACCAATAAAAATAAAAACAAAAGCAAAAACAAAACAGACAAACAA
ACAAAAGAAAAAAAAAGACAGTAAACATCCCACCCCTCATCCCCCAACCCACCCCGTAGG
TGAGTGATAATTTCACTTCCTTTTCACTTTACCTTGATTACATTCCAGATTTCAACACAT
AACTCACTATTGTTGTTAGAGTTTCAAAACGGACTCACTATTTTTGTTGGAATTTATCCC
CTAAGAATACAGCTCTATTAATAGGGAAATATTTGATAGTAAGTTTTCCATTGATGAGAA
TGAAGAGATAAAATGTCTACTGCGGCCGCGCGGTTTACAATTTCTATATTATAGTAATTA
AGTCTGCGAAGATTTAAGTTTGAAAATGAATCATTTCTCTTCCTGGAACAGCAGTAGCCA
AAGTTAGTTCACAGTCTCCATACATGGGTGCAAGCACTTGCTGGAACCCCAATTCCTAAA
GCTGTCTCTGGTTCCCGCTTGTTCCACATCCACCGGCTCTGCAGGGGCATGGGCGCCTGG
GCCGAAAACCCGGCCGGCCAGAGCCGAGCACGGGCCCCGACTGGGGCTGGCCCTGTATCC
CGCGGCTGTTTTAAGTTCAAAGCACACATTTTTTTTTTTTTCCGTGCCAAAGTTCATACC
TTCTCAACGGACCCCCAAAATGTCGGACACCACGCCTTCTCCCGGAGGGGAGAGAGACCA
AGAAGGAAGGTTATTTCCTCCGTTAGCCGGCGTGGGGCAAAAGCTTAGTTCACAGTCTCC
ATACATGGGTGCATATGCTTGATTCTCTTAATAATTCTCTTTATAAATGGGTTCTCTTAT
TTTAAGATCTGGTCTTGGATACTTAGCTTATTACTGTGCTTGGGTCCTTTAATCTTTCCC
ATTATCTGATTGGACAGCTGGGGGCATTATCAGACTTTCTTTTGAGTGATGATGGTCATT
GATTATTTTGATGTGTTATGGACACTTTCATTGCAGAGAGAGTGGACTCCAGAGATTGTC
ATTTCAGGACACTTTGATGGTGTCCAAGATCTAATATGGGATCCAGAAGGAGAATTTATC
ATCACTGTTGGTACTGACCAAACTACGCGACTTTTTGCTCCATGGAAAAGGAGAGACCAG
TCACAGGTAAAATGTCTTTCTGTTTAACTGAAATAGGTAAAAGGGGAAAAAAAAATCCTT
GAGCACATGAAAATTAAGAGCACCATTGTTAGCACCATTTTTTTTTTCTTTTTGGGTCAC
ACCTGGCGATGCACAGGAGTTATTCCTGGCTTTGCACTCAGGAATTACTCCTGGAGGTGC
TCAGGAGACCATATCGGATGCTGGGAATCGAACCCAAGTTGACCGAGTGCAAGGCAAACG
CCCTGCCTGCTGTGCTATCGCTCCAGTCCCATTGTTAGCACCATTGTTAGCTCTTAGGAA
AATGCTAATTGAAGCTGTCAGAATAATTGTGTTTTTAATCTAAAATAGAAATAGAATAAT
ACTGTGAATAGTATAGCAGTTGTTGGTAAGGGTGCAGAGCAGCTATACCTTTTTATTATT
ATTATTATTGTATGGACCGTATATCCACTTTGAAAAACAGTTCTGCATTTTCTCAGAAAG
CTTAGATCATACATACTCTAAAATTCTAAGAATTAGGATGTAATTAAATACCTCAGTTTA
GATGAAGGGTTGTGTTTTATAATTTTAGGCTTAATCCATAAGAAGCACTGTCAAGGGGTT
GAAGCAAAAGTACAGCAGATAGGGCGCTTGTCTTGCATAAGGCCACTGAGGGATCAGTCC
CTGGCATCCCATTGCATATGGTCCCTTGGACACTAGTAGGAGTGATCCTGAGTGCAGAGC
CAGGAGTAAACTGTGAGCACTGCCAGGTGTGCCCCTGCTCATCCACACCCACCCGAAAAA
GAAGTACTATCAAATATGGAGTAAAGCTAATTTTTAATTTCATAGTGTTATATATCATTG
TAGTTGAGAGGATTTCTTTTTGGAAAAACTTATGTCTTGGTCCTGACCTCAAAAAAATGC
ACTAAGATTTTATTATACTACTATTGCAAAGCTATTAAATTGCTGTATGGTAGAGTCAGT
CTACTCAGCTTTATTATTTTTTATTTGTTTTTGGTTGAGGGTCATATTTGGCTTTACTCA
GGGCTTACTCTTGGCTCTGTGCTCAGGAATTTCTCTTGGCAGGGCTCAGGGGACCATATG
TGGTACTGGAGATTGAACCCAGGTCACCTGTGTGCAAGGCAAGTGCCTTATTTGCTGCAC
TATCTCTATGACTCCCTCAGCTTTAATTTTTGACAAATTTTCAGTCCCTGAGACCTAATA
AAGTTTGCTATCTTAATAAAACATGGTAGATGACATTAATGTTGGAAAGATAAATAACCA
ATTTAAAAATATGGCAAAGGACTTAGAGTAATTTTCTTTGACTCTTCATGATCTTTTGCT
GAAAATACCGAAAAACTATTTAAGCAACACACAGTTTCTTTTTGAAAGGCATGTCAGGAA
AATGAAAAAACAAGTCACAAACTGAATTTAAAAGAACTTAAAAGAACTCAATATCCAGAA
TATTTTCAGAACTCAAGACAAACACAATAAAAGTGGACAAAATATTTAAGTAAATACTTC
TTAAAGGAGGATATATGGAGGCCAGAGAAATAGTACATGGATTAAAGCACTTGCCTTGCA
CATTGATGATCCCAGTTTGATCTCAGACACTACTTATGGTCCCTTAAGCACTACCAGGAG
TGACCCATGAGCACCCCTGAACTTAGTCCCTCACTTAAATACCCACCACCAACAAAAAAG
GTATATAGCTAGCAAAAGAAGAAAGGAAAAGATTCTTTGGGCTGGAGACAAAGTACAGGC
ACTAAGGTGCTTGCCTTGTATATTACTGACCCTGATTGGATTCCTGTCACTGAGCACACT
AAGGGTCACTCTTGAGCACTGTCGGGTGTGACACAACCCTCCCATTTCTAACTCTGTGCA
GAAAGCAACAGAGATTCTCCAGACCATCAGTCATTGGGGGAATGCAAATTAAGGGTGCAA
TGTGACACCATTACCAACCTGTTAGAATAATTGTAGTTAGACTGCTATATCAAGTGAGTG
TGTGCATTACTGGAATTCTCACACTGCTGGTATGATTTCAAAACAGTGCAACTGCCTTGG
AAAATAATTTGGCAGTCTCTAAAAGATTGTGTATACTGGACCTTTTTAGTCTTTTAACAC
TCCAAAGCAAAGCAAAAACTGGAGAGCTAACTTATAGGGCTGGAGCTCATGTTTTGCATA
CAGAGAGCGTGGGTTTGATCCGTGGTACTGCATGGCCCTCCAAGCACTGCTAGGAGTAGC
CCCCAACTCTGTTGGATATAGGCCCCCCCCAAAAAATGATTCTTAATATACTGGACCCAA
AGATAATTCAGTGGTAGAGCCCAACTGCCATATAGGCTTGAGAACATAAGATCCCTTAAA
CAACCCATATAATCATTCCAGATGTGATCCTGGTGGCACAAGTGTGTAATCTCCACATCA
CATAATCAAGTGTCTGCTACCCCTCAGTCATCACAGCAACAAAGGGAAGCGAAGGGAGAT
AATTTTCACATTGATATCTGCAACTCACCCAGCCATTCTTCTCATAGGTAGTAATTTACT
TGAGACATAGAAACGCGCGCGCGCGCACACACACACAGACACACACAGACTTGTATACTG
ATATTCATAACTGCTTACTTCAGTGAGAGCCAGAAGCCATAAGCAACTCAAACATCAGTC
AGTGGGTGATTGTATATTGTATATCCATTCAAAGGAATAATACATGAATTCAGCTTGTTG
TACTTCTGTTGTTGTTTATCCATTCAAGGGAATAAGACACGAATGTGGCTGCAGCCTTGA
CAGGGTTCGAATCCTCACATTGCATCTGCTCTGCTGAGCACCACCAGGAACGCCCCTGAG
TACAGCCAGTGCATGCCCCCACCCTTGAAAAAAAATTCCAAGGATTAATATTGTTCATAA
AAAGACTTGAATGCAGCATATGTGAATCTGCCTTGTAGTTGTAATTCCATAACATAATTT
GTGTCCAGTAGTTTTGCTTGTTGAAAAGAATTTGGTTTTTGAAATTAGGTCATTTTTATT
TGTGCTGTTTTAATACCTAGGTGACATGGCATGAAATTGCAAGACCTCAGATACATGGAT
ATGATCTGAAATGTTTGGCAATGATTAATCGATTTCAGTTCGTATCTGGAGCAGATGAGA
AGGTTCTTCGTGTGTTTTCTGCACCTCGAAATTTTGTGGAAAATTTTTGTGCCATTACTA
ACCAGTCATTGAGTCATGTGCTTTGTGATGTGAGTATCTTTCTAAACACTTTAATAAGTT
GTTTCATTTTAAATTTTTTAATGTTTGACAAGTCTATAGAGTATATGGATATAAAGGAAG
TCAGACCATTTATCCTCAGCTTGGCACACTTGTGTGCACTTTGATGTATGGTAATTTAAC
ATTAAAATGAAAGCTTTTTTAAGAAACATGTTGTGTAGTAGGTGGGGTTAGAGAGTACTT
AGCATGCCATGGTTCTAGAATGGTAATATGGGCAGAACGTCACATAAGGTAGCCTTTAAG
CTGCTTCCAAGCATTTCTGAGCATCTGGAAGGGGGAGGGGCACCCCTGCAATGCTCAGAG
CTTACTCTTGGTTCTTTGCTTAGGAATCACTCCTGATTGTACTTGGGGGACAATGTGTGG
TACCCTGGTCAGCTCTGTGCAAGGCAAACACCCTACCCATGTACTGTTGCTACATTGAGC
ACGTTTTTTTTTTTTTTTAACTTTTTGGGTCACACCCGGCGATGCACAGGGGTTACTCCT
GGCTCTGCACTCAGGAATTCCCCCTGGCGGTGCTCAGGGGACCATATGGGATGCTGGGAA
TCGAACCCGGGTCGGCCGCGTGCAAGGCAAACACCCTACCCGCTGTGCTATTACTCCAGC
CCCACATTGAGCACATTTTTATTTCTTTTTTATTTGTGTGTGTGTGTGTGTGCGCGCACG
TGCTTTCTTGGGTCACAGTGATGCTTGGGTTTATGCCTGACTCTCTGCTCAGGAATTATT
TCTGGCAGGGCTTGAGTGGATGGTATAAGATGCCAGTATTGAACCTGGGTTGGCCTCTAA
AAGGCAAATTCTCTACCCATATTACTATTGCTGTGGCCCCAAGCACTTTTTTTTTTGTTT
TGTTTTCGGGTCATACCAAGCGCACAGGGGTTGCTTCTGGCTCTACAATCAGGAATTACT
CCTGGCGGTGCTGGGGGACCACATGGGATGCTGGGAATCGAACCCGGGTCGGCCTCGTGC
AAGGCAAACGCCCTACCCTCTGTGCTATCATACCAGCCCCCCCCAGCACAATTTTATAGT
GCCTGAGATAACAGGTAACTTTCAACATTTGTAGTTTTTTGTTTTTGGCTGCTCAGATCT
TACTCCTGGCTCTGCACTCAGGGATCATCTTGGCAGTAGTCAGGCTCAGGGGACCATTTA
GGTAACTGGGGATAGAACCTGGGTTAGCCACATGCAAGGCAAGCACCCTATCCACTGCAC
TGTTTCTCCAGCCTCAGCATTTAGAATATTATGTCGTATCTTTTTTTCTCCGTTTTTTGT
TTGGGGGCTACACCTGGTAGTAGTCAGGAGTTACTCCTGACTATGAACTCAGGAATAATG
ACTGGCAGTGCTCCAGGGTACCATATGGGATGCTGGGGATCAAACTCTGCTAGGCCCCAT
GCAAGACCTGCACCCTACCTGCTGTCCAGACTCTCCAGCCACAATGTCATACTTTTTATT
CCAGCAAGATGGTGATCTTCCAGAAGGAGCAACTGTCCCTGCTTTGGGTTTATCAAATAA
AGCTGTATTTCAAGGTAAGGCTTTAGTCTCCAAATTATTGAACTCACAGTGGTACCTAAC
ATCTAGTTATGTGCACATTTGCGTAATGTTACAATATTTATTAAAATAATTGCTATAGTA
TTACAATTATAAAATAATTGTCATAATAATGTTACAATAATTGTTACAGTTGTTACTTTA
AAATTATTATATGCATCTATTTTCTTCATCAATTATTTTATTATAACTACTATATAAATG
CAGTTTTTGCCAAACTTGTGTCATGAAATTATACAACTACAGAAACTAATGTTGGTGACC
TGAGAAGTCTTAGTTGAAAGTTTGGAAAACTGGGGTCGGAGATACAGTACAGTGGGTAAG
GCATGTGCTGTGCACACAGCTGACCCAGATTCAATAACCAGCATCCCACATGTTCTCTGG
AGCCTTCCAGTAGTGATTTCTGAGCACAGAGCCAGGAGTAAACTTGAGCATCGCCAGGNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCACCAAAACTTCCACCCCTCA
ACCCCCCCCCCCCCCCCCGCCACACACACACAAACAAGTCTGGAAAACAGGCTTGCTCTT
CAACCCCATGTTCCCCCCTTGAACAAACACATATGTATCCCACTTGCTTGTTCTGCCTGC
TTGTTTTTTCTACTCTGGAGAAGCCAATGTTCTCTCTTGAACACATACTTCCTCTCATTC
TCTCCTATCACATTTTATTTAGCTTTTTGGGTCACACCCAGCGGTGCTCAGGGGTTACTC
CTGGCTCTGCACTCAGGAATTACTCCTGGCAGTGCTCCGGGGACCATATGGGATGCTGAG
AATTGAACCTGGGTCTTTTTGGAATTAGCTCATGCTTTAGAGAGCACTTTGGGGATGCGA
GATCTTTGAGCCACATGACATTGTTCAGGAGCTATCCCTGACTCTCTTAAAGGTGACCCT
GGATGTGCTCAGGGGATGAAATTTGGTGCTGGGATCAGCTGCAGGGCAAGAGTTTTACCT
GCCCTCTTTCTCTGGCCCCATAGGAAGCACATTTAGAAAATACTTGATTTGGGGGCCGGA
GCGATAGCACAGCGGGTAGGGCGTTTGCCTTGCACGAGGCCGACCCGGGTTCGATCCCCG
GCATCCCATATGGTCCCCCAAGTACCGCCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNGATTTTTAATTTTAACTGCCTTTTCATCAGTATTCACCATCAAAGCTCCCTTTGATCT
ATGCTTATGATGCTGGTTGGCTGGCATTGAAAATTAATCTAGTTGAACTGTAATACTTCC
CAAAAGTGCACTTTTAAAAGTTGTAGTCTCTTTTTTCCCAAAAAATCTTTGCCCTAGACT
GAAATGTAGTTTCCTTAAAAAAACTTACTACAGATTACTAAGGGGTAGATACTGTCCTTT
TCACATTTTAAGATTTTGCGGTTTAAGGTGGTTAGCTATATTTAATTTGTTAATTTTTAT
TTCCTCTTTTTAAATTTTAGATATGGCCATGGTTATGAAATATTTTGTGTTACTTGTAAT
AGTTCAAAGACTCTGCTTGCCTCAGCTTGTAAGGTAGGAAATTTTATTTTTACTCATTTG
GTCTTAGGTTATTAAGTGATCAGACTCTGTAAATTGGTAGTGATTTAGGCCAGTGATCTC
CAGCCACTGGTCTACAGCCTAGTGTTGGTCTATGACTGTGAAAAGGTTGAAAACCACTGG
TTAATCACCTGGGTTATAACTGTTGGTCCATGGGTGGTATGTAGGCAGATGTTGGCCCCC
AGGTATTAAACGTTGAAGACCTTGATTAAGAATGCACAGCAGGATGGGGCCGGAGCGATA
GCACAGCGGGTAGGGCGTTTGCCTTGCACGCGGCCGACCCGGGTTCGATCCCCGGCATCC
CATATGGTCCCCCAAGCACTGCTAGGAGTAATTCCTGAGTGCAAAGCCAGGAGTAACCCC
TGAGCATCGCTGGGTGTGACCCAAAAAGCAAAAAAAAAAAAACAAACAAAAAAAAAAAAA
GAATGCACAGCAGGAAAGGATACTGGTAATCCCTGCTTTTTCTGGGTCTTGTTTTCTTAA
TCTCTTTTTCCTTTTGACTCTTTAAAATCTTTTATTTATTTATTTTTTTGCTTTTTGGGT
CTCACCTGGCGATGCACAGGGGTTACTCCTGGCTTTGCACTCAGGAGTTACTCCTGGCGG
TGCTCAGGGGACCATATGGGATACTGGGGATCAAACCCGGTTCGGCCGCGTGCAAGGCAA
ACACGCGCTACCCGCGTGCAAGGCAAACACCCTACCCGCTGTGTTATCACTNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTGGTTTGGGTTTTATTTTTTCTTTTGTGG
GGTGTGTGTGTGTTTGTGTATGTGGCCCTCTGATGTGGAGAGAGAGAGAGAGTGAGAGAG
AGAGAGAGAGTGTGTCTTATGGATTGATCCCAGGTTCTTGAACATGTGAGAGACATGCCT
TCTGCCTTTGAGCTATATCCCAGCCCTGTGATTGCATTTTAATTCTGTTATGTTGGTAAC
ATGTTGATGTTAAGTAGTTTGGGTCACATTCCCTACTCTCAGTTTACTGAAATTTTATTT
CAAACTTTATGCTTAGTATGTGAGAGATGTTTAGATGTTTACATGTGTAGTTTTCTTTCT
GGATAATGGTCTTGCCTGGTTTTTGCATCATGGTAATGCTAGCCTAAAGATATATTGTCT
TTTCCTTCATTTTTTGGAAATGAAAATTTAGAATTTCCATTTGGAATTTGGAAATTTGTA
TAGAGTTATTGTTATTTCTTCTTTAAATATTTTAATTTCCTAGTGAAGTCAATTAATTGA
CTCCAGCATTTCCTTTGTGAAAGGTTTTTTAACTATAAATGTAATTTCTTTGATTGATAC
AAGGTTATTTATATTACCCAGTTTTTCTTGAGTGCAAGTAGGTAGTTTTTATTTTTTCAG
TAAATTTTCTTTTACCTGAGTTATCAAATTTGTTGACATGAAGTTATTGTAATATTCCCT
ATCTTTCAATATCTGAAAACTCCTGTGATGTTACCTTTCTGATTTCTATGATTGTCAATT
TATATATATCTTCTCTTTCGTATTTTTTGCTTTTTTAGTTAAAAAGATTTGGTAGAAGAA
CATTCTGGGAATTAATCAGAAATTTAATGATTTTATTGATTTTTAAAAGAGCCAAAGACT
ATTTTTGGTTTGTTTGTTTGTGTCGGGTGACACCCAACAGTACTCAGGGATCACTTAAGG
GGGCCCATATGAGGTGCCGGGGATTAAACCTGGGGATNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNTGATATTTTTAAAGCTTCCCCCTCTCCCCCAAGTTTATTTTCA
TTTAAATTGTTCTGCCATTTTCTCTCTGCCCTGCGGGCATCTAAGAAGAACATGCAGCAA
TCATTCTTTGGAACACAACATCTTGGAAACAGGTGCAGAGTTTAATTTTCCACAGTTTGA
CTGTTACACAGATGGCATTCTCTCCTAATGACAAGTTCTTCCTGGCCGTTTCCAGAGATC
GAACCTGGTCACTTTGGAAAAGGCAAGACACAGTCTCACCAGGTAGACCTGCTTTTCTCT
TTTAAAATGGTCCATTTAAGAGGCTGGAGCGATAGCACAGCAAGTAGGGCATTTGCTTTG
TACGCAGCTGACCCGGGTTCAATTCCCAGCATCCCATATTGTTTCCTGAGCACTGCCAGC
AGTGATTTCTGAGTGTAGAGCCTGGAGTAACCCCTGAGCATCGCCGGGTGTGACCCGAAA
AGCAAACGCAAAAAAAAAAAAAAGAATAAAATGGTCCATTTGAAAGCTCCCATGGTTCCT
AGGGAACCCTGCAGTGTTGGAAATCAAACTCAGGGACCTATATGTGCTAGGCAAGTCTGC
TCTGTCACTTAGGTGTCTCCTCAATCCGGGTAAAGCAGTAAAGCAACTTTGGGAGTTTTG
TTTTGTTTGGGGGGGTCACACCCAGTGATGCTCAGGGCTTCCTCCTGGCTCCCTACTCAG
GCATCACTCCTATTGGTGCTCAGGGACCATACATCATCAAGGATAGAACTGGGGTTGACT
GCATGTAAGATAAGCACCTTAACAGCTGTCCTCTCTGTCTGGCCCTACTGTTTTGTTTGT
TGGTTTTTGAGCCACACTCCACAGTGCTCAGGGCTTTCTCCTGGCTCTGTGCTTAGGAAT
CACACTTGGCAAGCTCAAGGGTGCCAGGGATCTAACTCTGGTTGGNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNCCGATGAGTGACGCACAGCCAACCGATGGAGGAGGGCGAACCGG
GGCCCTGGGATGGTTGGCAGTCAGTTTATTTTCTTTATCCTTCCCAGCATCGTCCAATCT
CTCCCTTTACCATGCAGTCGTAGTCGTCATTTTGGCCGTAGTACCAGTCATCAGAGTTGC
ATTATCTTAGTTTCCTCAGACCTCAAAGTCTCCAAAGTCTCAGTTCTCCTCATTTTCAAC
GTCTCATCATTGACCTTCTCGTCCTCAATATCTAGTCCTCAGGTCTAGTTTTCAATATCT
AGTCTTCAGCGTCTAGTCTTCATCTCCCTCTCAGCATCTCCTTCCCACAGTCCAGTCTAC
CTCCTACAAGTCTTTCTCTGCCAGTCTACAAGTCTCTCTGCCAGCCACAAGACTTCTGCT
AGCCTAGTGCCCATAGGGTGGGGATAAAAGATGGGGTTGAACATTATCATAACAACAAAG
AGAGATAAAGGCCACTGCTTCAGGAGATTAACTCAAGGACAAAATCTCATCTAAGGAGAT
TACTCAAGATTACTAGGAGATCCACCCAAGGGCAGGATTTCATCTGGGTGTATTGCTGTC
TTCTTTCCTCAGCTAGTAATCCATTTAAATAGTTATGGTAAATTTACTTCTTGTAATATT
TCTAGCAATATCATTTTATATGAGCACAGTAAGAGATATATTAAACTTAAAGTTTGGCTC
TTCCTGGGGACATCTCACTACATATTCCAGACCACAGTCCTCAGGCCAAGTTAATCTTTC
CTAACCCCAGCAGGGTCCTTATTCAGTTACCTCTCTTTGGGTCATGACAGAATTTGTCCA
TGACCACCGTGCTCTTATAGTTAAGTATTATGGCACTTGGCCTGGCCCATTTTGATGCCA
GGGTAGCTCACGGCTTGCCCTGGGCCCATCAGACCCTACTCTTGGAGTGGTAGAAACTAG
GGCAACTGAAGGTTAAGTCAAATAAATATGGATGCCCAGGAGTAAACATTATTTATTTAT
TTATTTATTTAACTTTTTGGGTCACACCCGGCAATGCATAGGGGTCACTCCTGGCTCTGC
ACTCAGGAATCACCTCTGGTGGTAGTCAGGGGACCATATGGGATTCTGGAAATTGAACCC
AGGTTGGCCGCATGCAAGGCAAACGCCCTACCCGCTGTGCTATCGCTCCAGCCCCAGGAG
TAAGCATTATTTTGGAGTCAGTTAACTCCCTGTTACATAGTATAGCATCAACTATCTTCC
TGCATCTATTAAAAAAAGGACTTTGTTAAATAAACCATACAAATGACATAAAGGAAAGAG
AAAAGCAATTACTATTAGTGCCTGATATTAGTGCACACCTCAGTTGCACTGTTGTGGGAG
TGGCTCAACAAACCTTAAGCTCCCTGTGGAGAGCAGCAAGGACAACCAGTGTTTTCCAAC
CGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAGATTGGCTGCTTT
TTTAAGGCCAGTGCCTTAACCTCTGTACACACTCTCCAGTGCACAAGAAAAGGACCTGGG
ACGTTTTTCTTTTTTTTTTTTTTTAAGACATATTAATCCTTTTTTTTTATAACCTAATAT
ATGCAATGGGCAACTTAAAGGTTAAATTGCTTCAGACTACTTATGTAGGCATCAAACTGT
AGAGTATCTAATTAGGGGCTGGAGTGATAGCACAGCGGGTAGGGCATTTGCCTTGCACGC
GGACGACCCACGTTCGATTCCCAGCATCCCATATGGTCCCCTGAGCATTGCCAGGGGTAC
TTCTGAGTGCAGAGCCAGGAGTTGCCCCTGTGCATTGCTGGGTATGACCCAAAAAAGAAA
AAAAAAAGTATCTAGTTAGTGTAAAAATATCCCTTATTAGAAAAGTCAGTGTATGCCTTC
TGGTGTGGAATGAACTGCCTACCCTGAGTCTGATGCACAGCTCAGCATGTAGAGGGGCCC
AGGTGATAGTGCAGCAGGTAGGGAGTTTGCCTTGCACATGACCGACCGGGTTGGGCTCTT
GGCACTCCATTTTGTTTCCTGAGCACCGCTGGGTATGGCCCCCAAACAAAAAAGTACAAA
GAAAATTCAGCACGTGTAGATTACTAGATCTATGTTTGTAGTATTTTCAGAAGACTTTCT
AATAGGTAAACACCAGTTTTCTTTGTGAGTGTGGTGTATATTGTTTCTTTCAGACCCAGT
TTTCAGTCTCTTTGCCTTCACCAACAAAGTCACTGCAGTGCACAGTAGAATAATTTGGTC
TTGTGATTGGACTCCTGACAGCAAGTATTTCTTCACTGGGAGTCGGGACAAAAAGGTAAT
TTTTCAAAGCTTAAGATCATATTTTTATAGATATGCTGTATAAAAGAGCACAGTACCATG
ACTTTCTAAAATAACCTTTAAAATCAGTTCATGCATTATTTTACTCTTTTTTCCACATGC
AAGCAAAAAAGGTCTTCTCTGATTAATTCCATAAATTCAGTTTTTTATGGAGNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNCCTGTGGGAGCAGCAAGGACAACCAGTGTTTCCAACGGTTCTGCATTTCT
CAGTGTCTTTTTTTTTTTTTTAAGTTTGTTCACCCTTTCTTTGGCTACTCAGTCCTTTCA
GGCCTGAGCTTCTGAGCTTCCAGGGCAACCTCTTTTTGTTTTGGGGCCACATCTGGCAGT
GCTCAGGGATCACTCCTACTTATGCTTAGGATACCATGTATGTTGCCGGGGATCAAGCCT
AGTCTGGCTATGTGTGAGTCAAGTGCCTTACTCACTGTACTCTCTGGCTCCACAGTCTCG
TTTTCTAATGAAGGGCATCATTAGGGTTAGGTCGTCTGGACAGATGGGTGGTAGAAAGAG
CCTTGAATGTGATTATTTGCCATCTTTGAGGGTGGTAACTTCATGGGGACGTGCCTGAAC
TCCTCAACAAGGACCATTAACTCGGAGGATTGGAACTGCTGAATGGGAATTGGTAGACAT
CCTTTTATTCTGTGTGGGAACGCCTGTCTTTGGGCCAGCACTTTTAGGTTGTTGAGCTCT
CTAATACCTGTGGTGGGGTGTGGCTCTATGCGGCTCTCTGTGGGGTTGGAAATGCTCTGT
AATCCTAAAACATTTGCAAATGGAATTGTGTCTTTCTTGTTAAATTTTTTTCTGCATAAC
TTATGCCTTTGAAACTGTGATGCATTTCTAGAAACTTTACCATAAAAGACTTCTAAAGTT
TTGTCTCTGTTAGGTGGTGGCTTGGGGTCCATGTGACCCTAACGATGACTCCGTGGAGCA
CAACATCGGACCCTGCTCTTCTGTCCTGGACGTGGGTGGGGCTGTGACGGCTGTCAGTGT
GTGCCCAGTGCTGAGCCCTGCTCAACGGTCAGTCTACTGGGCCTGGGTTTTTGTTTTTTC
TCTTCTTGGTTTTTGGGCCACACCTAGAGGTACTCAGGGCTTACTCCTGCTCTGTGCTCA
GGGATTAATCCTGGTGGGGCTGGGGGATTCTCCTGTGGTGTCAGGGATCCGACCGACCCC
ATTTAGCCATGTGCAAGGCAAGCACCCTACCTGCTATACTATCTCTGGCCCCCAAATATT
TCATAATATTCTTCTCATACAGTGCTTTGAGTTGGGGCCTGGCCTGAGATGGCTCAAAGG
GCGGGTGCACATGCTGGTGTGCAGAGGCTCTCAGTCCACTGCCCGGCACTGCGTGCTCAC
TCCAGGGCACTGAGCCCACTGCCCAGCAGGGCAGGATCCCTCTGGTTCTGTCAGGTCAGA
GCAGCACTAGGTCAGGTATCAGTGGTAGTGGCCTGGAGGACCCCCTTGAGCTCTGCTTGG
GAGTCTCCACTGTCCCCCAAAGAGAAAAATTTGAAATTGATAGATGTTCAGTGGTGAAGC
AGAGTTGGGAGTGTGGACCAGCAGTTCCTGTCTCACCAGTCCAGGTCCGAGGTGTTTCCT
CTGTGACCTCACAGTGGTCCACCCTGCTGTAGCCAGCCAGGGAAGCACAGGCTTTGCTCG
CAGAGGACAGAGGTGCAACCGTTTGTGACCCCCTGAGGGAGAGGAGGTCCCTGGAGGACT
GTAGAGTCAGCAGTGTGTGTCTCCGAGGCTGGCATTTTTAGTCTTTTGTAAGACGGAGGC
AGTTAGGAACATGAAGAACTCTGTCTACCCGTTTGCCTGTGTCATTAGGGCTCCCAAGCA
GAGCTCATGGGACCCAGGGGTCACTCCTGGTATACTCAGCCAGCAAGGCCACATGGGTTC
CACACTAAGACTCCAAGAAATTGCAGCTTGCTCAGGCCCTGTGGTGATGGAGACTCGAGG
GCCATTGCAGCAGTGATAGGTTCCTCCAGGGGCTACATCTTGGGGATCATTTGTCCTTTG
CTATGTCCTGACCCCTGTTTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NGGTCACACCCCATGATGCACAGGGTGCATGGCTCATGCACTCAGGAATCACTCCTGGTG
GTGTTCAGGGGACCATATGGGATGCTGGGAGTTGAACCCAGGTCGGCCGCGTGCAAGGCA
AATGCCATACCCGCTGAGCTGTCACTCCAGCTCTGCAGACAAGTTTTTTTAATTTGTCTT
TTCCCTATTTTATAATGGTCATAATGACATAGCAAAAAGGTTTATAAGGAAACTGCCTTC
TAGACTGACTCCCCCAAATTTGTATCTTCTAAGTATCATGAAATAGTATGTTAGGCTCAA
AGAATAATAGCAAAAAAAGGGAAAAAGAAAAGGATGAAAACCCTATCACCGTAGGGACCA
GATTGATAATGGGTGTTTGACTTGCATGTGGCAGAATTACCTTACCCACATCCAACATGG
TTCCCTAAGCTTGGAGTAATTTCTGAGTGCAGAGCCAGGAGTAACCCCTGAGCATTGCTG
GGTGTGACCCCAAACCAAAAAACAGTCTGCCACTTTATTTATTTTTAATTTTTTAATTTT
TTTGCTTTTTTTTGGGGGGGGGGGTCACACCTAGTGATGCACAGGGTTCACTCCTGGCTC
TGCACTCAGGAATTACCCCTGGTGGTGCTCAGGGGACCATATGGGATGCCGAGAATTGAA
CCTGGGTCGGCTGCGTGCAAGGCAAATGCCCTACCCGCTGTGCTATCGCTCCAGCCCCAA
GCCTGGCACTTTATAGCTTATGTAGCCAAATAAGTACTTCCCCCAACTCCCTCTGCCCAA
TGTGGTTTTCAGCCAAGCGCACAAGGCTGCTGCTCATGCCATGAGTGTGGGGGTATCCGG
CACCCCCAGTGGTGCTGGGTGTCCTCAGCTGTACCGGCAGTGCTTGGGGGACCTTATGCT
CAGAATCAATCCTGCGTGCACCGTAATCACTCTACTGTTGGTCCCAACAATGGTTCATTT
AAGACTTTTTTGGCTTCATGATAGGGTAAAGGCAATAAATATTCATAGGAACGTACTTCA
ACTCTTGAGTGGGAGCATTCTGTTTTTCACTTTTAGTACAGCATTCAGTGAATGACATGA
GATAATCAACGCTTTATTATAATAAAATAGACTTTTTGTTAGATAACTTTACCCAAATAT
AGGGTAATGCAAGTGTTTTAAGAACATTCTGGCTTAGAACTTGGGCTTGGCTAAGCGACA
TTTTGTAGGTTAGATGTACTGAGTACTTAAAAGGTTTTCTTTTTATTTGCTTAATATTTA
TTTGCAGTATTATGACTTTCAGGGATTTAGCTTTACATCTCTGAGTATTTGTGATTATTC
TGCCATCCACCACCAAAAAAGACCTCTCTGCTTCTTCCTCTTGTCTGTTTCCCCTTGCAC
TCAGCTAACAACCATAGTTTCCTTTATTCTAGGAATTACTTTTATTAAACATATTTTTGT
TTGATTTTTTGGTTTGGGGGTCATACCCAGCAATGCTCAGAGGCTACTTCTGGCTTTGCA
CTTTAAGAATTACTCTTGGCAGACTATATGGGACGCTGCGGATTGAACCCACATCTGATG
TATGCAAGGCACCCTACATGCTGTGCTATCTCTCCAGCCCCTAATTTGACAGTTTTAAGT
ATTTAGGTTAAGTTGTTTCCAGGGTTAAAATTGCTAAAATATTTGTGTCATTTTTGAAAA
TTTGAACTTCTTGGGGGTTGTTTGACTTTTAGTTTGGTTAGTAGCAGTAGTGAGATTAAT
TAAATAAATACATATATTAGCATCACAAATAGTTTATCATTGTAGCATACTTGTGTTTCA
TGATTTTTTCTGTTTTAGCCAAGGTCATACGCTTGCTATAAAAAAACTGTGTTGGAAGAA
TTGTACCAGAAAAACTGAACAGAAAGAAACAGAAGATGCTGAATGGTTACACTTTGCAAG
TTGTGGTGAAGATCATACTGTGAAGATCTACAGAGTTAACAGATGTGCACTGTAATAGAC
TTACTCCTGTCAGATAGATCAGATAATCTTTGGCTTCTTCACATATTTATCCTGTAAATA
GATAACTTTACCTCTGTTATTTTTGTTGAGTTTCACTTTGAGTCCTTTCTATAGCAGTAG
TATTTATATGGCCCGTGGAGCTTTTGAAATCTGATGGAAGCTATAGACCTTCTTTTCAAA
ATCTTTATCTCACATCCTCAGAACCTTGGCCATATCTTTAAGGGCTTATCCACACCCACA
GGTCCTGATTAGGAATCTGCTCCTTCTTCAGAACCGAATTTGTCTCCTCTTCTGTTACCA
TGAATCTTCTCTTTCTGTTGTTCCTTTGTGGGATATTTCATTATACCCTCTCAGGGGGAG
GACTTGAAAAATAGATAAAATCCAGATTAATTTTGGGGCCACACCCAGAGAGACTCCTGA
GTTATTTCTAGCTGTGCTTGGGAATAACTCCCAGCCTATTGAGCTGTCTCTCCCACCCCA
GGTCATTCAGTTTTTTATTTTAACATTTTTGTATTAACAGACCACACAGTGTGGTCTGTT
GACCCCTTCCTCCCACTGTGCAGTAACTACTCCGGAATTCGGCATTAGTATTTTGAATTG
TGGTGTTTTTTTTGTTTTTTTTTGTTTTTGGCATTTTGGGGTCCACCCGGCGGTGCTCAG
GGATTACTTCTGGCTCTGCACTCAGGAATTACTCCTGATGGTGCTTGGGGGACCGGGGAT
TGAACCCGGGTTGGGCTCGTGCAGTGCAGAGCCCTACCGACCATACTATCTCTCTGGTTA
ATTCTTTTATTTATTTTTATTTTTTCACATCAGGGAAATTGTTCAAAGGACTGAGCAGTT
GCTTTGCATGCTCTGGACCGGTGTGATTTCCAGCCTCCCAAGCGCCGCCAAGTGCGGTCC
AAAGACTGGAAAAAAAAAAAAAGAACACCAAAGTACTTCGATTCTTCTTTCAGCATTTGC
TGAAGAGCAGAGTTCTGAAACATTTGAATTCTTGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1138, 4021..4099, 5712..5782, 9629..9785, 11182..11259, 13810..13874, 14641..14707, 16083..16220, 21622..21717, 23671..23771, 23982..24113, 29256..29405, 32420..32608, 34084..34153, 35770..35865, 35966..36023, 36740..36812, 39096..39104, 39107..39281, 45173..45294, 48793..48926, 50355..50468, 52698..52854
1001..1138, 4021..4099, 5712..5782, 9629..9785, 11182..11259, 13810..13874, 14641..14707, 16083..16220, 21622..21717, 23671..23771, 23982..24113, 29256..29405, 32420..32608, 34084..34153, 35770..35865, 35966..36023, 36740..36812, 39096..39104, 39107..39281, 45173..45294, 48793..48926, 50355..50468, 52698..52851
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved