Sorex_araneus Locus NCOA6
snOPY snoRNA Orthological Gene Database
Sorex_araneus NCOA6
Sorex_araneus
NCOA6
GeneScaffold_5253
SNORA40
35674..35800
97389
CCTCCCTTTTGCTATCGTTTGCCTCTCCCCTTAGGGACACACACGAAAACGCTATTAGG
TCTCCCGGGTATCAAAACTCTATAGGTATTTTTCCCCCGTTTGCTGAGGATTTAACCATT
CTCATGCATAAAAAGCTTGATCCAGGTCCTCCGGCCACTACTTAAATGCACTTATAATGC
CGGTGTCAAAAGCCAAAGAAACCGTACATGGGTTAAAGTGCTCGTCTTGCGTGCAGCCAA
CTCCATCTCATTCCCAGCCATTTCATGCTCCCCCAGCACCACTAGAAGTGACCCCCGATG
GGGGTGGGGCAGTAGCACAGCGGGTAGAGCAGTTTGCCTTGCATGCGGCCGACCTGGGTT
CGTTTCCCAGCATCCATATAGTTCCCCGAGCACCGCCAGGAGTAATTCCTGAGTTCATGA
GCCAGGAGTAACAACCCCTGTGCATCGCCGGGTGTGACCTAAAAAGCCAAAAAAAAAAAA
AGTGACCCCCAATCATAGAGCCAAGACTAAGCCCCCAGCAACCCCAGATATGGTTCAAAT
GTACACTTACATCCCCCCCCCCAAAAAAAAAAAATACTGGTCTCTTTTATTACTATAGCA
AACCCAGCAAGTTCACGCTAGATGTAGTGTTGTACTATCCAATCACTTGGTTATGACTGG
ATTGTCAGATAATGCAGAATTGAAAACTGGTCTTTAATTCCTAAGCTGCTGGAGGAAAAG
GTGGTCTTTAACACATACAATCTTTTGTATGCAATATAATTGAAAAATGCGATTTCTCTA
GATCTGAAAGTAAAGTAATTTTGTTCTGTCCAGACACAGGTCTTTGCCACCATAAACATG
TATTAATAACCACTTCTTTTCTTTCTGAGATGGTGGGCCACGTGGTGCTGGAGGTCTGTA
GGTTATATTTTGTTAATTGTACAGTTATAATGCTCTTTTATATTCTTTTCAAAGGTTTTC
TTATTTTCCACTTGGCGTATGCTTCCAGAATTATATTCACCATGGTTTTGGATGACCTGC
CAAACTTAGAAGACATCTATACTTCCTTGTGTTCATCAACAGTGGAAGACTCAGAGATGG
ATTTTGACTCTGGACTAGAAGATGATGATACAAAAAGTGATAATAGTTTGGAGGATTCTA
CAATTTTTGTGGCCTTCAAAGGAAATATAGATGATACAGACTTCAAATGGAAATTGGACA
CAATATTGGAGAATGTACCCAATTTGTTAAATATGGGTAATCTGATTTTTCTTTCCTTAT
TCTTATTGATGTGCTCTCCTTTTTTATAGTTACTTGGATTTTGCAAAGTAAAACTTCATT
ATACTGGCTTAGAAGACTTACTTTAAGTGAGAAGTTACTTTTTTTTTTTTTAATGCAGAA
AATCTGTTTGGGAGCTAGTACAGTGGGTTAGGTGCTTGCCTTGTACACAGAGCCTACCCA
GGTTCAAACCCCGATACCACATAAGGTACCCCTTGCCTCACTATCAGTAATCCCTGAGCA
CAAAGTCAGGAGTAATCCTTGAGCACCACTAGGTATGGTCTAAGAACCGAAGAAAAGGAA
AACGAAGAATAAAGAAAATATGTTATGGGGGCTGGAGAGATAGCACAGCGGGTAGGGCGT
TTGCCTTGCACGCGGCCAACCCGGGTTCAAATCCCAGCATCCCATATGGTCCCCTGAGCA
CGGCCAGGGGTAATTCCTGAGTGCAGAGCCAGGAGTGACCCCTGTGCATCGCCGGGTGTG
ACCCAAAAAGCAAAAAAAAAAAAAAAAAAAAAAAAAAAGAAAATATGTTATGTTTCTTTT
AATTAAGAAGCTGACTATAATGAAGTATTGCATAACATAGTAGTCCATAATCTGTTACCT
TTTTTTCCCCCGTATCCCATTAGTGAAATAAGACTTTTACNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNCAGTTTTTAGGCATCTGGTGACAAAATGAAAACTACCATA
GTATAAGTAAGCCAGTGGTGAAGCTTAAGGACAGCAGAGGGAGAAGGGAAGACACAGAGC
TGGCTTTTTCTTTCCCTCAGCAGATGGGACTTCTGAAGAGCTGGCCGGTGACTCTCCTTC
CTTCCCTTCGTTTCTAGTGTCTATCTATACTGTTGTTTCATATGTTAATTTGGAGGGGGG
ATTTTTTAGTCCTATCCAGTAGTTCTCAGGGGTTACTCCTAGTTCTGCACTCAGACATCA
CTCCTAGTGGGATATGGGATATTGAGGATCAAACTCTGGTTGGCTGCATGCGCCTTAGCC
GCTGTACTCGTGTACTAAATTAATTGTACCCAGCCAGTGGTACGTTAATTTTTCATTTTT
TAAATCTTTTTTGCTTTTTGGGTCATACCTGGCAATACACAGGGGTTACTCCTGGCTCAT
GCACTCAGGAATTACTCCTGGTGGTGCTTGGGGGACTGTATGGGATGCTGGGAAATGAAC
CTGGGTCGTCCATGTGCAAAGCAAGCGCCCTACCTGCTGTGCTATTGCTCCAGCACTTTT
TTTTTTTAATCTTTTTCTATCTCACCTTATTCTAAGCAGGACATGAGTGGCAGCCTAAGA
GCTCAATAATTATTTGATGAGTTAATTAATAAACAACTAAATTAGCATAATACAGGTCTG
TGTACACGGGGCCTGTTGTGAATTGGAAAGAGTAATGCAACCTAGAATCACTAAGCTGCA
TTTCATGTATAAACCCTGAAAAAAGTAGACCAAAAGCATGTTTTCTTTGATTAGTAATTA
ATTTTATGTTCTTTTGTCATTGTTCTTGCATGTTTTATTTCCTTTTGTTTGGGCGCCACC
CAGTGGTGCTTCGGGCTTATTTCTGGCTCTGCGTTCAGGAACCACTCCTGGTGGTGCGTG
GGGTGCCTGGTGGTGCTTGGGGTCCATAGGTGCCCGAGATCCAACCCACATCAGACAGTG
CAGGGCAGACACCCTACTCACTGTACTATCTCTCTAGACCAAGAATTGTATATTCTCTCT
TTGTTTTGTTTTGCGGTCACATCTGGTGATGCCCAGGTGCACTAAGTCAGCCACATGCAT
GTCAGGTACCCTTCCTGCTGTACTATCTCTTCAGCCCAGGAATTGCGTATTCTGTGTCAA
AATACTAATGATCAGTTCATATTAAACTGTCAGTTTAAAAACAAACTCCTAGACATGGGT
AGATTGGTGGTTGCCAGGGGCTGGGGATATGTGTTAGTCAAGTGGGACAGACTTGCAGTT
ACTAAATGAATCAGGTCTGGGCACCTACAGTGCAACATCTGTAATCAACAGTGTTGCTTT
TTTTTTTCTTTCTTTCTTGATTTTGGCTTTTTTGGGTCACACCCAGAGATGCTCAAGGGG
TTATTCCTGGCTCTGCACTCACGAATTACTCCTGGCAGTGCTCAGGGGACCATATGGGAT
GCCAGGGATTGAACCCGAATTGGACACGTGCAAGGCAAACACCTTCCCCGCTGTTCTATC
ATTCCAGCCCCAACAGTATTGCATTTTATTTTTGAAAGTTGCTAAGAGAATGCTAAGAGA
ATGCTAAATATTCTCACCACACACCAGGTCATTATGGGAGATGACTGATATGTTAGCTAA
CTTTATTGTGGTAATCATTTTGCTCTGTACACATGTATACATCTCCATCCATCTTAAGCC
TCTATAATGTATGTCAATTATATCTCAGTAATGGGAAAAGATGTCAGTTAATGTTAATGA
TCACCAAAATGAGGTGTGATCTTTAATCACTTTTTTGAGTTTTAACTTTTTTTTTTTTTT
CCGATTTGGGTCAAACCCAGTGATGCTCAGGGGTTACTCCTGGCTCACACACTCAGGAAT
TACTCCTGGCAGTGCTCGGGAGACCATATGGGATGCTGGGAATCGAACTCGGGTCGGCCG
CATGCAAGGCAAACACCTTCCCCGCTGTGCTATCGCTCCTGCCCCCATTTTTTTGAGTTT
TAAGTAGGAGCTTAGGTTTGTATTTAGCATAAACCAGCTGCAACTTCCCTTCCCTGCAAC
AAAGAAACAATAAAAGTTCCGACTACCCAGTTCCTTTAATATAGAACTTTTTCAATGTTA
GTAACATTTATATAATTTTCTTTTTTCCTTTTTAAAAAAATTATATGCATTTTTAACATA
TAGATTACAGTAGGGGAGTTATATACAGCTTCCCTGGGGAGCTCAATAGTAATAACTACC
TCAATGACAGTATGTCGCCCCTCCCCCAGCCATACTACCTGAGGCTTCATAGCTGAAAAT
GTGTGAGCAGCACACCAGGCATGCTATCTCTGATCATAACAACTCCTTTATCAACAATCA
CCAAGGCAGGAAAAGAGGGGAAAGAGTGATAAAAAAAAGAAGACCCTCTGGGGGCTGGAG
TGATAGCACAGCGGGTAGGGTGTTTGCCTTGCACGCGGCCGACCCGGGTTCAAATCCCAG
CATCCCATATGATCCCCTGAGTGCAGAGCCAGGAGTAACCCCTGTGCATCGCCGGGTGTG
ACCCAAAAAAGCAAAAAAAAAAAAGACCCTCTTTAGGAAGCAGTCTGAGTTACAGGAATG
TTTCTCATTGATCTCTGCATGCGTGTATATGCACATTTATTCGATAGCTAACATCTATAA
TGGAAAAGACAAACAAACCCATTAAATTTGGGTCCATTGATCTCCTGTATCTAATCAGAT
GCTAGTTTACCCGAGTCCTGTTCTCTTCCCTTTTACCTGTCGTTTGCTGCAGTGACTGGG
GTTGCACGTGTGTAGCTGTGGTGCATGAAGTGGTGTTTGCTGCAGTTCTCTTTGAGGTTT
ACACTCCTATAATTGTGCTTGCAACATGCTCACAAGGGATTGTTATAAGATTGAACTCCG
ATTGACTCTGTGCAAGGCAGGCTTTCTGTATGCTTGACTATTTCTCTGGCCTCCCAATTT
TCTTTCCTTAAAAAAGAAAATTTTTGTTGTTGCTTTACCATACCTTTTCTGGGTGAAACA
ATTCAACCCATAACAGTTGTGTAATACAGAGACAGTAATTGGGGCTGGAGTGATAGCACA
GCGGGTAGGGCGTTTGCCTTGCACGCGGCCAACCCGGGTTCGAATCCCAGCATCCCATAT
GGTCCCCTGAGTGCCGCCAGGAGTAATTCCTGAGTGCATGAGCCAGGAATGACCCCTGTG
CATTGCCGGGTGTGACCCAAAAAAAAAAAAAAGAGAGAGACAGTAATTAAAAAAAAATTT
TTTTTTTTAATTTGGTAGCAGTGCTGGGGATCAAACCCAGGGTTGACTGACTGTATGGAA
GGCAGACGCCTTAACATCTGTACTATCTCTATGGCCCCTAAGAAGAATTTTTGTTTGTTT
TGGCATTATATCTTGTGTTGCTTAGAAACTGCTCCTGTTTCTGTATCTTGGGGTTTGCTC
CCTACAGGTGCTCAGGGCAGTATGTAGTGCCAGGGATCCAACCTGGTCTTCTTGCATGAA
AAAATGTGATTTAGTTCATTGAGTTATCTCTTTGGTCCTAAATTAAAACAAAGTAAATGG
GGCATGGGGAGGAGATCCTAAGGAATTAAGTTGAGGGGTGGAGAATCACAGGAATGGTGG
GCATAGGAAAGCATAAAGAGTATATAGGAAATGAAATTGTGTGACGTCTGGTTTGCTGGT
ATTTTGAGAAGTGTCAGGAAATGAAGCCAGAATAGTTGGTTGGAGTTGTAGATGCCAGAT
CCAGACATTTGAATATTACTGAGTTGGAGGTTCAAATTAATATTATTACTATTGTGTAGG
CGCATGATGGCACTGCATAATTTGGAAATGGTGCATAATAGAGTCTTGGATAATTAATTC
TGGCTCTAGGGAATTTCATTTTGATTTTGTAAACTTTATTATATCATCAGTTCTCATCTG
TTTTGTAGATGTTACCCCTTACAGGCACAGAGGTAACTTACCAGTTGTACAGCTTGTCTG
GTGCATCTTCATCCTCATCATGTTTTCTGCACAAACGTGTGGTTGTGGTTGAGGATGTCC
CTTATCCCTCTGACCCAGACGGCTTTGTGGAGGTGGTGTCAGTGCGCACATCTGGGGCCT
CCTGTCCTTCGTAGACCATTTTTACATCTCTGGATGCCCAAGCTGTACACAGCTTCTGAA
TGTTGACAATGTGTTCTGTCACTTCCTCAAGGACAGCAGAAAAACCCTTCTTTTTCTTGC
CCACCCTTTTTAGTGGGAACTGGGCCCAGGTAAGAAAGATCCTAGAAAAGTTTTTTAGTT
TATCTTTTGAAGTTATTGTTGTTTATATTGGGGCCACACAGACTGGTGTTTCAGAGCCAC
TCTTGGTCCATGTTCTGGGAACCCTGTGGCATTGGGGATCAAATCAAGAGCTTTTGCAAG
CAAAAAGCATGCATGCTCCAGCCCTTTGACCCATCTATTTGGCCACTCTAGGGAAATTCT
TGGATTGGATTATCCTAGACAAGTGGATATCTCAAAAAAAAAAAAAAAAGATTTTTGATG
GTTTAGCACATCTAGATGCTCTCATTTTCCCTATACCAGTCATCTTTTTACTAGGATAGT
GAAGAAATTCCTCTTACATGAGCAACGAAAAACACACCACAACTGACTTTTGGTTAGTCA
TCTGTGGATATTTAGTCTCTCCAGGGATTTAAGGTGGCTTGTATATGTTTGTTTGTTTTT
AATTTGGCAGCCACTCCTGCCAGTACTCAGGAACTGCTCCTGGATCTGTACTTGTTAGTC
ACACCTGGCAGTTTTCAGGGGATCATTCACTGTATGACCCCCTGCCAGGGATCAGATAGG
ATTAGCCACATGTAAGCATGTGTCCCAACCCTTGTATGGCCCCATAGGATTTTATTTTTA
TGATTGATTCATTGACTGGTTTTTTGAGCCACAACTGACTGTGCTAAAGGGTTCCTACTA
GCTCTGCACTCAGGAATCACTCCTGGTAAGCTTTTGGGACTGTATGGGATGCTGGGGATC
AAACCTAGGTCGGCCACATGCCAAGCAAGTGCCTTACCTTAATATTGATATCCATGTCAC
TCTTCACTTTTTCAAAATCATGTCTTTTCCATCCTTTTTTTTTTTGCTTAAATATTTTTT
TATTCATTTTAGGCCAAGTTTTCAAATTATTTTTATCTAGCCTACTTTTTATCCTTTTAC
ACTACCATAAATATGATATTCATTATTAAACAAATATTTATGTGGAATGTAAATGTACCC
CAGCCAGTTGCCCACTACTGAATACTTAGGTTGTTTTTGTGTATGTTTAATAGTCAACAA
AATATAGAGAAATAATTGACAGAAAATCAATTGAAATATAAAGGAAAAAAATGTAAGTAT
TAAACAATTCTATAAAAGATTATAATGTTTGAAGGCATAATATAGGATTGTCCATCCTTT
TTTTTTCTTTGCTTTCTTCCTGGCAGTGATCAGAGGTGGCTTCCAATTCTTTGTTTAGGG
GTTAGTGTTAGCTATGGTGGACTGGAGTGATAGCACAGCGGGTAGGGCATTTGCCTTGCA
TGTGGCCGACCAGGGTTTGATTCCTCCGTCCCTCTCGGAGAGCCTGGCAAGCTACTGAGA
ATATGCTGCCCGCACTGCAGAGCCTGGCAAGCTACCCGTGGGCATATTTGATACGCCAAA
AACAGTAACAAGTTTCACAGTGGAGACGTTACTGGTGCCCGCTTGAATAAATTGATGAAT
AACGGGAAGACAGTGCTACAGTGCTACAGTTAGCTATGGTCAGGGGGCCATATGCCGTGC
TGGAACTTAAACCCAGGCCTCCGGCATTGCAAAGCTATTGAGTATTGCTCCAGCCTCTCT
CTTCATCCTATATTTTTAGTCTTGATTTTTTATTTCTGAACTCTCTCTAGTTTACATCTA
TCTTTTAAAAACAGCTGGTTTATAGAATTAAGGAAGATTACATATTGTCCTAGCCAATGA
CATGCTTTTTCCTGCATCTTTTTAATAATAGGATTATATTAAAATTGTGAATAATTATTC
AAATTGTGATCATCAGTAGTCCTCGGGGACTTGTTTGTTTCTTGGCAGTTCTTCCTAATT
CAATGCTTCCATCGTTTCATGTTTTTTCTTTTTTCTTTTCTTTTTGGTGGGTTTTCAGAC
CATACCCTGTCCAAGGGCTATTTCTGGCTCTGTGCTCAGAAGAGACCCCTGGCTATACTC
TGTGATGCCAGGGATCTAACCCAGCCTCCCACATATGCAAAACTTGTGCGCAGACCTTTG
AACTATCTTCTGGTCCCAATTTCATCTTTTTTTAGAAAAAAACAACAGAACAGTATTCCT
ACAATGAACACTACATTTTTGGGGGGTGGTGGTGAGGGGGGCACAACTGCAGTCTCAGGG
CTTACTCCTGTCCGGCTTGGGGCCTGTGGGGTGCTTCTGATCATATCCCAGTTGGTTGTG
TACGAGGTGAACACCTTACCCATTGTACCATCACTCCAGCTCCTGCAGGGGAACTCTGCC
TTCACCGCCTATATTCAGCATTAATCCTCCATTAAGTACATATTGGCAATACTTAATGAT
ATATTTGTTATCTTTATGTTTTTCTTATGTTTTTGTTTTGCTGTTATTCAGTATGAGGGC
CCCAAGATGCAATGCTGTTTGGACCCTGTGGTGCTGGAGATTACCTGGGCAAGCCCTGTG
GTGCTTGAGGCCTCTAGGTCTACACCTCTTTTTTTTTTTTTTTGGCTTTTTGGGTCACAC
CTGGCGATGCACAGGGGTTACTCCTGGCTCTGCACTCAGGAATTACCCCTGGCAGTGCTC
AGGGGACCATATGGGATGCTGGGATTCAAACCCAGGTCAGCCGCGTGCAAGGCAAACGCC
CCACCCGCTGTGCTATCACTCCAGCCCCTCTAGGTCTGCACCTCTTAATGCTCAAGGGGA
CCGTGGGTGCTGAAGATGGAATCTCCTAATCCCTGTACTCTCTCCAGCTCCTTTACCACC
TTTTTTTTGTGAGGAAGCACATCGGTTAGTGCTCAGGGGTTATTTCCAGCATGTTGCTCA
GGAACCATGGGGTTCAGGGATTGAATCCAGGCCTCCTAATACATAGCATGTGCACTAACT
TTGTGCTATGTCTCTGGTTCTAAAAAAAATTTTTTTAAAATTAAAAAATTTAAAGAATAA
AGTGTGTGTGTGGGGGAGCCTTCATTATGACTATTAAGACAGTGGGGAAGAGAAATTTAC
AGACTCTTAGAATAATGGCCAAAGCAGCTGGAGCAATAGCACAGTGGATAGGGCATTTGC
CTTGCACGCGGCCAACATGGATTCGATTCCCAGCATCCCATGTGGTCCCTCGAGCACCGC
CAGGAGTAACCCCTGTTCATCGCCGGGTGTGACCCAAAAAGCAAAAAAAAAGAGGTGTAG
ACCTAGAGGCCTCAAGAAGAAGAAGAAGAGTGGCCAAAGAATTTGTCTAATTTAGAGCCC
ACCTATTTCTTTCTTTTTGATTCTAATACTTTCTTGGTTTTTTGGGCCACACCCTGCAGT
GCTCAGAGATGACTCTTGGCAGTACTAGGGGACCATGTGTGGGGCTGGAGATCTTACCCA
GCCTCATACTTGGCCACGTGTAGTTTAGTCTGCTGTATTATCTCTGTAGCACCCTCACCC
CAGTTTTCTTGATTTAATTATTTTTAGAAACTTAGTAGAGGAAGAAAGCCATTGTTCTTT
AAAGTTGTCTAAAATAGTTGAATAGGAGACTAACACCCAAGAGTAGTAGAGATAAAGACC
AGGAGGTCTGCTCCACGGCTTGGAAACTGGCCTCACCTGCTGGGGGGAATAGGCAGCTGA
GATAGAGAAGGGAACACCAAATAGAAGATGTTGGGAGGATCCATTCGGGTTGAAAGATGC
GTGCCAAAAGTAGACTGTAGACTGAACACAATGGCCACTCAATACCTCTATTGCAAACCA
CAACACCCAAAAGGAGAGAGAACAAAAGGGAATGCCCTGCCACAGAGGTGGGGTGGGAGT
GGTGGGAGCAATACTGGGAATACTGGTGGAGGAGAATGGGCAATGGTGGAGAGATGGGTA
AACGATCACTGTATGACTGAAATGCAAACACGAAAGTTCCTAAGTTTGTAACTGTACCTC
ACAGTGATTCACTAATTAAAAAAAAAAAAAAAGGAAAAAAAAAGTTGTCTGTTATCACTG
TCCTTTGGTAGAGGGGAGGAGTGCTGGAGGAGAGGGCACTCAGTCACACCCTGTGGTGCT
TGAAGGTTACTACCTGCAGTGTCTGGGGGACCCTTTCATACCAGAGATTTACTACAGTTG
TCCACTTGCAAGGCAGGTGCCTTAATATCTGTATAATCTCTGTTACTCATTCTACTAGTT
GCTGTCTTACGGCAATACCTTACTTATTTTCACTACACTATAGCATTCTTGTCTAGTACT
TATAAAAATAAGGATTTTGGGGGCTAGAGAGATAGAAATGTGTAGGGCACTTGCCTTGCA
CACAGCTGAGCCGGGTTCGATCTCCATATCTCATGTGGTCCCGTGAGCATTGCCAGGAAT
GATTCCTAAGTACAGAGCCAGGAGTAATCTCTGAGCATGACCAGGTGTGGCCCAAAACCA
TAAACAAACAAACAAGCAAAAGTATCTTTGTTGTAGTAAAAAATCCTCACATGTGAAGTG
AAAGACTTGCTGCTGCTTTTTTGTTTTTGTGGAATGCCAGGATGCTATATGCAAGGCAAA
CACCCTGTCTGCTATACTGTCACTGAGCCTCAGAAGACTTTCTACTTCTAAGAGACTTTG
GATAAATGGTTAATTTATTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTT
TCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTT
TCTTTCTTTCTTTCTTTCTTTTTTAGTTTTGGGTTAGAGCCATAGCACAGCGGGTAGGGC
GTTTGCCTTGCACATGACCGACCCGGGTTCGATTCCTCTGTTTTTCTTGGAGAGCCCAGC
AAGCTACTGAAAGTATCCTGTCTGCACAGCAGAGCCTGGCAATCTACCCGTGGTATATTT
GATATGCCAAAAACAGTAACAAGTCTCACAATGGAGACATTACTGATGCCCACTTGAGCA
AATCGATGAACAATGGGACAGCAGTGCTACAGTGCAGTGCTACAGTTTTGGGTGGGGGTC
ACATCCTATGATGTTCAGGGGTTATTCTTGGCTCTGTACTCAGGAACCACTCCTGGCGGT
GCTTGGGGGACCATATAGTATGCCAGGGATTGAACCCGTGTTGGGTGCAGGCAAGACAAG
CACTTTACCTGTTGTACGTCTCCAGCCCCTACATGGTTAGGACCTGAAGTTTTCTATCCA
TTCCTTGAGGCTGTTGGGACAGAAATTGCCAAGGAGCTCTAGATCTTACTTTGCCCAGGT
TATCATCGTCATTGTTTTGGGGGCCACAGTCCCCAGCCATGCTTGGAGATCATGTGGTGC
CTGGGAGGGCACCTGCTTGCAAAGCATGTGCTCCATTCCTTTGAGCTTTTTCCTGGGCCC
TCTCGCCATTATTTTTAGGAAATCTATTATTGCTGTTGTTGATGGGTATTTGGTCAGATA
CTCCAGGCTCTCTGCTTTGGGATCATTTCATCACCTCTGGCAGGGCTCTGGGAACCATTT
GGGGTAGTGGAGATTGAACCTCTCTGCTGCGTGCAAGGCAGACACCTTACCCACTGTATT
ACCTCTCCTGCTCTCATTTTTTCTTATTTGTTTGTTTGTTTTTGCTTTTTGGGTCACACC
CAGCGATGCTCAGGGGTTACTCCTGGCTTATGGCTCAGGAATCACTCCTGGCGGTGCTTG
GGGGACCATATGGGATGCTGGGAATTGAACCCAGGTTGGCCTCGTGCAAGGCAAACGCCC
TAGCTGCTGTACTATTGCTCCAGCCCCCATTCTGCTCTCATTTTTAGGGGAGGAGTCAAC
CTGGCAGTGCTCAGATCTTACTCTTGTTTCTGCGCTCTGAGAACACTCCTAGTGGGTTTG
GGGAATAGGGTGCTGGGGATGGAATCCAAGTTGGTCGGTTTGTTTGTTTTGTTTGTTTTG
GGTGCTGAAATGCTTTTTCTGGCCCAGTGCTGATATCAGGGAACCATAGGCACTAAGAGG
GCTTGATCCCAGACCTTAGACCTTGAAACCAGGCCTCCTTTATGCAAAACATGTACTTCA
GACTGTTTAACTCACTTGGGCCCCATTAGGTTGTTTTTTTATTGCAGCTATATTATGATA
GAAAGAACATGATTGTGTTCATAATTAGAATATGATATGAAGAACTGGTTTTCTCTAAAT
TTTATCTTACCTACTCATATCTAATCAGATGGGAAATTATTCAAATCATTTATATTGTGC
TGTATTAAATTGTTAAATATGTTAGGATGAGTANNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAAAAAAAAACCAA
AAACTCATGGGCAGGAAGTAGCTCATGAGCTGAAGTGGTGCCTTTGCTTGCAGAGACACA
GCTTTGATCCTTGTGCCAGCGCACTCTAAGGTCCCTTGAGAACAGAGAACCCAAACATTA
AAAATTAACTTGTGCTTTGTAAGTCTGAAATTTCAAAATATGAAGTTAAAAAAAAATTAT
GCAGGGCCGGAGAAATAGTATAGTGGTTAAGGAGCTTGCCTGGAACAGCTCAACCCAGGT
TTGACCTCCATATGATCCCCTGAGCACTGAGAGTGACCCCTGAGTACAGAGCTAGGAGTA
AACCATGAGCACTTCTAGGTGTGACCCCCCCCAAAAAAAAAAATAAGAGAAAAATGTCAT
GGTGGTGATAGTAAAGTGTTAGGGATATTATTACTTTGAGAGGGAGAGAGTTTATAGCTT
GGCAACAAGTACAGAATATTTGTGTTTGGTATAGGATTAGAATATACCTTGTTTATGACG
CAGTTACCAAAGATGCTGTACGATTCTTATTTACTATATACATTCAAATATATGTTAAAG
TGAAAACATATAGAACATACATTAAATTTCTTGATAAATTTTTTTCTTTTTGTCTCCTGA
TGGGAGGAGTTCCTCCTAGTGGTATGCAGTGGACCATTTGGTAATGGGCTCAAATCTTGG
CCTTCCACATGTGCTCAGCCTTTTGAGTTGTCTCTCTGGCCCTGAAAATTCTTTTTTTTT
TTTTTCTTTTTGGGTCATACCCAGCGATGCTCAGGGGTTACTCCTGGCTTTGCACTCAGG
AATTACTCCTGGCAGTGCTTGCGGGACCATATGGGATGCCGGGGATCGAACCCGGGTCGG
CAGCGTGCAAGGCAAACGCCCTACCCGCTGTGCTATCTCTCCGGCCCCATGGCCCTGAAA
ATTCTTAAACCAAGAAGGAACCGAAGGGGCCAAAGTGATGGTACAGCAAATAAGGCACTT
GCCTTACATACATCCTGAGACAGGTTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNCATTAGTGAGATTTTATTAGCCTTCATTTTTAAGTCG
GTAGGAAGAGGAATTAACTTCTTGAAAGAAAGAAGGTGAGTTTTCAAAATGAATAGGCCC
TACTAGAAGGAAGAGTTAAAAACTTGGGTTTTTTTAATTGTTTGTTTGCTTTGTTTTGTT
TTGGGGCCACAATCAACGATGCTCAGGGTTTACTTCTGGCTCTGCACTCAGGAATTACTC
CGGTGGTGCTCAGGTCAGCCACACGCAAGGCAAATGCCCTACCTGCTGTACTGTCTCCCT
GGCCCCAGAGTTAAAAGCTTGTACCAGGACCGGTGTGACAGTACAGATATAAGGACATGC
CGTACATGTGCCAATCCTGATTTGATCCCCAGCACCCTGAGCTAGGATTAGGCTTTGAGT
ATGTGACCCCAGTCCTGTACCAGGACCCAAAATGTTCAGTGGTAAAGTACTTGGTGTAGA
CTGCGGTTGGGGATGTAGCTCTGTCATAGTACTAGGGATGTGGCTCAGTGATAGAGTACT
TGTCTTTTTTAATTTTTTAAATATTTTTGGCTTTTTGGGTCACACCTGGTGATACACAGG
GGTTACTTCTGGCTCTGCACTCAGGAATTTACTCCTGGCGGTGCTTGGAGGACCATATGG
GATGCTGGGAATCAAAACCTGGGTCACCTGTGTTTTAAGGCAATAGCCCTACCCACTGTA
CTATCATTCCAGTCCCCTAGAGTACATTGACTTTCATTGTGTGGAAACTGGGTTCAGTTC
TCAGAACCACTATGGGTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACTAAAG
GTACAAAAGGTGGAGCCCTGGAACAGTGTGCGTGTGACATTCAACATCCCCCGGGAAGCA
GCGGAGCGGCTCCGGATCCTGGCTCAGAGCAACAACCAGCAGCTCCGGGATCTGGGGATT
CTCTCCGTTCAGATCGAAGGTCTTTTACTTTGTCATGTGCCCATTTGAACCAAAATCATA
ACAGTAGAACATAGCATGATTATCTGTCCTGCATTGTCTGTTCCTCTGCTATTATGTTCC
AGGATGCTAAATAACTCAGAACCTCTGCTGTATATTGCATTACCTTAGGATAATAAGGGG
TCACGCTTGTGACTGGGTCTTGATGCTTCAGTATCCATAACATCAGACTCTAGTCCCTTG
AACTGATATTAAAGTTTCTCAGACTTGGATTTTATTCCACCCTGACCAGGAACTGCTTTG
TTTTTTTAAAAACACTACGTAGGAGCGGGAGTGATGGTACAGCATGTAGGGCATTTGCCC
TGCACATGACAGATCCGGGTTCGATCCCCAGCATCCTATAAAGTTCCCCCAGCACCACCA
GGAATCATTTCTGAGTACAGAGGTGCAGAGCCAGGAGTAAGCCCTGAGCATCACTGGGTG
TGACCCAGAAAGAAAAAAAAAAACCACTATGTAATCCCACGATCTTTGCTCTGCTGATTA
ACTCGAAGCATCCCTGTGATGCCTGCTCCAAAAAGAAGACCTCATTTGCATTGCAGCTTT
TCACCAAATAAGCCTTAATATATTTTATTTAATAGAGGTGGTAGGATTACATGGTGTTTA
AAAAAAGCGGATCAGTTCCTTGGTTAGGAAGTCCTGCATAATACTTTTGTAGCATTAATC
TTCAGATATTTTGCCAGAGTGATCTTTCTAAAATGAGTTGCACTCATAAGCCCTTCTGTG
ACTGGGCCTCGTGGTGCCGATAAAGAACAGACTCCAGGGGGCTGGAGTGATAGCACAGCG
GGTAGGGCGTTTGCCTTGCACGCGGCCGACCTGGGTTCGAATCCCAGCATCCCATATGGT
CCCCTGAGCACCGCCAGGGGGTAATTCCTGAGTAAAGAGCCAGGAGTAACCCCTGTGCAT
CGCCAGGTGTGACCCAAAAAGAAAAAAAAAAAAAAGAACAGACTCCAAATCTTTACTTGT
ACCTTCTCATCCAGCTTATCTTTAACTTTCCTCTGATCCCTGTTCCATCTTCTCAGTTGT
CTTCTGGTTCCTTGAATATGAAATTATACCTCTTGCCCAGCTCCTTCACATTGGTGTTTT
CTCTATATGAAAGGATGTCCTCTACCATTTCCCCTCACCTTAGTTAAACCTACTCAGCCT
TCAAGTATCAAATCTTGAGGATATATTTTCTGAACTCTGTGACTAACTGAACTCCTTTGT
TATGTCCTCTCACAGAAGTCTTTTTTTCCTTTTCTGTTATTAATCTCAGATTTCCTTAGT
GCAGTTATTTGCTTTTTAATTTTTAAAAAATTCCTCCATAGATTGCAAATTCTGGCAGGG
CAGAGATCATATCTGATTTTCTTTACTACTGTATCTTTGCTTGGCTGGTACATGTTAGTA
AAAACATTGAATGAAAGTATGGGAAGTATACATATGATAGCACCAACATGTTTCAGCATT
CTGAATACAGTGATAGGGGCTGGAGCTATAGCACAGCAGGTAGGGCATTTGCCTTGCAAG
CGGCCAACCCAGGTTCGATTCTCAGCATCCCATATGGTCCCCCGAGCACAGCCAGGAGTA
ATTCCTGAGTGTAGAGCCAGGAGTAGCCCTGTGCATCACCGGGTTGTGACCCAAAAGCAA
TAAATAAAGAAATAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNCCAAAAGGACCTAGTATTTTCTTGCAGTTAAGGTATTCCGTCTT
GCAGCCAGACTAGCTATACTTTCATCTGTCCACAAGGTGGTGCTTTCCTCCAGAGTAAGA
AAGAATTGAATTCTTTGGATTTAGAATTGGGTTATTAAGCTCAGGGAGCATCCCAAAACT
TGTTTTTAAAATCAATGACAAAAATTAAAATAAAATAAAATAAAATCTTTTAATGAGTAG
ACCAAGTAAGATTTAAATGACATATAAATTTAGGGTCTACTTATATTTCTAGTGATAATT
ATCTACCAGGCTATTGTAGATAGTAGGCTATTATAGATAGCAGTCTGTTGTAGATATTGT
AGAAGAGCAAATGAGATTAAATGTTATAAGCTTTCGAAACTCTAACATATCTCAGAAGTA
CAGTAACAGCAATAGAATTCTTATGAGTTTGTTTATTGGATAAGTTTATATTGCATTTCT
GTTTTTATCAAAGTGCAGTGGTGTTCTGCTAACAAATATTAGTGTCTTCATGCCATCATA
TGTGATTTCTTTGTTAAGTCTGCTTATGTCCCTACTTACTGTTATAGATAAGGATTTTGA
GATTTTCTAAGAACATTTTCTCTCTCACATAAGCATTTGTGCACACACATGCATACTCTC
ATATCCATGCTGAACTGTTTGAAAATATTTAGTTTCATGCTTTGTATTTATGCTATACAT
CATTAGTGGTTCTCAATCTGCTGTATTATGATAATTGGTTGATCCTATACTGCAGGTAAT
CAAACCCGTTTAAATATGATTGAAGGAGCTGGAGCGATAGTACAGTGGGTAGGGCGATTG
CCTTGCATGCGACCGACCCGGGTTCGATTCCTAGCATCCCATATGGTCCCCTGAGCACCA
CCAGGAGTAATTCCTGAGTGCAGAGCCAGGAGTAGCCCCTGTGCATCGCCGGGTGTGACC
CAAAAAGCAAAATATATATATATATAAATATATATATATACACATATATATATGATTGAA
GTCCCATATTGCTTTTTCATGGTGGTAAACTTGATTTAAACACACACACATAAACACAGA
AAGCAGAAACTCTTGTACGCACGTTTTTATACAAAATTTCATTTTATTATGATAATTTCC
TTTTTATAATCTGTCATTTTCAGGGGAAGGTGCTATCAACCTGGCTTTGGCTCAGAACCG
AAACCAAGATGTGAGAATGAATGGACCCATGGGAGCTGGAAATTCAGTTAGGATGGAGCC
AGGATTTCCCATGGCAGGTGGTCCAGGTGAGAGCTCCCTCTCTTACCTGACATTTTACTA
ATTTCTTATTTAGCCAACATGAAATTGTTTGGGTTTTGCAAATTAGATAGGCAGGGTTCC
TGGCTCTATTTACTGGCTCAAGAAAGCAAAACCTAACTTTAGAGTTACGGAGCATGAACT
ATATTGATACAGTCTTTTTCAGTCTTTGGATCTCAGTGCTTAAAGGTAGATGAGTAATGA
ACCACTCAGCGGGTATTTATTGATTTCCTATTGTCTGATAGGACCTATACTAGCTGTTAG
AAATGAGGAAATTTTTTTTTGTTTAATTTTTTTGGTTTGGGGCCATACCTAACGTGTTTA
GGGCTTACTCCTGGCTCTGTGCTCAGGAATTACTCCTGGCTCATCTAAAGAGGACCATAT
GGGGTGCCAGGGATCAAACAAGTGTTGTCTGCACCCAAAACAAGTTCCCTGCCTGCTGTA
CTATCACTCTGGCCCCAGAAGAAATGTTTTCTACCCCAGGGATGAGCATGATATATAGAG
ATTGTACAATGTTCACTTATTCTGAGCTCAGGAGCTGCAAAATCTGTAGAAATACATGAG
AAATATGTTTTTATCTATTTAGAATTGGAGAGTTATAAATTACTTGCTGACTTTCCTAGC
AATCCTGAAGTATCTTCTTTAAAAATTGAACTCAGTAGTTTGTGAATCACAGAATTTTAG
GATTGAAATGACTTTCTCATCTAAAGCTGAGGAGTGGTAGTGTTCGCAGAGAGAAAGTAG
TTTTTCTAAAGTCAAGTTGTAGTTGGCTGTTGTCACATGACTAACACCCAGTGTAGTGGT
CTTTTCACTACACTAGTGATTTCCAAACTTTTTCTGCTTGAGGATCCTTTTCTTTCCCTC
TCAAATATACCCAAAAAAGTAGAGCCACAGTAGGTAAAGCAGAGTAAACACCTGAAAATA
TATCTAGTCATTCACCTCCCCACATAACATAGCAAAGTAACTTTTGAGGAAATGCACCAG
AGTGGAAATCTGTTTTTAAAGCTATTGTTTTTAAATGGTGGTCTCTGGAATCAGTACTGG
GATTTTATCCTGGCATTACCATTTATTGCTTACTTCTAAGTATATACTATATCTCTCAAG
CAAAAGTCTTTTCAACTGTAAAATGAGGAAAAGGTGAGGGAGATTCACTCAGTAATATGC
TCAGGGACCAGTCCTGGTGATGCTAGTGTATATTGTATGGTAATGTTAGTGAACATACAA
TCTTTAAGAATTTGAGCATTTCTGAAAGTAGGAAACTATAAGAGCATGTGTTCTAAGCAC
TTTTTTACTGTCTAGTTACCATCTTTTCAAAAATGCTGTAAGGTTCATTAAAGTAAAACA
ATTATGTACAGATGAACATTTTTCTTACTGTTCAGCTACATAAAACAACTAAAACTTCTG
GGGAAACTTTTTTTTTTAATTGGGGCTGAAGAGATAGTACAGTTGGTAGGGCACTTGGTT
TGTATATGGCAGACCCAGGTTCAATCCCTGGCACCACATGTGAGTCCCCTGAGCCCACCA
AGAGTGATCCCTGAATTCAGAGCCAGGAGTAAGCCCTGAGCACTGCTAGGTATGGGGCCC
CCCCAAAAAAAATTGTTGCAAAATGGAGCTTATGAAAAAGGGATGAAAAGGAAGGCAAGA
AAGGAGATGCAAAGTTATATAGCAGTAACCAAAGGCTTTGAGGGGTTTTGTTTTGTTTTG
GCTTTAAGTTTTAATCACTAGGAAAGAATAGCATTTGAAACTTTGCCTTGGATTCACATA
AAATGAAAAGTAGATTATAATATTTGCACCCTTTGACACAGGGAGAGGAATACAAAACTT
GTTACTGTTGACCTAAGCTCTCATTGCGGATATATATGGGGGTTGTGGAATTGTCTTCTC
AGTCCTTTACGTGTTGGATATTGAATATACTATACAAATAGCATAGAATGGCCAAGGTAA
GGCATTAAATGTTTTAGACTAGTGCTACTTAATTGGAGCTCTGGAGGGACACAGTCTCAA
TTCAGGTCACTACAGATTTCTCATAGCTAAATAAAGCCTGATATAAATGGATTTATATTT
CAGATTTATAAAATTCAGGATTATACTTCCTCCAGAATTCTAGGTAACAGCAATATCAGG
ATGTTTAGAATGATGTAAATCCTAAGAGAAAAGACACTGTTAAAGAGAATTAGAGAAGTG
AACTAATAGAAACCAAACAATTATTAAAGTGAATAGCTTATTCAATAAATTAGACACAGT
GGGAGCCGGAGCGATAGCACAGCACGTAGGGCGTTCGCCTTGCACGTGGCCGACCCGGGT
TCGATCCCCGGCATCCCATATGGTCCCCCAAGCACCGCCAGGAGTAATTCCTGAGCGCAA
AGCCAGGAGTAACCCCTGAGCATCGCTGGGTGTGACCCAAAAAGAAAAAAAATAATAATA
ATTAAAAAAATTAATTAGACACAGTGTAATTGGAAGATAAACTTGAGAAAATACTAAGAA
TCCAGCAGAGAAAAGGATAAAGAAATATGTAGACACTTGCTTTGCATGTAGCTGGTCCCA
CTTCGATCCCCAGCACCTCATACGGTCCCCCAAGCACCAAAGGGAGTGATTCCTAAGCGC
AGAGCCAGGAATAATCCTTGATTATTCCTGCCCAGTGTAGCCCAAGCCCCTCCCCCAAAA
AAGTCAAAAGAGGCATGAAGGAAAAAAATTGTACCCAAAGAGAGCTCCAGAAGAGGGTTA
TTTTTGTTGTTGTTGTTTTTCTTAAGGAGGAGAAAATAGTCAAAGAGAATAGCTGGAATT
TTTGTCAGAATTTATGAAAGACTGAAATTCTCAGAACCAGAGTGATAGTACAACAGATAG
GGTACTTGTCTTGTACATAGTCAACCCAGGTTCTATCCCCGGCACCCCATATGGCCTCCC
AAACCTGCCATGAGTGATTCCTGAGCACAGAGCCAGAAGTAAGCCCTGAGTACAAAAATA
AAATAAGACAGAAAGACACAAATCCTCATATTAAGAAACCCAGTAATCCTGATCACTATA
AATAAACAATAAATTAATGTCCAGACACAAATTTATAAAACTACAGAACATGAACAAAGA
ATATTTAAAGCGAATCCCAAACAAAAGATCGATCATTTACCAAGGAGAGACTTTCAGATC
CACAGTTAATATCTCAACAACATTGGCAGCCAGGAAACAGGGAAGTAATATTTTGCAAAG
TGGTGAGAAAAATAATTGAAAGCCTAAAATATTAAACCTCTCTATGCTATCAAGAGTAGT
ATAAAAATAAAGAGCTTTCTAAAGAGACTTAAGAAAATTTACCATTAACAGACCCTTGAT
AATTGAACTGCTCAAGAATGTACTTCAGGAAGAAGAAAATTGAACCTAAGATGGAAGAAA
TAAGATCTAAGATGGAATGGTGAGCTAAATAATTGTTAAGCGTGTGGTAAATTTTAATAA
ACATTCATTATGTAGTAATCACAATGATCTTTAGACTTTAAATATGTCTGTTGACATTTT
TCAAAAATCACCTTCCCCCCAAAAAAGATAATCACTAAAATTAGAAATTAGAACATATAA
CTTAACAAACTAGAAGTGGAAGGTTGAAAGGAACGGCATGACCAAAATAAAAAAAAAAGT
CAATCATATAAAACTGGGAAAATAGGAAAAGAAGGCTAAAAAGTAATGATGGGGGTTGGA
GTGATAGCACAGCAGGTAGGGTGTTTCCTTGCACGCGACTGATCTGGGTTCGATTCCCAG
CATCCCATATGGTCCCCTGAACACTGCCAGGAGCAATTCCTGAGTGCATGAGCCAGGAGT
AATCCCTGTGCATTACCAGGTATGACCCAAAAAGCAATAAGTAAATAAAGTAATAATGTG
GAGTGCGGGGCTGGGGGGGGGGGATCAGAAAGATAGTATAACAGGTACTTTCCCTATATA
TGGCTATCCTGGATTTGATCCCTGTCACTGCATATGGTTCTCAAAGCCTCACCTGGAGTG
ATCCTGAGCACAGAACCAAGAGTAGCAAAAAAGTTCAGAGGGCTGGAGTGATGCATGAGG
CCCTAGTTCAGTCCACGATTCCACATGGTTCCCTAAACTGCCAAAGTGGCTCTTACAACC
TCGAGGTGTTGGGCCGGAGTATCGGGTCATCCAGTTCAGTTGACTGACTAGATTCAATCA
AGTATTAACTGGTCCAGTCTTGGAAGTTGCCCCAAAATAATGGCATAAAATGATAAACAA
GAATAGTTAGATGGAATAACCTTATGTGCCCTTAAAAAAAATTTTTTTATTTTGAGCCAC
ACCCAGCTGTCCTCAGGGTTTATTCCTGGCTCTGCGTTCAGATGCAGGGAACTAGATCGG
GTGCCAGGGGTGAACCTGGTTCAGCCAAGTACAAGGCAAGAACTTTACCCTCTATACTAT
TTCCCTTACACACTCTTTTTTTGTTTTTTAACTTTTGAAGTCACATCCAGCAGTACTCAG
GGCTTACTCCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNGAAAAAAATTCGAGGTGACTATTCATCGAGATAAAGAGTACAACAGACTTTTGTC
ATCAGGTAAAATAGATTAAAAAAATTTTATATTGCTGGTGGGGCCAGAGGGTTAGCTGAA
AAGACTGAGTGCTTGCTTTGCGTATGGGAGGCTCCGGTTTAACCCTTTGGCACTGCCAGA
TGGGACCCAAACTTCCCTCTCCCAATAGAACTATTTTTTTTTTTATGCATTTAAGAACCT
AACTTTAAAATGTATCAAACAATCTATAGAATTAGAAGAAAGCAAATTTTAGGAATTTTT
AACATGGTAATTTTGGTGGCTTTTTCATTTGTTTTAAAGTAGTAAGAAGTCTAAAGTGTA
GTTAGTAAAGGGGTTAAGGTGCTTGCTTTGCATATGACTGTCCCCATTAAATTTCCTACA
CTGCCAGGAATCATCCTTGAGCACAAACCCAATTATAAGCCCTTAGCATTACCAGGTGTG
TCGTAAGACTCATCCTGCCCCAAGGTAAGATTTAAGAAATCCTGTATAACATACTTAGAA
TAGTTTGATATGTTGGGGCAAAGAAAGATTATTAAGATTAAGGCACATGCCTTGCATGCA
GCCAGCCCCAGTTTGATCCCTGGCACCAGACAGTCCCCCTAGCATTTCTGCAGTTTTGGG
TGCAGCAATGGAGGCCCTTGCACACCACCATCATGACTACCAGCACAGCCCAGGTAGCTG
CCAGCACCCATAGCCCCAGGAACACTCATTGAACTGCATGCACAGTTGGCTGAGAATCAT
TGGCAGAGCCTCCCTGGCCTCCTGAACGCTGTGTGGGAGCCCTCCAAACTTTGATGTAAT
GGATCGTATAAAAACTATAGACTAATAAATCAAGCACAGTCTTTTTTAAGCATAAATGTA
ACATTTATACAAAATGACCACATATGTTTTAGGGGTTAAAGCACTTCCATCTCTAGTACC
GCATATAGTCCTCCAAGCCAGGAGTTACCCCTGAGCACAAAGCCAGGTGTAGCGCGTGAG
CACGAAGGGTATGACCCAAAAACCAAGCAAAAGACAAAAACCCAAATATCATTTCAGAAG
AAAGTTTCTGTAAAATTGAATAATTGGTATCACACAGATAATGTTCTCTAACTACAGTGA
AATTACAGTAGTTAGTGGGAAGAAAACAAAACTAAACAACCCATATATTTAGAAAATTTT
AAATACCTTCTAAATATCCATATTTGGGGGTGGGTTGGGGGTGAGGCTGGGGCTTACTCC
TGGCTCTTTGTTTAGGGATCACTCCTGGTGGTGTTCAGGGGACCGTAAGTGGTACCAGTA
ATCCAACCCATGTCAGCAGCATGCAAGGCTATACTATCTTTCTAACTCCCCATGATTTGA
AAAAAAACAACAATATTGATAGAATTAAAAATATGTAGAGGGCGGGGGCTGGAGCAATAG
CACAGCGGATAGGGCGTTTGCCTTGCATGTGGCCGACCTGGGTTCCATTCCCAGCATCCC
ATACGGTCCCCTTAGCACCGCCAGGAGTAATTCCTGAGCACAGAACCAGGAGCAACCCCT
GTGCATCGCTGGGTGTGACCCAAAAAGCAAAAAAAAAAAATGTAGCGGGGCTGGAGTGAT
AGCACAGAAGGTAGGGCATTTGCCTTGCACGTGGCCAACCCAGGGTTGATTCCCAGCATC
CCGTATGGTCCCCCAGCACCGCCAGGAGTAATTCCTGAGTATAGAGCCAGGAGTAACCCC
TATGCATTGCTGGATGTAACCTGGAAAGAAAAAAAAAGTAGAATAGAATAACGAGAATAA
TACATATCAAAATTTGTGAGCTGTCACCAGAATAGCCCTAGGAAGAAAATTTAAGCCGTC
AGAATTTATGTTAGAAGGGCTGGAGCGATAATACAGCTGGTAGGGAGTTTGCTGTGCACA
TAGCCAACCCAGGTTTGATCACTGCCATTCCATATCAATCAAAAGTTAGCAAATTTAGTG
ACAGTTGTAAATCAAGAAAATGAAGAGCAAAGTTGGAGCGATGGAACAATGGGTTTTAGT
TTTAGTACACTTGCCTTGCGTGCAGCTGACTGGAGTTTCATCCCCAGCATACCATGTGGT
CCTCCAAGCCACACCAGGACTGATCCCTGAATACAGAGCTAGGAGTAAGCCCTGAGCATA
GCCCAGCATCACCCAAAGGCCAAAAAGGAAGGAAGAAAGGAAGGAAGGAAATGAAGAGCT
GAGTAAAGTTCAGTTACTTAGGAAGGAAACAGTAGACTTAAGTAAGATCTAAATCTAGAA
AAGCAGTAGAACAGAGCAGCAGCAGCAGCAAGACCAAAGGGTACTTCTTTGGAAGGCGAC
TAAAATTAATGATCCATGGGGCCTGGGATATCATGCTCAGGGGTAGAGTACATGCCTTAT
ATGTTGAGATCTTTTATTTTTAGTATCACAAAAACACAATAAATAAAACAGATGATCCTG
ACAAGTAAAGAAAAAAACAGAAAGACCAGAGAGCTAGTTCAATTGCTGATCACATGCTTT
GCATTCAGAAGGCCCATTTCTGATTCTAGAACTGCTTGGAACCCTGAGAGTAAATTCTGA
GCACTGCTGGGTGTGGAACAAACCCTTAAAATAAAGAAATAAAAAATAGGGGACTGGAGC
AATAGTATAGCAGGTAGGGCATTTGCCTTGCATGTGACTGTCCTGGATTTGAACACAACC
AGGAGTAACTCCTGAGCACCAGGTGTGGCCCCAAAACAAAAAAAGTTAAAAAAAAAAGCA
CAATTTATGTAAAGATGAAGAACTATATGCTTAAAAGTCTTATAAAATGTAAATTATATT
TCAGGTTTTTTTAAGAATGGAAAAGGGATATCCCATATATACATTTGTGCTATTAATTGT
AAAGCATTGGAAAATTAGCTGTGTTTTACAACCTACCAAAGGGCCATAGTGATAGCACAG
TAGGTAGGGTGTTTACCTTGAATGTGGCCAACTCTGGTTCAATTTCTCTGGCATCCCATA
TGGTCACCCAAGCACCACCAAGAGTAGTTCCTGTGTGCAGAGCCAGGAGTAACCCTGAGC
ACAGCTTGGTGTGACCCATAAAACAGAAATATCTAATTTAACCAGAACTTACTTAAGACA
AACTTTACTTAAGAAATAAAAATAGTTAAAAACTGATCTCTCTGTGAATTATCTGGTAGA
ATATATTGCCCAGGCCCAGCCCCAGATGTTTGTACAGATGAATTTTACTAAAATTTAAAG
AACAGATAAATATGTTCTTTCAAAGCATGGAAAAAGGAAAGTGCTTTTTAATTTAATTGC
AGAGGTTTTGGTGGGCTTTGGTGGTTGTCTCCCCTTTTTTATTGAATCACTCTGAGATAC
ATAGTTAGAAAGTTGTTCATGATTGGATTTTCAGTCATACAGTGTTCCAACACCTGCCCC
TTCACCAGTGTACCTTTCCCCCCGCCGATCACCTAAATACCCAGTTTCCTACTGCCACCC
ACCAAACCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACCCCACCC
CGTCTCCTCTCTCCGGGTACTGAAAGGTTGTCATGTATTTCCTTTTACCTCCTTTCTGCA
CTCAGTTCTTGTTCAGAGAGATCATTTCTAACTGTCATTGTCATAGTGGTCCCTTCTCTG
TCCTAACTGCACTTGCCCACCCCGACTTGTGGCAGGTGAAGAGGTTGTTTGTTTGTGGTA
TTTTTTTGGGCCGCACTTGAGATACTAGGAGGACCAAGCTATGCTGGGGATTGAAAGCAA
GACATGAGCTCATGTAAATTGAGCTGTCTTTGATTCCAAAGCAGTGGTTTCTTTTTGTTA
TTTTGCTTTGATTTTTGGGCCACACGCTGCCAGGGGTACTAAGAATCAAACCCAAATCTT
CTGCATGCAAAGTTTGTGCTTAGCTCTGGCTCATCTTAATATTGGTGTCAAAAATAAAAG
AAGAGAGCTAGAGAGATAGTACAGGATTTAGGCATTTGCCTTGCAGGCAGCTGACCCTGA
TTCTATTCCTGGCAACACGTGGTCCCTTGAGCACCACAAGGAGTAATCCCTGGACATAGC
CAGAAGCAGCCCCAAGAAACAAGAACAGCAGCAAAAAGAGTGGAAGAAGAACTGCATGAG
AGGATAATAAATGAGTATTTTCACTTTCAAAGGTGCTAAGAATCTTTAAAAGTCTAATGG
TGTCAGACATTACAAAAATGTGGAGTTTGGGGCTAGAGCAATGGTACCGCAGGTAGGGCA
TTTATTTGCCTTGCACATGGCTGACCCAGGTTCAATCCCCGGCATCCCATATGGTCCCCC
AAGCATTGCTAGGAATAATTCTTGAGTGCAGAGCCAGGAGTAATCACAGAGCACCGCTGG
GTATGACCCAAAAATTGGTTTGTTTTTTTTTTTAAATGCTGAAATAAAAGATTTTCCCAA
TTATTATTTTTTTTTAAAAAAGTGGAGTTTGTATTTTTTTCTGTTTTGTTTTTGTTTTTG
TTGCTTTTTGGGTCATACCCGGCAATGCTCAGGGGTTACTCCTGGCTCTGCAATCAGGAA
TTCCTCCTGATGGTGCTTGGGGGACCACATGGGATACTGGAAATTGAACCTGGATCAGCT
GCGTGCAAGGCAAACGCCCTACTCGCTGTTTGTCTTGCACGAAGCTGATCCAGGTCCAAT
TCCCAGCATCCCATGTGATGCCCCAAGCACCACCAGGGGTGATTCCTGAGTGCATGAGCC
AGGAGTAACCCCTGTGCATCGCCTGGTGTGGCCCAAAAAGCAAAAAAATAAATAAATATC
ATTAAATGAAGAAAGGAACTAAGTAGGAATACATGTGGCATGGAGTCACATGTAGCTCCC
AAAACATTTTTACTGCTTACATGTTAGAAATTTTATTTTTTAACTTGGATTTAGGACTAC
ACCCAGTAGTGCTCTGGCTTACTCCTGTCTTTGCACTTAGCTATCACTGTCGGAGGAACT
CAGGATCATTTGTGCTGCCAGAGATTGAACCTGGATCCACCATATGCAAAGCAGGCACCC
ACCTGCTATACTGTCGCTCTAATTCCAGAATTTTGGTAGAATTTTAAATAAAGAAGGCAG
GGAACTGTTTGGGTGTTTTGGTTTTGCTTTGGGGCTCCATCTGACAATGCCACAGGGCCC
TTGCAATGCTGGGGATCAAACTTAGGGAAATTCCAGCATCTGTGTGAGTGTTTGTCTAAT
GTGTAGACAAAGACTTTGAGACAGGTGCAAAAATAAATCCTCTTTTGCAACCCAGAACTC
GTTGTTTGGTATGAGTTCTGATACATATGAGAAGGAACATGACACCCAGAACAGATGAAA
AGTTGAGAGTTAACAGGTCTTTGTCTTTGACGACACCAAGCACCTGTCAGTTGAGCCAGC
GTTGTTGGACATCAGACACCTGAACAGACATGCTGAGGTCCATGACTTGAGTGACCGCAC
TGGGTGCCTACTCTGAAAAGGGCTAAACTGAAGATATTCTTGGATGTATACACTTTATTG
TTGATAAAGCAGAATCTAAAATGCTGCTGATGATTTTATTAAGTGTAACTCAGATGTTGT
CAACCAGGAGGGTTCGTGCTGGCATGTGGACCCTGGAAGGTCAGGCATGAAAGACAAACC
AAATTGTGTTTTGAGGGTACCTAATATGGAGAAGTAGCTCAGTCCACATGACCCTCAGAA
ATGGAGCTGAAGTGATCATGGAGGAACCAGTCTCCTTCCCTGCATCTCACTGGTAGCTAG
AACCTTGGGGCCCAAGGCTGGAAACTGTGACCTTGTTAAGACCAGAGCAGTGGAACCTCA
ATCACTTGGAGTGACGGTATCGGGATTGAAAAGACTGGTCAGTGGTACATAGGGCCACGC
TGGAGGTGAAGAGAATTGAGCTGCCATGCCAAAGAAACCACAACAGGATGGCATAAATAA
ATAAAAGTTTATTAGCAAAAAAAAAAAACAAAAAAAACTTAGGGAAATTGTACAAAGTGT
ATGCTTTGATCCAAATCCCCAGCTCTGCATGGAACTGTAAATCTCAATTATAAAAAGGAG
GGAATAGAATGAGACCGTAAAAGAAGCTTCTGTATCTACATATTTTTCTATCTGAAGGGC
AGAAGGTTTCAGTATAAATAGAACAGGTGATGGCTGTAGAAGACTCCCATGCCTTTTCAG
ATTCTTGAAAACTTCATTAAAATCAAACACATACCCTTCGCAGTATTTAATTTAAGGAGT
TCTTCTTTCCTCCAGGATTAATAAGGATGACCAGTCCTGCCACTGTTATGATACCCCAAG
GAGGGAAACATGTCATCTTCCATAATGGCACAAGGCCCTGGTTCAGAGCTACAACCTCGG
ACTCCTCGCCCTGCTTCTCAGTCAGGTAATGACCTTCAATCTCTGAGGGCTGAAGAAAAT
AGAACTTCCTGCACAGAGCGTTACAAAAGTCAGTGTTCCCTGATATCAGATTCCTAACTG
TGCAGCTCAGATGCCTCTATATTTATAAAATCTGCCCTAACTTTCTTTTCACATTTCTGA
ATATTTCATCAGTTCTACCCCAACATTCCTAGAACTGCTTCCTTAACCTACTTATACTCC
TGCAGGATACTCTGACAGAGAATTCATACTTGAGTACTTTTGGTAAATGCTTTATACTTT
TACCCTTCCTCCTCAAGATTCAAAATTAACATTGGAGGCACTGAGAAACTCGCAGTTTGT
AAATCTAAAACTTTAAGTCCATTGTTACCCAAATATAATTTAAACTGTACTTTTTAGGTG
AGATTTATCTTTCTATCATCTTATTATTTGCATATAGAAAGTACTTGCAAACATTTATTT
TATTAAATGGTACCAGCAAATTTGAGTTTAGATTTGCAGTTTGCCATGACTACTGCTCTA
GGACTTAGGCTGTAGTACTTTAATTGCTTTATTGTCTATTTTCAAACAGATGCAATGGAT
CCACTCCTCTCTGGGCTCCATTACAACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCCTGGCCCAATGCAAC
AGCAACTCCAGGCAAGACCATCCTTAGCCACGGTACAGACACCTTCCCACCCTCCCCCTC
CATATCCCTTTGGCAGCCAGCAAGCCTCACAAGCCCACACAAACTTTCCTCAGATGAGCA
ACCCAGGCCAGTTCACAGCTCCTCAGATGAAGAGTTTGCAGGGAGGACCCTCCCGGGTCC
CCACCCCCCTGCAGCAGCCCCACCTCACCAACAAGTCTCCTGCCTCCTCACCCTCCTCCT
TCCAGCAGGGATCCCCTGCTTCCTCCCCAACGGTTAACCAAACTCAACAGCAGATGGGAC
CAAGGCCACCTCAGAATAACCCACTTCCCCAGGGATTTCAGCAGCCTGTCAGCTCTCCAG
GTCGGAATCCTATGGTTCAACAGGGAAACGTGCCACCTAACTTCATGGTGATGCAGCAGC
AGCCACCAAACCAGGGGCCACAGAGTTTACATCCAGGCCTAGGAGGTGAGGAGCATTGAA
GCTGTTTGTGTTGGTCAGTTTACTGAAACTAGATCTTAGTAGAACTTAAAGTTTTTGAGC
TAATGGAGGGAGTGAAATAAGAATGTAATTAATTTGGTTTTTGAATGTAGTGATGACACT
TGATCTAAATTAATTTGGTACATTATGAAAACCTTATGCAGCATTTACTGGTAACATTTA
AGCAAGCTCTCTGGGTAAAAGTGCAGGTAAATTCAATATAAAGATACTCAATTTGTTGAT
CAAATTATTTTGTTGATCTTATACTGGTAAATTGAATTTTCAAAGAGAAGCGTACATTTA
ACAACTAAAACTGCTCAGATGTTAAAGAACAATTAAAGTACAGGATCTTATTGGGGAAAA
GGCCCTTCTAGTTTTCATTTTTATAATTCTAGTGTATAAAATAGTAAGCATGGTATTTGT
TAAATTTGGTTAAAGTATTAAAGGGGAATAAGTTCAGAAATCATTGACTTTTATAGTTTT
ATAATGCCAATGCCTGCTCCTTAGAGAGGGAATTCCATCAGTTATACCTAAAGGAGATTT
ATTTATTTATTTTGTAAGGTGCCTCTTGTATGAAGAAAAAGCAATGGAGCTTAATGTGTG
AGAGGTAAAACGATTACAGTAAAACTTATCCATCTCCATGTTTATTATTTATTCTTATTA
ATCATTGATCCTAGTGCACATGAATGTGCTTGGAGCTGTTCAGTAGGTATAGAGAGTGTC
AGTAATGCTGTCATCTGATAAACATACCCCCCACCGAAAGACACCCATTGTCTGCCCGGA
AAAAACCCTTGCATCTTTAGTGCAGCATAGCAAAGGCATGTTCCCATGGTTTATGATGAA
TGAAATTAAGTTGCTCATCAATCTTTTCACTCTCTTGTAATTCTGTTGACATGCAGGCTC
TACTATTTGAACCCTAAGAAGTTTTTAGAAAATGCAAGAATGTTTCAGCTCCAAACTTCA
CTGTTCTGGGCATGTCACATGGCCCTGAATCAGTAGAAGCTGGGAAGTCCCTTCTGCCAA
TGTGATTATTGATTTACTTACAATGGAAACATGCAAATGGGGACTTGTCACTGCCAAAGA
AAGGACAAATGTATATTTGTCTGTAAGCATTTTCCAGGAGATTGAAAATTTGGCCCTCAA
AAGAATAAATGAACTAATACAAAATTTTCCAGTGAGCTATAGGTCTTGATGCTTTCATAG
AGCAGATGATGTGCTCACCTAGGTGATCTGGCCACATCAAGGCCCACAGTATAGACAAGA
GTGGGTTCTGAGATTCTCCTTAGCACCGATTTGGTTCCTAAAATTAAACCTTTCTGTAAA
AGGAAGTACTCCTTTAGTAAGAATCTGTTAAGTGTCATTTTTGGTACATAGCTCTTTGAA
TTGCAGCAAACCTTATGAGGAGAAGGCATAATGATAAATTTAATGCAGCCTCACTTTGAA
GCTCCTATGTATTGTTTCCAGTAGCTTGTCTTCCAAAGAGACAAGCACAATACTAGTGAG
GGGATTGTTAGACAAAGGAGATTGTCAATGATTTCCCTCAAAGGGAAAACAGAATCATCT
ATGTTTAATATCAGGACCCAACTCTTTGTTTCATAGCATTTTTTTAATTAATTTGGTTGA
ATATGGGAGAATTGAGCATATTCCTTTTATATCTGTGTTAAAGTATGTAAAGTTTCAGGG
TCTGTTGTATTACAGAGAAAACTAAGCCCTAAACCTTGATGTGACTTGGCTTCAGATCAC
ATTTAGGGAGCAGATTGCCATCTTTTCCTTGGCATGTTCTAAATGTAAATTTTTCAGTAT
TTCTTTTTCATTTTGACAATGCTCATGTAAGAGATTGTGTTGATTTTTTTAACCATCTTT
CCCAACCTTATTATTAAAGATCTTACCAGTGTGACAGAGAGAGCTAAGCCAGTGAAGACT
TCATGCAGCTCATCCTTCCTTATTCATTCCACATCTAAGCAAGAGTATAAATTTGCTAGG
TAACTGCCTTACTCATTGTTTTCTATTAAGGAATGCCTAAACGCCTCCCACCTGGCTTCT
CAGCAGGACAGGCCAATCAGAACTTTATGCAAGGTCAGGTGCCTTCGACCACTGCAACCA
CCCCTGGTAATGCAGGAGCCTCTCAGATGCAAGCAAATCAAAATGTCCAGCATGCAGGTT
TGTTTTCCATCATTTATTCAGTGAGCATTTAATGATCATTGTGTGGTAGACTATGATAGA
CAAAAAGGATATACTTAGAGTTAAATATAACTGGTTTCTCCTCTGAATTTCAAACCCATA
ATTATGTATTCTTGGGGCTGGAGCAATAGCACAGCGGGTAGGGCTTTTGCCTTGCACGCA
GCCAACCCGGGTTCGATTCCCAGCATCCTATATAGTCCCCGAGCACCGATGGGAGTAATT
CCTGAGTGTAGAGCCAGGATTAACCCCTGTGCATCGCCAGGTGTGACCCAAAAAGAAAAA
AAAAATTATTCTTTTAGGACAATAATTGGTATATCAAAAGTAGTCAGGATGGATGGAGAT
GTGACTTAAAGAACATGCTTTTCTTATGTGAGGCCTTAAGTATGATCCCTGGTAAGGGGG
AAAAAGTAGCTTAAGGAAACTGGAAATAATTAAATACCAAAGAAAAGGAGATGAAACTTT
TTTTTTTTTTTTTTTTTTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNTGTGCTATTGCTCCACCCCTGGTGAGAAACTCTTTTAACTTCGTGATTATTTGTT
TTATGTTTGTATTTATTTTTGTATCATATCCAGCAGTGCATGGGAGATCACAAAATGCCA
GAGATTGAACTCAGGCCTTCTACATACAGTACATGTGCTATAATCCATTGAACTAACTCG
TTGATTCAACAATTTTCTTTTGGGTGGTGGGGAAGGTTCGTGGTACATCTTGGGTACTCA
GGGCTTTTCCTGACTCTGTTCAGTGCTTACGGGACTCTGAACTAATCTAATCAGAGTTAG
CCACATGCAAGGTTCCAACTCAGTTTTGTTTCCTTAAACTGATAATAGATTTTGGTTAGT
AAGTATTTTACATTTTGTAGATTATATGGTCTCTGCTGCAGCTCTTTAACTCTGCTGTTG
TAATGCCAAGTAGCCTTAGATAATTCATGAACCATTGAGTATGGCAGTGTTCCAAATACT
GTTTATTTGTGAACTGATGCATTAGCTTTGACTTGGCTGATGGGTGGTTAGTAAAAGTAT
AAATGTATAAATTATAAAAGTATAAATTCTGGCAAAGGAATTATAGGTGCAAAAGTCATG
GTGACACATGGCATTTTGGAGAATTGCACCTTTTAAAATTCTGTATAATTCATATTAGCA
TTGTTTATCCTGAGCATCAGAACTCTGGTTTACAGTGTGAGATTTGAAGACTGAACCTCA
GCCAGAACTTACTTAATATTAATAGTGTATTTTATACAAGAAGAAACTGGAGGAGAAGTG
GCAGAGCAGGGGCCAGAGTGATAGTACAGCGGGTAGGGCATTTGCCTTGCATTTGGCCGA
CCCAGGTTCGATCCCTGCTACTCCATATGATCCCCAAGCTCGGCAGTAGTGATCCCTAGT
ATAGGGCCAGGAGTTATCCCTAGCAGCGCTTGGTGTGGCCCCAAAACAAATCCCAAAAAA
GGGGTAGAGCAGAGTGACTGAAAAGTATTTATAAAGCAGTTTTGCATAAGCCTAGATAGA
CTTCATGTTTCTGGTCACTTAGGTACTGCATGACTAATTCTCTTACCCTTTCTCATTGAG
GCAGTTTTAGGCTGACATAGCTTCAAGTATTTTCTGAACTTCCATTCCCACTTGGTGTTA
AAATTATGAGGTTCTATTCTTCAGTGCAAATCATTAAGGAGAAAAAAAATTTTTTTTTAA
ATTGAATCACCATGATACACAGTTACAAAGCTTTCATGTTTGAGTTTTAGTCATACAATG
AGCGAACACCCATCCCTCCACTAGTGCACATTCTCCACCACCAATGTCCCCAGTATACAA
CCCCCTTTCCTAACTCTCCCCCTGCCCCATACTCACTCTCTCTACTTTTGGGCATTATGG
TTTGCAATGTAGATACTGAGAGGCTATCACATTTGGTCCTTTATCTACTTTCAGCACATA
CCTCCCATCCCAAATGATTCCTCCAATCATCATTGACTTAGCTTAGTTCTGCCTTAGCTG
CCTTCTTCCCCAGCTCATGGGACAGGCTTCCAACCATGGAGCAATATTCATGGCCCTTGT
TTCCACTGTCCTTGGGTGTCAGTCTCATTATTTTATATTCCACAAATGACTGCAGTCATA
CTATGTCTGTCCCTCTCTTTCTGACTCATTTCACTTAGCATGATACTCAAGGAGAAAAAT
TCTCTTTTAAGATTTTAAAATTTTTTTAATTTTGATTTAAAAAAAAATTTTATTAGTGAA
TCACCGTGGGTTACAGTTACAGATTTACAAACCTTTGTGCTTGTGTTGCAGTCATACAAT
GATTGAGTACCCATCCCTTCACCAGTGCCCGTTCTCCACTACCAATGATCCCAGTATCCC
TCCCAGCACCCCTACTCCCCCTACCCCCACCCCGCCTCTGTGGCAAGGCATTCCCTTTTG
TTCTCTCTTTCCTTTTGGGTGTTGTAGTTTGCACTAGAGGCATTAACTGGCCACTGTGCT
CGATCTATAGTCTACATTCAGTTCGCATCTCCCAACCAGAGCTGGTTCTCCAAATACCCT
TTACTTGGTGTTCCCTTCTCTATCTTAGCTGCCTTTTCCCCCAGCGTTTGAGACCGGCTT
CCAAGCCATGGAGTAAACCTCCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNTTTAACCAGTCATCTGTTCTTGGGCACTCGGGATTTT
TCCAGATTTTGGCTATTGTAAACAGTGCAGCAATGAACATACATATGCTCTGTCCCACTG
AGCACTCTTTCCCCCACTTTATTTTATTTCCTCTCCCACCTGCCTTTCTCTTTTCTGTTA
CAGTCACCAGGGGTTCCACATTTGCCTAACTGTAGTGCTCATATACTTGGTCTCAGTTGT
CCCTGAAGTTTTTATACTCCTTTAGTTATTGCTTGCACAAATGTTTTGCTACAGGTCACA
CACTTAATTGAGACACCCAAATTATGGTTATGGTGTTCGCCAGAAGTCACGTTGCCTGGC
AAAGTGCTGGCACATCTTTCTAGCTACAATACAGCCAGAAATGCTTTCAGTGCCAAAGAT
CACAGAGAGCTGCCAATGGGACAGTTAGACTCAACCATACACTTGCAGGGCAGGTGCTTC
AAGATACTGAACTCTTTCATCAGAACCATGAACTTGTGTTTTCTATAGGAAGTTTAAAAA
CAGTGATAAACTGAGTCATGATTCTTCATTTAAGCACAGCTAGTTTGTATTTTCAATTTA
CAAGCACTTTCTTTTTTTTTCAACTTCTTCACTTATATCTAAAATAGTGCTGCCCTTGTT
TATTTTTCCTTCTCTATCCCATTTTATTTTCCTTGGTAGGTTTTAATATTTGGAAAATAC
TTGAAAAAATACCTCTCTTTTTGATAGTATCTCTTCCCACTCCAAGAGGTTTAAGAATAT
GGATTTTCTTGCTTATTGATATTATATCAACACCAAAGTGCTTTGTACATACTGTATACT
TAATAAATGTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNGGTACGGCACTGCCCTGCATGCAGTTTACATCAACTGGTTGATCCCTGGTACCACATA
CAGTGTGGTCCCTTAGCCAGGAGTAATTGTTAAGCATACCACTGGTTGTGGCACACTTTG
CACCTGCCAAAAAAGAAAAAAACGAGGGGGTAGGAGAGATAGTATAGCAGGTAGGACATG
CAGCCAACTTCTATGCATCCAACCAGGTTTGATTGCCAGCATCCCATGTGTCCCCCAAGC
ATCACCAGGAATAATTATTGAGTACAGAGCCAGTATTGAACCCTGAGCATCATCAGGTAT
GGATCAAAAAACAAAACAGAAAAAAAATTGGGGCAAGAGAAATAGCTCAACAGACTGAGT
GCATACTTCAGATGCCAGAGGCCCAGGTTTGATTCACCAGTACCACATGACCCCTCAAGC
AACACCAGGAACTACCCTGAGCAGAGAGCCAGATGTAGCCTCTAGGCACTGCAGAGTTTG
GCCCAAATATTAAAAATAATAATAATAATAATAATAATGTAGCTCTTTGTAGAGCACTTG
CCTTGCTGTGTGAGGCCCCGGGTTCAATCCCTGGGAAATAAATAGTTTGAAAATAATTTG
TTAAAAATGGGGTCTCGGTGGGGCTGGAGCGATAGCACAGTGAGTAGGGCGTTTGCCTTG
CACGCAGCTGACCTGGGTTCGATTCCCAGCATCCCATACGGTCCCCTGAGCACCGCCAGG
GGTAATTCCTGAGTGCATAGCCAGAAGAAACCCCTGTGCATCGCTGGGTGTGACCCAAAA
ATAAGAAAAAAAAATGGGGTCTCGGGATGTGACTTAAGGAGTATGTACATACTTTGCATG
AAGCCCTAGGATCAGTCCCTGGCACTTATCTCATAGCACGCAGATACTGCCAAGAGCAGC
GCTGGTGCTCCCAAGGCACCACAACATTGCAGCAAACCCGGCAGGTTTCTTTGTCAAAGT
AAGAAATAACCAGGAGGGGCTAGGTTGCCTTGCATGCAACTGGACCAGTTTCGATCCCCA
GCATTTTTGTATGGTCTCCTGAGCACTGCCAGTAGTGATTCATGTGCAGTGCCAGGAGTA
ATCTCTGAGCATCACTGGGTGTGACCCCAAAACAAATGAACAAACAAACAAACAAAAGAG
AGTAGAACACTTTGTGTTCCACTAGGAACTCACAAGAGAGGGTCACTAAACTTTAACAGC
CTTTGTTTATTATCCTCTATTTGCAATTTTCTGGTTATCTTACTGATCAGGATTGAGTCA
TTTTACCACATTGAGGCAGAAAAAATTTGTCATTGGGAAGTATTAAAAGCTCTTTACAGT
TCAACAGCAGGTAGGGTGTTTGCCTTGCACACAGCCGACCCGGGTTCGATTCCCAGCATC
CTATATGGTCTCCTGAGCACCGCCAGGAGTAATTCCTGAGTGCAGAGCCAGGAGTAACCC
CTGTGCATCGCCGGGTGTGACCCAAAAAGAAAAAGAAAAAAAAAAAAGCTCTTTACAGTT
CAGCATCAAGGCCAAAGAACAACACAGGGGTTAAGGTAACTGCCTTGCTTACAGCCAATA
CTGATTTGAATTCTCTGCTCCATGTATGGTCTCCTGAGCACCGAAAGGGGTTTCTACAGA
GCACTTGACAGCTTGAGCACTGCCAAATGTGGCCCAGAAACAAAAACAAAGTGAAAAATA
AAGTTCAATATCCAGATATCACACATTTGACCTTTGAAAGTCATTTTCTGAATAGCATTT
TTAAAAGTCTTTTCAGCATTATCAAGGTTTCCCCAAGAGGATGCACTGTGTTCTTTGTTT
CCATGACTCATCTAAAGCAGAGCATATTTTACTAGCTTACAATGCTATTTACTCCTTCTG
TTCATTGTAAGGTAGCTTCAAGTTGTTTTTGAACAATGAGATGCTGCCTTTCTTTTTAAC
CAGAAAAAAAGTAAACTATTGATTTTTGAAATATTTTCAGTTACCGAATAGCAGCAAAAA
AATGGTTTCTCTAGGGCCGGAGCAATAGTACAGAGGGTAGAGCATTCGTCTTGCATACTA
CTGACCCAGGTTCGATCCTAGGCATCCAACATGGTCCCCCAATTACTGCTAGGAATAAGT
CCTGAATGCAGAGCTCGGAGTAACCCCTGATCATTGCCAGGTGTAGCCCCCAAATGAAAA
CAAACCGAAAAATAGAAATAGTTTATTGGGCTCTATTGTATGGTCTTCGAGAATATAAAC
AATTATACTATAATAAAGTGTTCCTGCTTTAGAAAATCTTCAGAAGATTTCTGAATCACA
GCACACTTGTCATTTTGGTCAGTAGATATATGTAGGTGATGGCTATTAGGCTAATTTGTG
TATATAAGTTAATATTATTTCTTTCTGAAACTATGCTTTTTTATTTTTTTAAAGGTGGTC
AAAGAGCTGGTCCTCCTCAAAACCAGATGCAGGTGCCCCACGGGCCACCAAATATGATGC
AGCCCGGCCTCATGGGAATTCATGGCAACATGAACAGCCAGCAGTCTGGTAGTTCCGGGG
TTCCTCCGGTGAACCTGGGCAACATGCAAGGCCAGCCCCAGCAGGGCCCGCCATCTCAGC
TGATGAGCATGCACCAGCAGATCGTGCCCTCCCAGGGCCAGATGGTCCAGCAGCAAGGAA
CCTTGAACCCTCAGAACCCTATGATCCTTTCCAGGGCCCAACTTATGCCACAGGGCCAGA
TGATGGTGAACCCTCAAAGCCAGAATCTTGGGCCCTCGCCCCAAAGGATGACCCCACCCA
AGCAGATGCTTCCCCAGCAGGGCCCACAAATGATGGCGACACATAACCAGATGATGGGGC
CTCAGGGGCAAGTTTTGCTCCAACAGAATCCAATGATAGAGCAGATCATGACCAATCAGA
TGCAGGGGAATAAGCAACAATTTAATACTCAGAACCAATCCAATGTCATGCCGGGACCAG
CACAGATAATGAGGGGACCAACTCCAAACATGCAAGGAAACATGGTGCAGTTTTCGGGAC
AGATGTCAGGACAAATGCTGCCTCAGCAGGGGCCTATGAACAACAGTCCGTCTCAGGTTA
TGGGGATTCAGGGGCAGGTCTTACGACCACCAGGACCCAACCCACATATGGCCCAGCAGC
ATGGTGATTCTGCTACTACAGCAAATAATGACGTCAGCTTGCCTCAGATGATGCCTGATG
TTAGCATGCAGCAAGCCAACATGGTCCCCCCTCATGTGCAGGCCATGCAGGGAAACAGTG
CCCCAGGAAACCACTTCTCAGGCCATGGAATGCCCTTCAATGCACCTTTCAGTGGAGCAC
CCAATGGAAATCAGATGTCCTGTGGTCAAAATCCAGGCTTTCCAGCCAATAAGGATGTCA
CGTTAACAAGCCCATTGTTGGTCAACTTATTGCAGAGTGACATCTCTGCAGGCCATTTTG
GGGTAAACAATAAGCAAAATAATGCCAACGCAAATAAACCGAAGAAGAAGAAACCCCCTC
GGAAGAAGAAAAATAGTCAGCAAGATCTAAAGTAGGTCGCGATAGTTTGCCTCAAATCTT
ATTCATTTATTTCTATTTGGACAACTTTTTGATGGAGATTTCTAAACATCTAATAATATA
TATTCTAATTTTATAATGCAGCATAATGAAATTCCCCTGCTGCAACCTGTTGCCTGTCTT
TTATTGTGCTCTCCCTGCTACCCTTTTGATTATTTTAAAGCAGAGTCACTAAGTATGTCA
GCATATACCTCTGAAAGATAATGACAGGTTTGCATTTGTTTTGTTTTTGTTTGGGGACTG
CTATTTTTGATCTGGTTCTACAGAGTTGCTTCCTGCAGTACTTGGGGGTCTGTGTCATAT
GGCAGATGAAACCCAAGGCTTCAGCATACAAGCATTCTCTTCAGTTGTTAGAGCCATCTT
CCCAAACCCAATGATGATTTGTTAATGATTTCTTAATGACCACATAAAGTTTATACATTG
CAGCATGCCTATTAAGTCTCAGGTTTGGCACTGGGCCTTAAAAGTAGCCATTGAGGCTCC
TCAGAGTGTTCAGGCTTACCATGGCTCTTAGGGAACTAGGAAAGCCAAATGTGTTTTGGA
AATGAAAACTGCTTGTGGATTATTTGTGCTCCACAGAAATTGTATTTCTGTACTTGCACT
TTTCACTCAGAAGCTCTTTATCACCCTTTAGAAGCTTAAGACCTCACGTCAAAACGATTT
GACATTTTAGGGACTGGAGTGATAGCACAGCGGGTAGGGCATTTGCCTTTTACGTGGCCA
ACCCGGGTTCGATTCCCAGCATCCCATATGGTCCCCCAAGCACTGCCAGGAGTAATTCCT
GAGTGCATGAGCCAGGAGTAAACCCTGTGCATTGCTGGGTGTGACCCAAAAAAGCAAAAA
AAAAAAAAAAAAAAAAAAAACGATTTGACATTTTAAATCATTTACTCTTTTGGTAATGAT
TCTCCAGTTGTATTCTTTTGCAAGATCCCAGCAGGAGGGCAGTTAACAAATTTTGTTTTA
TTTCCTGAAGCAAGGTGTTAATTTAAGTTATGTTCTTAGCTTTGATAAAGTGTTTTCAGG
AGGAATATTGGTTTATGTGAATTTTATTATTTTAATCATTAGCAGGGAATAGTGACTAAT
GCAAAACAGGTTAATTGAAGTAAATTGCTTGACCTGTAGGGAAAAAAATAGGGGAGCTTT
AATTAAACAGCATGAATGTTCAAAATAAAATTAAACTGTTTTCCAGCCTTCCCACAATGT
TTCCTTGGTTATACTCTAATATTATGTCATATGCATTAGGTTGTCAGTAGTATACAGCCT
GTATTTTACTGGATTCAGACTTAATCAGCCCTTATTCTAATTTATCTGAAAGTGATTTTT
AACTAAAAATATTACTCTTCTCACCTAGTGGGGAATTGTGTGTGTGTATGTTTTCCTGTG
TATGTTATGGATGTGTCTGTGTGTATTCCATGTGTGTGTCACATGTGTGTTCTATATGTG
TGTGTTCTCCTTACTCCAGGGCCAGAGAGATAGCACAGGAGGAGAGCCAGAGAGATAATA
CAGGAGGGCCAGAGAGATATCACAGTAGGGCTGAAGAGATAGTGCAGGAGGCTCAGTGCT
TGCCTGCATGCTTCCCAGCACCATATATGGTCTCCTTGTCACTACCAAGGGTCATTCCTG
AGCACTGCCATGTATGGCACCAACCCCCACCCCCCAATTTTTTTCCATCCCAGTAGTCTG
GCAGTAAAATTGCAAAGTTATTCAGTTGCTGTTAGTGTGTATTTTGGTTTCTTCACCAAC
CCTGTGGAGATTGTTTCTTGTTGAGGGATACCGTGGTGAAAAGGGCTTTATAGGGCATCA
GAGTTTCTAGGAAAGGGAAATTGTAGGTTTAATAGGTAAAGGACTGTCTCAGCTCTCTTG
GCATGTCTCATAAAGTGTGGACCTGTCTTTTACACTTCTCTTTATTTTTCTCTAACATGA
AGTGGCAGGATCATATATCACATTATTGTTAGCAGCACAATTCCTAAAAGTGAAGAATAC
TCCTAAGTTCTTGCTTGTAATTTGCATTGAGAGAGGCCATAAAGATAGTAAAGTGGGTAA
AGAGCCTACTTTGCATGGATTCAATCTCACTTTGCATATGGTTACCTGAACCCCATCATA
AGTGACCTCTAAGTACAGAGGTAAGAGTGAGCATTGAGCCCAACTGGGTGCAGCCCAAAA
ACCAAACCAAAAAATTTTTTGCAGTGAGAAAAACAACCATGTAAGGAGCAAATCAATACT
GGCATCAGATAAGGACAAACTTCAGGTTCTGAATTTCCATCTTTTCTAGATGGATCTGAG
ATGAGACTTATGAAACTGCTCAGAACTGAAGTGATAAAATACTGTCCAGAAATTAGTGAC
CCAAGATCTAGCCCAAAAGAAACTAAAGGTGGGGGGGGATGCAACTAATGTTACAGACAA
ACAGGGTCTTGGGAAATGTGGGTGTTAGCATCTTAGCATTTTCTTGTTCCCCACTAAAAC
TTTTAAGCTAAACCCAGGTGAGAAATAAAAGCATCCCAAAATCAATGAGAACATCTATAA
ATACTCATTTTGCTGCAGAGTTAATTAGCTTTGCTCTAGCGTTCCCTGTCTTTGTTCACT
GAATACATTTTCATCAGACATCCTACAAGTTCTTGCAATGTGTTATGAATTGTTGGAGGC
TCCATTAGTAAAATTCACACTAAATAAACAATGTAGATTCCCAGGTTGACTTTCATGGCA
ACACCAAAAGACATTGTGGCTTCCCATGAACCATGTGACATATACTGTTAGTAGCCTAAA
CTTTCATCAGGCATTAGGATGTGTAAGGGGTGGTCAACTACATGAAATTATATCAGACGT
TTTTAGAAAGTACTTTGGGTCATTTAGTCAAACTTCAATTTTGTTTTTATTTGTTTCTGC
AAGGTTCCACCCAGTGGTGCTCCAGGGATCATGCAGTGCTAGGAATTAAACCTAGGCTCC
TGCATGCAAAACATGTGCTCCAGCCCTTGATTCATTAAATGGATTTAAGTGGATTCTAAT
GTTTAATAAATTCCTAGATTATTTGTGCCAAATGATGAATATTCAGTATAAAATAAGTTT
TGAAAGTTAAAGATAACCAGGTTGGTGATGCCTTTAGGTTTTAGTTCTTCAGAAATAGGA
GAGGGTTTAAGTTTTTTGTATAAATTACGCAACTTACTCTTACTTGTATAATTTATTTTT
TAGCACCCCAGATACTCGCTCAAGTGGTCTAGAGGAAGCTGATCAGCAGCCAATGCCTGG
AGATCAAGGAATTAACTTGGACAACTCAGGCCCTAAACTGCCAGAATTTTCAAACCGACC
ACCAGGTGATGAAAATAAACATATACCTCTCACCGTTTATACAGCAGTGCAAGGCTTCTC
ATCAAGGAAATAATAGTATTTTATTTTTTGTCTTTTAAATAGGGTTCTTTAGGAACATAC
TGTGTTTTATGTGGAAACCTTGCCTTAATATTAAGTAAACTTTCAAATATAATTTCTGAA
GGAATGTGTAAAGATTTCAAGTTTGTCTTGAGACTAAAATGTCATGTGCCTTTCTATATA
GTCTTACTATCAAGATTCTAGTTGGCATCAAAATGAAGTAAAATTACACAGGGACATAAT
TTTACTCTAATCTTCTAATCTTATTTACCTGATTTTCTTACAGCCCTTCATACTGGGGTT
TTCTCAAAACAGAAAACTATCTGGATTTAAAACAATATTGTTTTTTATATAAGAGGTTTA
TTATTAATCTATAAAACATAAAAACACATAAAAATAATAAAAGAACCGATTATGTGCATA
ACATATAGCATAATAATAAAAGAAGACAAACGTTATTGAAGTCCCCTATGTTATACCCCT
CTCTGATTATAAAATAATTGTATCTAAATATTGAGAACTTACATTAAAGAGGAAAATGTT
CCTATCATACATTCATTCCAGTCTTAGTTGTAGGCCCATGGCCATCTGCTACAGTATCTC
TGCACCTGAACAGTGATTTGTAACTGTATTCCCCTATAACACTATTGAATACATTGTCAA
CAGAGTTAACAGTTTCCTCCTCACTAGTTACTCATCTTTTCTTTTCTTTTTTCTTTGCTT
TTTGGGTCACACCCACCAATGCCCAGGGTTACTCCTGTTTCTGCACTCAGGAATTATTCC
TGGCAGTGCTCAGGGGACCATATGGGATGCTGGGAATCGAACCTGGATCGGCCACGTGCA
AGGCAAACGCTTTACCCACTGTGCTATCACTTCAGTCCCTATTCCATCTATTTTTTGGCA
TGAGAGAAAAATGCTATTTTGGGGCTGGAGCGATAGCACAGCGGGTAGGGCATTTGCTTT
GCACGCGGCCAACCCAGGTTCAAATCCCAGCATCCCATATGGTCCCCTGATTACCACCAG
GAGTGATTCCTGAGTGCAGAGACAGGAGTAAACCCTGTGCATTGCCAGGTGTGATCCAAA
AAGAGGAAAAAAAAATGCTATTTTTAGGAATAACATTTTAATCTACACTTTATAGATTTT
AAAAGTGAATTCAAAATGAAAAGGTAAATTCATCAAAGTGCTTTGTGGTATTTCTTACGA
ATTGTTTAAGCTTCCCACTATGAGGTACAGTAGGATAACTCACAGCACAGTTGAGCTGCA
AGTTGACCAGATTTGGGCAGACTTGTATGCCCAGAAGAATTTGGAACAGGAAGGTACCTT
CTTACCCAAACACACCTGAATTCTTTCATGAATTCCAGAGGTCCTTACACACTTTCTTGT
TCTTTTTCTTCAAACTGGGGAACCTACAGGTTAAATTTAACCTGTTTGACTTAGTAGTGT
TTTAAACCAAGCAGAAACTTGGATATAAATGCGTTTAGACAGAGCATATAATTTTTCTGT
CCCGAAAGCAACTACTATCCATACCAGCTCACTTCTTTTCACTAATGGGCTGGTGGGTCC
TCAAAACATTTGAACTTTCATCCCTTAATTAATAAATGTGGTTCTGAATATGGTATAGGC
CCTGTGTGTTTTAGCTTTCGCTCTTCATCATTCTTTGACATGGCACCCATAGTTTATCTT
CTTATTATTAGTTCCCTTTGGACTGCTACCTCCGGCTTCCGGAAACTTTTCAGCAACTAT
GCCATATTATTTTCAAGAGGCTGCTATATTTTTTATGCTGCTCTTTTTTTTCGGGGGGGG
GTCACACCCGGCGATGCACAGGAGTCACTCCTGGCTCATGCACTCAGAAATTACCCCTGG
TGGTGCTCAGGGGACCATATGGGATGCTGGGATTCGAACCCGGGTCGGCTGTGTGCAAGG
CAAACGCCCTACCTGCTGTGCTATTGCTCCAGCCCCACTATGCTGCTCTTTTGGGTATTT
ACTGTGCTGTCTGGTGGACCAAAAGGCATTTTTGTCTTAGTCTTGACATTGAAAAACATC
TACAGAAATTGCAATTTTCTTAATTTGAGAACCCCAATTAAATCTGTTTTTTAAAAAAGC
CATGATATTGTCTTTACAAAAAATATATGTAAAATATGTAAAAGAATTTATATTTTTAAA
AAGAATATAGAGAGTAGGTATGCAGTACTAAAACAGCAAAGAATTTTCTTTTTAAAAATA
TTCAAAACTGGATTCTACACATTACACTCATTCATGTCATGGAAATCCTGGCCCGAAGAT
ATCAGTTAGCTGTTGAGCATAGCATCTGACCCCGTGGATTAGCATTTGGTAACTATTCTG
TGACAGTCTGAGCCAACATTTCTTCCAGCTGCCAGAGCCAGTTGTTCAGATTCCTGCGCC
TTCTTAAAACGTCCTCATTTATTTTTCATACAACAATGGAATAAATTTAATTTATAAAGT
TGTATCCCAGCTATTTACTCATTTTACGCCACTGAACCCCCTCTTTTTTCTTAACTTTGT
GATCATTACCTCTGTTCTGATTGTGTAAGATGTTGGTCTAAGTTGCCAAAAGAAATCCTT
ACAAAGCAAGAACCATTTGAAATGCCATCTGCAAATATATAAAGTATTAATTGTCCTCAG
AGTTTGTGTCACAAAATTATTTTTTTACTACCGAGGGCTATACTCCTGACTTATTTATTG
TCCATTTGCAGATTCATAGGAAATACTTCTTCAAAGAGTTTTACATGTAAGAAAATAAAT
AGAAGTGAATAGCCATAAAATCTTTAGTGTCATCATTTTATTTTTAATTTGTATCAGTCT
CTGTTACCTCCTTCTATCTTTTTCAATGATATCTGTCGGAGGGGCAGTTTAATCACCGTG
GGTTCCCCAAAGGACTGAGCTTGAAAAATTCAGCATGGTTTGGAACTAATGGATTGGAAT
AATCCCAAATTCTTCTAAGCAATTGAATCCTAGGATTTTCATATTTTACTTCTGTTCAAA
GAATAAAAATGCTGCTTCTATGTCAATAAAATCAAGTCTTTAAAAAAAAAAAAAATTTAA
CCCTGTGCTTAAAAAAAGAAAGTTAATCCTAACTTCATTCACAAGTGCAGTAAAAGGGTC
ATTGTTCCTGCATAGAAACCCCAGTGCTGGATGGTCAGCTACTTGCTTTTGATGAAGTTT
TTCTCATTTCTGAGTATTTGACTGATACAGAGTCTGCTACTTCCATGTCTAGTGAAATGC
CTGTGAAGCTTTAGGATATGCAGTAATGCCTCTTGCAGCCTCGAAGACTGAGGAGCTCCA
GGTTGTTGGTGCTTTGCTTGCTGCTTCCTTAAGCAGTGTGCTCTTTGCTATGTCAGAGAA
TGAAGGGGCGCCCCTCCCCCAGAAGCAGGCAGGCCTTCATGGCTTGTGCACAGATGAGTA
TTGCTTGGCTCTACTCTAAAGGTAGCAAAGCCTTTTTTGCTGAAAATCTAACTTCCCTGA
TTTTGGGGGCTTGTTTTAGGTTATCCTTCTCAACCAGTTGAACAGAGGCCACTTCAGCAG
ATGCCTCCTCAGCTCATGCAGCATGTGGCACCCCCACCACAGCCACCACAGCAGCAGCCA
CAGCCACAGCCACAACTGCCACCACAGCCACAGCAGCCGCCACCACCTCCCAGCCAGCCA
CAGCAGCAGCAACAGCAGCAGCAGCAGCAGCAACAGCAGCAGCAAATGATGATGATGCTC
ATGATGCAGCAGGACCCCAAAGCAGTTAGGCTTCCCGTCTCCCAAAATCTTCATCCCCCC
CGGGTTCCCTTGAACCCAGACCCTCAGAGAATGCCTGTGCAGCAGAGTGGCGGTGTGCCT
GTCATGGTCAGTTTGCAAGGACCTGCCTCCGTGCCACCGTCACCCGACAAACAAAGAATG
CCAGTGCCCGTGAATACTCCTTTGGGAAGCAATTCAAGGAAGGTGGTATACCCGGAGAAC
CCCCAGAATCCTTCCAACTCACCACTGGGTGAGATCTCTTCACTCCCTGAAGCAAGTGGC
AGTGAAGTGCCACCTGTCTCAGGAGGCCCCAGTAACCTGCCTTCGCATTTAGTGGTTTCC
CAGAATCAGTTAATGATGTCCGGGCCCAAACCTGGGCCATCCCCCCTCTCAGCAGCTCAA
GGGGCCACTCCTCAGCAACCTCCGGTAAATTCACTGCCCAGCTCTCATGGCCACCACTTT
CCGAATGTGGCTGCTCCAACCCAAACTGCTAGGCCTAAAACACCCAACAGAGCTAGCCCC
CGTCCTTATTATCCTCAGACACCCAATAATCGCCCTCCCAGCACAGAACCATCAGAAATC
AGTCTGTCCCCAGAAAGACTCAATGCCTCGATAGCAGGACTCTTCCCCCCACAGATTAAT
ATTCCTTTACCTCCTCGGCCAAATTTAAACAGGGGCTTTGATCAGCAGGGCCTGAATCCA
ACGACTTTGAAGGCCATTGGCCAAGCACCTTCAAATCTTAACATGAATAATCCTTCCAAT
TTCACCACCCCACAGACTCACAAATTAGATTCTGTGGTGGTGAATTCTGGAAAGCAGTCC
AATTCCGGAGCAACAAAGCGGGCAAGTCCAAGCAATAGTCGTAGGTCTAGTCCTGGGTCC
AGTCGAAAAACCACTCCAAGTCCTGGGAGACAAAACTCAAAAGCCCCTAAACTTACTCTG
GCCTCTCAATCGAACGCGCCCCTGTTACAGAATGTGGAGTTGCCAAGAAACTTACTGGTC
AGTCCTACTCCTTTGACCAATCCCCCCATACCCGGGAGCTTTCCTAACAACACGGGGCTG
AATCCGCAGACTCCTGGCATGCCTGTGGCTGCAGTGGGGAGTGTTCTGGAGGATAACAAG
GAGAGCATGAATGTGCCTCAGGACAGTGATGGCCACAGTTCCCAAGGGAGGAAGGAACAG
GCAAACATCGAGCTAAAAGCAGTTCCTGCCCAAGAAGTTAAAATGGTTGTCCCTGAAGAC
CAGTCCAAAAAGGATGGGCAGCCTTCGGATCCTAACAAACTTCCCGGTGTTGAAGAGAAC
AAAAGCTTGATATCTCCTGCCATGAGGGAAGCGCCGACATCATTGAGTCAACTTCTTGAC
AACTCTGGAGCTCCTAATGTGACCATTAAACCCCCTGGGCTTACTGATCTGGAAGTCACA
CCCCCAGTAGCTTCTGGGGGAGGACCTGAAAAAGTCATCTGTCATTCCCACACTGCAGGA
TCCGCCGCCTTCTAAAGAACCCTCTAATTCCCTCAGTTTACCTCACAGTAACGAATCGTG
CACAACCCTTGTGCATCCTGAATTGAGTGAGATCAGTTCTAACGTTGCACCAAGCATCCC
TCCAGTCATGTCAAGACCTGTCAGCTCTTCCTCAATTTCTGCTCCTTTGCCCCCAAATCA
AATCACTGTCTTCGTCACGTCTAATCCCATCACAACTTCAGCTAACACATCAGCAGCGCT
GCCAACTCACCTGCAGTCTGCACTAATGTCAACAGTTGTCACGATGCCCAGTGTGGGCAA
CAAGGTGATGGTTTCTGAGGGACAGTCTGCTGCCCAGTCGAATGCCCGGCCTCAGTTCAT
CACGCCTGTTTTTATCAATTCATCCTCAATAATCCAGGTTATGAAAGGATCCCAGCCGAG
CACAATTCCTGCAGCCCCACTGACTACCAACTCTGGCTTGATGCCTCCCTCCGTGGCAGT
CGTGGGCCCTTTACACATACCTCAGAACATAAAATTTTCTTCTGCTCCTGTACCGCCTAA
TATTCCCTCCAATAGTCCTGCTCCAAATATCCAGGCAGGCCGACCCATGGTCCTTAACTC
ACGAACTACCCCTGTTCCACTTCCATCCCCTCCTTGTACAGCTGCTCCAGTTGTCCCCCC
TCATCTGCCTGTCCAACAAGTGAAAGAGTCGAACCCGGATGAGGCTAGTCCTCAGGTGAA
CACCTCAGCCGATCAGAGTGCTCTGCCTGCCTCACAGTCAGCCGCAGGGGTTTCTCCCCT
TTTGAGCAGTAGTCCAGGCTCCTCTGTCAACCGACGAAGCCCAGTCTCATCTAGTAAAGG
CAAAGGAAAAGTAGACAAAATCGGCCAGATTTTGCTGACAAAGGCATGTAAGAAAGTCAC
AGGGCTCTCTCGAGAAGGGGGATGAACAGTATGGTGCAGATGGAGAGGCCGAAGGCCAAG
GAGTAGAGACAGCAGCTCCAGGGCTCATGACAACAGAGCAGTTATCCACAGAGCTGGACA
GTCAAACCCCAACACCCCCAGCACCCTCTCTGCTAAAAATGACCTCCAGCCCTGTGGGCC
CCGGCTCTGCCTCAGCAGGACCCAGCTTACCCGGCGCTACTCTCCCCACCAATGTCCGCC
CAATAGTAACCACTCTGGTACCCTCCGAGCTCATCTCCACAGCGCCGACCACAAAAACCA
ATCATGTTGGCATAGCCGCTGAGCCACTCGCAGGTGGCGTAGTGGAGGAGAAAGTGGGAT
CACATCCAGAGCTGCTCCCCAGCATAGGTATGTACTCAGTTACTGGCCTGCCACCATCTC
CTCATGTAAGTTTTTTGAAACCTATCCCACCAGAGAAAGCATTTCTCCTTTCTACTTGGA
GGAAGAGAAGTGGGCTAGATGACAGTAGTAGAAGTCATGGTAGTTTGAGTGTTTGGAAGT
ACGTTGGGAAAGAAGATGTGAAATCAGGCCAGAGTGATAGTACAGAAGGGAAGGCATTTG
CCTAGCACATGGCCAAACCAGGTTCAGAGCTGGCATTCCATACGGTCCCTCAAACACCAC
CAGGAGTGATTCCTGAGTACAGAGCCAGGAATAACCCCTGAACACCAACCGATGTGACTC
AAAAAGAAAATGTGAAATCCCATGTCATGCTTGCTTCATTAACATGGTTTTCTTCTATCT
CCAGAAATGAGGTACTTTGAAATAATGATGTATAAGTTTTTCACATCAGAGCCAGAGCAG
TAGTACAGCAGGTTTTCCTAGCACAAGGCTGACCCGGGTTTGATCCCTAGCACTCCATTT
GGTCTCCTGAGCACCACCAGCTTGGCTCAAACTACCCACACAAACACAGACACACACACA
CACAAAAGTTTTTCACTTGGAAGTATCTCACATCATCTTGAATTGTGTCAGTATTCCTTT
TCACCTTACTCAGAGGGTTAGAAGATTAAAGATTAGAGAAGTTCAGAATTTATCAATCTA
TACAGTGAGCCTGCAGTTTTACAGGGTTAAATGTAGACAACAGCTTCTATGGGTTGGTTC
TCCTTATTTGCTCCTGGCAGTTTCAGAGCACTGTTCTCATTGTTCCCTCTTCAGTATTCT
CTAGCCCAGGGGCCATTTCCTTCCAGCTGCTGTAGAAAAGAACTGTCCAGTAACCAGACT
TCATGATATTAGATAAGGAAGAGCAAAGTAGCTGTCAGATATTAGGCTTCATTTATCAGC
TGTCTGGGCTTGTACACGTTACTTGATCACTCCACACTTATCAGTGTCCTTCCTGATAAT
AGGAGGACAGTAGAAATAAGATGTTTATAATGAGATGATGCATATACAAACTTAGTACCG
AACCTACAATATTCATTCAGTAAATGGTAATCCGTTACTAGTTTCTTTCCAATGCAGTTT
CTTTGTAAATTGAACCATTCTGTTCTTATGTATCTAGTTCAGATTATCTCCTGTGAAAAT
TATAAAAGAATGGATGTTGTTATAACTCCCCTCCTTCCCTTTATGCCCCACTACACAAAT
TTTTCTGTGAGGCTTAAGTGGTACAGAAGTTCTGTATCCGGACAGTGGAGTCAGTCACAC
ATTTCCAGAACTAAGAAGGACCTTTGTTGGAGGGCCAGCTAATAATGCAGCTAAGATGTT
TCAAGTGCCTACCACTGGGCCATAGATAAGCTCCCAGGAGAAAGGACAGAACGAATCCAG
GATGTAGGCTAAGATCAGAGTTTAGATTCTAGCGCCACTGGTCACCAGTTGCAGTGGGAT
GGATTCCTTAACTTCCCATAAGCCATGTATTTTACCTGTGAAATGGAGATTATAATTCCC
ACTTTCCAGAATGTATACAGTGATTCAGTAGGAATGCTTCAAGCAAATGGGCCCACAATC
AGGGCTCTAGAAAGGTGAACTCCCTGTCTGCTTCACTGTGCACTGCTAGAGAAGCAGAGG
AAAGACTTCTGGAATTTGCTACCCATAGAAGATAGACTTTACAAGGTAGGGTATTAACGT
GTTTCTGGTTCTGGTATTGTTAACAAAGGTTAGTCCTAAGAAGAAAACCTGAGGCATATT
CTCTGCAATTAAAAAAACCCATTCCAGTTCCAGTTTGGCAACTTTTCCCTCAGGTTCCAA
GAAAATAAGTGATTAGAAAATTGTTGTTTTTTTTTTTAATCTGAACCACATGTAGCCCTA
GAGAAATATGTGAGCCTTGGGAAGATAAACACTGCAAATGCAAGAAAAAGAAAAAAGGTT
TTGCTCTCTGTGTCTGATTTTGACAGCCCAGATTGAATGAGAGAATAAGGAGGAAAAAAA
TATTCTCAATTTTAGTTTCCCAGACATTCTGTGCTTTTACCTTGAAAATGTGGACAAAAA
AAAAAACTATACCGAAGCTAAAAGTATATTAGAGGGGCTGGAGAGATAGCACAGCGGGTA
GGGCGTTTGCCTTGCACGCGGCCGACCCGGGTTCAAATCCCAGCACCCCATATGGTCCCC
TGAGCATGGCCAGGGGTAATTCCTGAGTGCAGAGCCAGGAGTAACCCCTGTGCATCGCCA
GGTGTGACCCAAAAAAGCAAAAAAAAAAAAAAAAAAAAAAAGTATATTAGAGCTGGAGAG
ATAGTACAGTGAGTGGGGTGCTTGCCTTGCACGTGACCAATCCACCTGTCCCATCCCTGC
ACCTCATTTAATCCACTGAGTACCATCAGGAGTGATCCCTAAGCACTCCTAGGAGGAGTT
TGGCCCTAAAACAACAACAAGACAGAAAAAAAGTTAGAGTACTGTTCTAAATTTTATTGA
GTGTATGCATGCAAAATAAAATGCCTAATGCAAATAAATGTATTACTGACTGCTTTCTAG
GAAGATAGAGAAATCCACGTAAGACGGTAAGGCATTTTATCTAGGATGTTAACTGTGCCA
TATCGGTGCGTACCTGTTCTTTCTGATCTGAGAAGCTTTCATTCCATAAAATGTTGAGTG
TTGTGGCCTTATTGATATTACAGCCCGTAGGTTTTTTGTCTTGCACACAGGCAATTTGGG
TTTGATCCCCGGCATTCCATATAATCCCCTGAGCACCACCAAAAAGGAAAAAAAAAAAAA
AAAAACAGAAAGTGAGTGTATACCCATTCCTCCTTAAAGTCCTTCCAAGGTCTAGTTTCT
GATAAAACTTCACATTTGTGAACTGATAGTCCTTGCTTTGGCCTTCCACAGTACTTTAGA
CTGTGGTGCAGTGTGCTCAGGTGTAAATTCTTGGTAACTTGGTAAGATACCAAGTAAGTA
ACACATCAGACTGATGACTTGAATGTAAATTGAATCATCACTCTTCCTAAGTGCTGTAGA
AAAGATAAACATTGTGATTCTTTTCAGGCCTTGAGTGTAGTGTTGAATCTGCTGAGACTA
TTTGTCAGGGGTCCAGGAGGCGGTGTTGGGCTTGCTCCTGTCCAAGACCATGCAGTATTG
AAGAGTGAACCTTGGACTCCCCTGTGCAAGGCTTATACTCTTAGTCCTTTGAGCCGAGCC
ATCTCCCTGACCTGAGACAGATTCTTACTTGTTTGTTTGGCCTGGGGACTGGTGTTAGGG
GGACATCTATCAGTGCCCAGGGCTTACTCCTGACTCTGGTCTCAGAAATTACTCCTGGAG
GTACACAGGACTACATGTAATGCTGAGTATCAACCTGAAGTGTGTGTGGGTCCCCATGAG
TGGCTTATGTGAGGAGGACAAGAGAGAGACTGTCACTTTCTCGCGATCAGACTCTGCCAC
CCTGGGACCGACTGGGAAGGTTACGATTGATAAAATCTGTGGATGAGCCCCCCTGCACAG
CATGGGCCAGAGCCCCCGCCAGCTCCACCAGGTGATCACCGGGCCACAGCTGACGTCTGC
TTGGTCTTCTCAGCATGGGAGTGGATCCCACCACTCGATCTCTTGGGGGAGTCACGGAAT
CAGGCTGGAGCGCCGAATTGCTCTTTGCAGGAAAGGAGAATCAGTCCTAGGCCTTACGCA
GGGTTTCCCGTCCTTGCCTTTCTCACAGAAAGGAATTTCAGGAGTAGATAAGAAGTGAAA
TAAAAACATTTTATTTGGAGGCTTTTAGGAAGGGGAAAGAGAGAGAAAAGGGAGAGACAG
AGTAACGCATCCAAGAGAGAATACAGGCTTCTCCAAAGAGGAGAGAGCCCCGGTACACAT
CTCAGGAGAACAGATGCAGGTGAGACATGTGCTCAGCGGCCACAGTTGCTCAGCCAGGTG
GACACAAGCAACACATGGGCTCAGGCAGCGTTTCTGCGCACTTCCTTTGTTCAAGGTGGC
TTTAATAGGGCTTTTCCCAAGCTGCCCCATGTGGGGCTTTCTAGTTAGGTAGGAGTCTGT
TGCTAGGGTGGTTGCCAGCTGAACCCTTGTTCCTGCTGGATCTTCTCTTGGAGAGGGGTC
CAGCCTTCTCTGGTGTGGGCTAGCTCCAGTTAAGGCCTTATCAGGTCTTGGTGGTTGTAG
CTGCAGGTGGGTCCTGACAGCTTTAGGGCTAGGTGGTTTTACTGACCCCCAGGAATTCCA
TTGGCGGGGGCCAGGGAGGGAGACGCAGAGGGAGGCCTCCCTTAATCTAGCAGCCCACAT
CAAACCCATGTTGGCTGTATGCAAGGCAAGCACCTTACCTTCTGTGTTCTCTGGTCCCCA
GGACAGATTTTTCTGAAAATTTGAGGTGAATGCATTCTCCCTCTGACCAAATGGGTTGCC
TGCTGAGATATACTTGGGGATGTGTTTAGGGTATCAGACAGAGCTTGACCTTAAGAAACC
AAAAGTACGGGAGCTGTTTGCTCAGGGCAGCCTCCTTCCTTGATCTTTGTACAGATGTGA
AAAACTGTCTTTGTAGTAAATGCTATAGTCGTTAACTCTTCATAACCTTTGTAATGTAAT
TTTAAAGCCAGCTTCAAGTACTGTGCCCTAAGAGAATATGTATTTGCATAGTTATTGAGC
TCTTGATTCAGTCTATACTTTGTTTTGTTTAGAAAATAAAAAGTAAACAGCTGTATCTCT
CCCTCCCACCCCCCTTTTGTTTAGCTCCTTCACAGAATTTAGTCCCAAAGGAGACTCCAG
CCACAGCACTGCAGGGCTCAGTTGTCAGACCAGGGTAAGGCAAACCACTCTGACTCCGGC
TCTCTGAGTGGGAGGGGTTGGCGTGTGAAGGACCTGCTATCCTCAGTGTGCCAGGAAGTG
CCTGAAATGGTCTCATCTGCTCACTTCAGAGAAGACTTCTCGGACTTGGCAGAACTCCTG
CAGTCCTGTTTGAGGTTATCCCCCACCCCTGCGCCCCACCTCAAACCCATTAGTGCTTTC
TTATGTGTTCCATGGTTTCCTGCTAGCGAACTCAAGAAGGGCCTCTCAGTGCTCATTGTG
TGGACCACCCAGCCAGGGTTTTCCTTTGCATATTCCCTGTTCCCTCTGTCCCTCTGTTGG
GGTCTTGGAACAAACAGCCTGTGACTGGCTGGCGCAGGGTGACTCTCTGGGATAGCAAGA
GTTACTCACTAGAGCAGTAATTGCATTATCCTGCAGAAGTGGAAGCGTACTCTGATACCT
CTGCTGCACTCAGGTAGCCAGTCTCCATGGACTCAGTCGTTTCAGTCATCTCTTCATGGC
TTTTCTTTTCTTTCCGTGATCAAGATACTGCAAATAGAGCCCGGACTGGTGTTTCTGACA
GACAGACAGATAACTGCTGTGGGGGACTCAGCTCTGAGCACATGATGATCTCGATGACCA
TAGTAGCACTGCCTTCATAGATAACCCTCTCAGAGCAGATTGATATCATAGATGTGTCAA
GAGTTTAGTTGTGTCTGTCCCTCTGTCCCTGTAGGGTACAAAAAACAAAGCAGGACTGCT
TTCTTCAAGGAGGTCAGAATCTCATTGACAGCATAATTCACACACTTGTGAGGAAATGAA
TGAGCAATACCGCCATAATACAATGTGTCTAATTTTGTAACTCTAAGCCTATAAGGCATA
ACTTGTGACTTGGGGAAGTGAGTGGGCAAGGGACATACCCAGTGACATTCAGAACACCAG
ACAGTGCTAAGGATCAAACATGGGACTCCCAAGTGCAAAGCTTGAGCTCCAGCCATTTGA
GCCGTATCCCTGACCCTAACTTGGAATTCTTTTATGTTTGTTTGGGGACCATATTAACTT
GCTCAGGCCTTAGTTCTGGTTCTGTGCTCAGGGATCAGTCCAGGCCTTTTGCTCAGAGAC
TATATTCAGTTTAAGGGATTGAACCCAGGTTGGTTGTATGCAAGGCGAGTGCCCTACCCA
CTGTGCTGTCTATCTCTCTGGCCCAGCAGTAATTATTTTAAAACCTGCTTCGGGGTTCTA
TATCTTCTGTGTTGAATGGGACTTGCTACTGCACATCTCTGGGTAAAGCGAGGCCTCTAA
AATGACAAAGTGACCAGCATGTGCCCAACCCAGGTTCCATCCCTGGCACCACATGGTCCC
CTGAGCATCATAAGGTGCAGCTCTGGAGGCCCTAAGTATGGCCAGGTGTGGCCCTGGAGA
CCCTGGGGTCTCATTGTACCCTCAGACCCTTCCTTGCATTGAGCAGCAGGCCCGCTTGGT
CCTAGAATCTCCAGTGAGGCTCCCAGAGCGCTGCTTGGGAGGCAGCCCCACTGCCCCACT
GCCCCCCACCCCCAAAAAAAAGAAAAGAAAGAAAAAGAAATGAACAGAAAAATATTTCAA
CCACTAGGTTCTTTTTGGTTACAGCTGCCTGCTGGCATTGAGCTAAGTGTCTATATGGGG
TAGGAATGGAGGGGCCAGAGAGATAGTACAGTGGATCCAGCACTTGCCTTGCATATGGCT
GACTTGGGTTTAATCCCTGGCACCCTAGATGGTCCCTTAAGCCCCACCAGGAGTGATCCT
TGAGCACCACTGTGTGTGGCCCCAAAACTTTAATAAAGGGATAGTAATGGAGATAGTAAA
TCTGGTTTTTATGGAGCAAATGATTAACCTAGAAGGAAGTTCCATTTTCTGCTCCAACTG
TTTATTCCAGTAAATGGTCTTTGCCATATTATATGTCATCCTTGTCAGCATAGTTGGACC
AAGATTAAATGAATCTCCACAGAATGCTCCCAGAGCCACTAATTGACCTTATAGCATAAT
GACATTTAATGTTGAACTATTGAAAAATGGCTGAAAGTTGGACCAAATGTTAGGATGTGT
TCATTTATTTAGTCTTAATTAACTTTGAAGTAAGAAAGTGATTATTTTCATTTTTCAGAT
GAAAGATTGAGCACAATCAGGATAAATAATTCATTCAAAGTCACATGGTTAATAAGAAGT
GAAGTCAAAATTTTGACCCAAACTGACTTCATTGCCTTCAAGGAACTTAGTATGTGATCG
GTAGGGTAGTTTAGACAGGTACACTGAGTTTAAAGTGCTGAATTCCCTACAGACAAGGCT
ATGGAAGGCTGATGGTAGAAGTCAGTGTTCTCTGGTAGTGCAGGGAAGCTCTTTGGGAAA
AGATGCAGATACCCAAAGACAGATGATTGGAAGGAGATGTTTTTCTTCAAGTACTGAGAA
AAAGTACCTGGCTAATCTCCTGGATGCTCATTTTTTTCTTGGGAGGGCATTGCTAGGAAT
TTGAAGAAGAAAGGAACATAATAGAATCAGCATAGGCAGTATTTCAAAACAAACCAGCAT
GTCTGGTAATCTTAAAGGTAATCTTTTGAAGAAGATGCATTATTTTGTTTGTAGTGATGT
AAATTATTTTACTTAAGAAATATGATTGAGGGGCTGGAGCGATAGCACAGCGGGTAGGGC
GTTTGCCTTGCACGCGGCCGACCCGGGTTCGAATCCCAGCATCCCATATGGTCCCCTGAA
CACCGCCAGGGGTAATTCCTGAGTGAAGAGCCAGGAGTAACCCCAGTGCATCGCCAGGTG
TGACCCAAAAACCAAAAAAAAAGGAATATGATTGAGGGACTGGAGTGATAGCACAGTGGG
TAGGGCGTTTGTCTTGCATGCGGCCAACCCGGGTTCAATTCTCAGCATCTGATATGGTCC
CCCAAGCACCACTAGGAGTAATTTCTGAGTACAGAGCAATTTCAGGAGTAATCCTTGAAC
ATCGCCAGGTGTAACCCATAAAGCAAAAAAATATATATGATATATGATTGAGGAGAGAGA
GAGGGAAGAAAACTCCATAAAATAAAGGAAATTGTTACACACCCAGAGTAGAGGTACAGC
AATTTTGAAAGAGTACTTGGCCGGCTTTGCAGGCCTGATGGTGGTTCGGTGCAACTCTGG
AGGACCATCAGGGCCACAGTTCACAGCTTGGGGACCTAAATCAGTCCAGCTAAGCATGCA
TCTTTTCCCTCCAGCATCCAAAATCATTTTAATGCCAAAGCAAGAGCTAAGTTAGTTTTT
GTAATTATAACTGACCCTTCTGTGTCTTGGCATGCTCCAATTTGCAGCTATAGGGTTTGG
TTTTTGTTTTTGTTTTGGGGCCACATCCAGCAGGGTTCAGGGATCATTCCTGGTGGTTGT
GGGGATACGAGCTGGGGTCAGCGAGTGCAGGCAGGTGCCTTATCTGCTGTACTATCTCTC
TACCCTCTGAGCATATATTCTTAATATTTGGGATGTATGCAGTGATGATTGCTTTTTAAA
AATTTTTTCAGAGAGATTTATTTATTTATTTATTTATTTTGCTTTTTGAGTCACACCTGG
AGATGCACAGGGGTTACTCCTGGCTTTGCACTCAGGAATTACTCCTGGCAGTGCTCAGAG
GACCATATGGGATGCTGGGAATCAAATCTCGGTTGGCCGAGTGCAAGGCAAATGCCCTAT
CCACTGTGCTATCTCTCCAGCCCCAGAAAGAGATATTTTTTAAATGAAAACTATGTCTTT
TACATGATAGTAAAAGACTTATTTTACTAATGTAGTTACAGGTGGGTGAAATATGAACCA
GACAATGTGAATTTGGTTTTCTTGATCCTAGGGTTATTCTAGAGTATGGAGTAGGAATAA
AAACCAGTTTTCTTCTGCTCCAGACACCTAAATTGTGTCAGTACCAACTCTTGGCCCCTG
TATTGTAGGATGGCAGTTCTGCTCATCACAGAGACAGGGGCAGTAATAGGAACCTCATTC
TTCTAGATACCTAGCTTCTCCCTGTGGATAGATATGCCAGAAGCTGCCTTGTCTCATTTC
TNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNTGCTTTGAAATAAAATGATATATTATACTGTGTTGCCTACATAATCTAAAAC
AGTAAAGTGCAGTTTAAATCTCATTGGCTCCTTAAAGTAGAGAAGTACTATTTTCCAAAA
AGTACTCCTTTATTTTTTCAGTGTAGGAAAGTATTTTATTTTTATTAAAATAAAATTTAA
AAAATCTCTCATATTTACGTGTATCACTTAGCTTGAGAAACATCTTCACATTTATTTCAT
CCTTTGATTAGTCCTGTGCAGATTGAATGCATTTATTTGAATGCTACTTATTGAACTGCA
GGCTCTTTGGATATATTATCTCATTTATTTTCAAATATCTATTAGGAAAGTAAATTTTGT
TGGGGTTTTTTTGGGAGGGTGGTTGTTTTTTGTTTTTTGTTTTTCTCTTTGGGTCACACC
TGGCGATGCACAAGGGTTACTCCTGGCTTTGCACTCAGGAATTACTCCTGGCAGTGCTCA
GGGGACCATATGGAATGCTGGGAATCGAACGTGAATTGGCCATGTGCAAGGCAAACACCC
AATGTGCTGTGCTATCACTCCAGCTCCAAGTAAATTTTCTTTTGCAGAAAAGGATTCTAA
AGCTCAAAAAAACTAACTTGCAGATTACAAGTTACAGATTTACAGTAAAGCCAAAACTCA
GACCCAGATCTTCTGAATTGGGAGCTTTCATATTTAATATCATCTTACATCAAGCAGGAT
TTATAAATCAAGAACCTGAGGCATAGAGAATATTAAATATTATATCATATAAATGCATAG
CTAAGGCTTGACCTCCGTTATTCAGTCTCCAAATTCCTACGCAGTGCTGGGCTAACATTT
GGGTTCCTTTGTGTTTCTTAGACATGCATAGCTAAAGAAAGGAGATAATCAGATCAAAAT
GCCCTTTAGGGGTCTGTGATGCTCAGGGAGTGAGTGCTGTGCTGATGACTGAACTCAGAA
CGCAGGACGCGTGCCCCTGATCCTGGACTATCCCCTCTCCAGTCCTTTTTTGGTGGGAGA
GTTTCGGGATGGTATTGTGTTTTTGTTTTGGAGCTACACCTGGCAGTACTCAGGGCTTAC
TCCTACCTCTGCACTCATGGATCGTTCCTGGCAGAACTCAGGGACCANNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCTTCGTATTTTATCTTTAGT
GAATACAGTTTGTTGATGTGTGATCTTTATAAGCAGCACCACAAGGGTTCTGCTTAACAG
ACAAATGCTGATGACCTCGCTTGTATGTGGAGTATAAAGAAACAAAGGCTTTGGATAAAA
CAGTTCTCAATGGAAACAAACATGATCAATAGAAGTGGGACTGAGAAGGTGTGTGTTTGG
GGGGAACCTCGGGCAATAGTGAAAGGGTCCTGGTGCAGTGGGGAGGGTCTGCCATAGCAG
CATTGCAAGGGTACAGCAATGACTCAATACTATCACAAACTGAGATCTACATACAATATA
GTTTTTTAAAAGAGATAACTATACTCCCCAGTTCCAAAATGCAATAGGTGCATAAGCAGT
AGCTACCTGCCTCTTCTCCTGCCTATGTTTTGAGTTATGCAAAACAGAGGAGCATTTTAC
TCCCTCCCGCAGGTACCCTGTGGGAAATGTAGCACATATGTACAAAATAATCCACAAATA
TGGTCTGTTCTTCTTTGGTGGTAGGGACAAGGGAGCTGGCACCAAGGCCAGAACCAGCCT
TGCTAGGGAGTGTTTGGGAAATGGTAACTATAAATGCCACCGAATGTTCGGACTATTTTG
AATCCAGCTTTTGCTTGACTGGGCATTTGGTTAGTAGCACTGCGCCTCTCAGCCCTCCCC
AGAGTGAGTCCCATTGCTTCTGCCTGTGCTTTTGGTTCCTATGGAGTAGCACAAGCTCAG
GGCTGCTTCCCTTTCCCATTTCCCCAGTGCCACTGCTGAGTATAAAGATCTTTTCCTTTT
AAGTCAATACAACACAGATTTTATTTGAAAGTTCTGAGGAAGGAGAGCGGAGGGAAAGAA
AGGGGGAGAGAGAGAGGAAAAATGCACTAAAGAGAGAAAGTGGAAACTCCCAAGGCGGAG
AGAGTCCCCAGCACACAACCCAGCATTGAAGTCTGAAGGTATGGAAAGTGCACATCCCAA
GAGGGAAGATGGGGGCGACAATGTGCTCGGGCACCACATGCGCTGGACAGCAACACATGG
GCACAGGCAGCACACGGGCCTGGGCAGCATGTGCGCGTGCTTCCTTTGTTCAAGTTGGCT
TTGATAGGGTTTCTCCCGGATTGCCCCACGTGGGGCTTTCTAGCTAGGGAAGAGTCCTTT
ACCAGGGTGATCGCCAAGGGTAGGATCTACAGTCCTTGGCAGCATGGAGGTCAAAAGACT
GACCTGCACCCACCTTAAAGATTTAAGGTGGTAAAATCCCTGGGGGATCCTGTGGGATTA
TGAGGAAGGCAGTTAGATAGGGCTGCTTCTCCCCTACCCCCATGGAAATGGATTCCTGGA
AAGTAATAAAACCAACAGCCCCAAGGCTGAGAAAACCCACCTGTGATCCCAGGAATTAAG
GTCTGATAAGAGCTTCACTCGTGCCAGCAGAGAGGCAGAGAAGGTTGTGCCCCCCTCAAC
CCCTCACCCCATAGAAGCTTTCAGCAGGAAGGAAGGCCAGGAAAGGAATAACAAAGAAGA
CCATCAACTATTCCCAACTCTACCTCCTTGGTCAAAGGTGTTTAAAACAGGAAGCAGAGG
GTATGTATGAAGGTCCACACACCCAAACAAGCTCGAATGATAGGACTATGATNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGGGT
TGCCAGTTCCTACCACTGCCTTTCTTTGTCCCTTGAGTACATCACTTGATTCTTTATAGC
ACAACAAAAGAGAAGCTTCTAGAGTTGACATAACAGATTTTTCTGAGGAAAAAAAAAACA
AGTGAAAAAAAAAAGGAAAGCTCAGTCAAGATAAAATACTTTATTTTTTTAACTGCAGAG
GACAGATTTGCTACAGTGAAAATGAAGCATAAGAATTAGAAATGAAGCGGGGGCCGGAGC
CATAATGCAACCAGTAGGGAGTCTTTCTTACATGTGGCAGACACAGGTCTGATCCCCAGC
ACCCCATATCGTCCCCTGAACACCACCAGGAGTGACTCCTGAGTTCAGAGGCAAAAGTAA
TCCCTGAGCATTGCCAGGTGTGTCCCATAAAGAAAATTTTAAAAATAAAAGACTTAGACA
TAAAAGGACTGGAGAGATAGTACAGTGCATGGCTTTTGCCTTGCACACAGCTGACCCCAA
TTCAGTCCCTGGCATCTCGTACAAGAAGTGATCCCTGAACACAGAACCAGGAGTAAGCGT
GACCACCACCAGGTGTGGCACAAAAACAAACAAGAGTTGGACATAAAGATTTAACTATGG
GGAGTTGCGGGCTCTGTAGGACTTTATTTCCATGGGATTAAAATAACATTGATATCCTGT
CAGATTAACTATCTTCTTTTTTGTTATCACAGCATTTGCATGTTTTATTTTTTAATAAGT
TTTACTGGATCACTGTGAGATACAGCTATAAACTTGCAAGATTACATTTCAGTCATACAA
TGCTTGAGCACCCACCCCTCCACCTGTGCACATTTTCCACCCCCATTGTTTCCAGTGTCC
CACCCGCCACCCCCACCCCATCTTACTCCCTGCTTCTGTGGCAGGTACAGTTCTTCTTAC
TCTCTAATTTTGGGCATTATGATTTGCAGTACAAATACTAAGAGGCCATGATGTTTGGGC
CTTGATCTACTTTCAGCACACTTCTCCCATCCTGGGTGATCCCTCCAAGTCATCATTTAC
TTAGTAGTTCCTTCTCCATCCCAACTGTCTTTTCCTCTAGTATGTGGGGCGGGCTTCCAA
ACCATGATGTGATCCTGGCCCAGATTAACTGTCTTATGATTTGCAAAAGACTAATGAGAT
TGATTTTGACAAAATCAATGCCATTGATTACTCATGGTTTTCCATGCAAAATTTCACTAA
CTGAAGTCCCCAAATAGTGCACATCACCTTTTGAAACATTACCTAAACTTCACTTGTTGG
CAGTTACTATTGCTTACAGAACAGTAAAATATTTGGATTTTTGCTTTTATAATTGACTCT
GGGTTCTTAAGTATTACATCAATGAGAGAAGAAAATTTTCCTACAACTCTGAAGGTAAAA
TGAGCTTTGGGAAGTTCAACCTAAGAGCTAGGAATGTGGTACAGCAGATGCATTTGCCTT
ACATGTATAACCTGTTTCACACCTCAGCACTGGGGGGAAAAGCGTTTAGCATAGTTTTCA
AAAATGAATGTATTTGATTCATCTTACGATTGTTAGATCAAAACACTTTTTCTTTGATAA
AAAAGTAATTTTAAAACATTGTTTTCATACTGAAACCAAAATATCTAGTATGGAACAGCA
TGAGATATGAGAGTGGATTTTGTTTTTAATTTTGTTTTTTTTTAAGCCACACCTGGCAGT
GCTTAGGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNTGAGCTGTAGCCATTCCCCACATGCTGTCCCTTTCTTGCAGTTACGTGT
CCTGCATCTCCCACCACCTGTACCAGATTCCCCAGTTGCTATACCCTAAGTGTGCAGGAC
TCTCTCCTCTTCCCCTGAAGCCTGAGCCCTCTCCACACTGGGTGCCCCCCTTTTGAAGCC
TGTAGATTCAGGGTCCATTTAGGCTACTGAGTTCTTGCAGATGACCTGAAAGGCCCCATG
TTAGAGAACTTTCTCCACTGAATGTGTTTTTCCTTTCTCCCTACAGACCTAACCAGTGCT
GTGCAATCCAAGCGAAGAAAATCCAAGTGAAAGAGCTGGACAGCAACTTGATACTTGTAA
ATGTGTGTGAATTTTACAAAAAGCAATTTTGAGCTGTGACTTTTTAAAATCCATTCTGTA
CAGTTACTCATTTTAATAATACGGCCCCTTTCCTAGGCCTTGCAACCTGTTTCATAAAGT
GCAATGGGAAAAGCAGAGTTGAACCCTTTTGTGTTGCAAGATGAAGTTCAAGCTTATAAA
ATGTTGCCATGTATTGAGAAGCTACTATAACTATTAGTTTTCACATTTCCTATGCAGCCT
AGTGTACAGGGTGAGCATTTTTAGATCTTCTAATGATAAATTGTGCCGTGGAAGTACTGT
GTGTGAATAGCAGTAGTGCGGGCAAAAGGAATCTTCTCATTTCGATATGTAAATAATTTT
ATCATATAGTGTTTTGCATGTATTTGTTGTAGAAATGGCCCAGTGAATAAAGAGAATCTA
AGGGTTTCTCCAATGTGAAATATTGAATGTGTTCAATAAATGTCATTGTTCTAGAACATA
AATGCATGATATTGTAACTTTAGTAAGGAATCTTTAAGTGAGCTCTTTATTTGGACCTAA
ATGAGTAGAAACACCTTTCTTTGTGACTGAGAACCCTGTCTGATCCTTGCACCCAAGATG
CCCACCTGGCAAGCTGAGGGTAATGTGCCCACCTGCTCACTTTTCTCAGGCGTGGCTCTA
GAACAAGCCCATTTTTAGCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1235, 21823..21978, 25643..25765, 36735..36780, 36782..36864, 37429..37460, 37463..37467, 37744..38105, 38382..38864, 40890..41036, 47694..48810, 52023..52144, 55699..57374, 57376..58320, 58322..58706, 63444..63511, 63513..63513, 67936..67972, 87990..87997, 88886..88977, 96348..96389
1001..1235, 21823..21978, 25643..25765, 36735..36780, 36782..36864, 37429..37460, 37463..37467, 37744..38105, 38382..38864, 40890..41036, 47694..48810, 52023..52144, 55699..57374, 57376..58320, 58322..58706, 63444..63511, 63513..63513, 67936..67972, 87990..87997, 88886..88977, 96348..96386
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved