Sorex_araneus Locus TOMM20
snOPY snoRNA Orthological Gene Database
Sorex_araneus TOMM20
Sorex_araneus
TOMM20
GeneScaffold_527
SNORA14
1599..1732
18909
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
CCCCCCCCCCCCCACGAGAACACCGGTCTCGGGAGTAGGACCGGGTCGGGAGTGGGGGTG
GGGATGGGAGAGGTGGGGCTGGGAGGGGTGGTGGAAAAGAAAAAAAAAAAAAGGACCCCC
CCCTGCGCAGGCGCAGAAGCGGTGCGAGCGCGCCCGTTCAGGCACTGGCGCGGACACCCC
GGGGGCCTCAGACGCTCAGGACCGGAAGTGGCGTGAGCTCGGCCTTTCCGCGTCCCTCGC
GGTGGGCGTCGGGTCTCGGCGGCTCCGTCCGCTCTGCGGGTTCGCGGCCAACAGCTTCTC
AGCGGGTCGGGCGCCGCCGCAGGCCCACTCCGGGTCGGAAGATGGTCGGCCGGAACAGCG
CCATCGCCGCCGGCGTCTGCGGGGCCCTGTTCATCGGCTACTGCATCTACTTCGACCGCA
AGAGACGGAGTGACCCCAACTTCAAGAACCGACTGCGAGAACGTGAGTGCGCGCCCGCGC
CGGGTGCGAGCGGCCGCCCTGGCGGCGCGGGAGCACGCGCGCCCGGGACCCCCCCCCACC
ACCCCAACCCCCTCCATCTTGGAAGAACGAGCCTTTCCCATGTTGTTCCTTTCCCCCGGC
GGGGCCGTGCACATTGCACTCGCGGCTCGCGGTCCGGCAGGGATGGGGAGTGGCCGGGCG
CTGCCCTTTCGCTTCGTGCTCTGGATTCGGAAGTCGTGCCTGGGGGCCGGAGCGATAGCA
CAGCGGCTAGGGCGTTTGCCTTGCACGCGGCCGACCCGGGTTCGATTCCCGGCGTCCCCG
GAGGGTCCCCCGAGCACCGCCGGGAGTTAATTCCTAATTCCTGAGTGCATGAGCCAGGAG
TAATTCCCTGTGCATCGCCGGGCGTGACCCCCCCCCCCAAAAAAAAACAAAAAATAATAA
AGTCGTGCCTTGCGCAACGTGCGCCAAAGCCAGCGTGTCGCGCATTCTTAAACCCTCTTG
GCGGCGCTCCGATCGCCCCCAGGATATGAGTGAATGCGATAGAAACCGCAGGGGAGTCCA
AAGGGCTGCGCCCCCTCCCCGTGGCGCGGCCTTATTTCATACCTGCGACATCACTGTTTT
TGGAGTTGGCCAGAGGGAAGTCGTGTCCCCAGAACCCCCCTGGCTTTGTGAATGTGGGAG
CGCGAGCTGAAACGGTCGCGCAGCTTTTGATGGCTCTGTGCAGAGTTCCCGGCGGTACGA
CCCAGAAAGCGAGGGTCCTGTTACCCCCCACCCCACCCCCGAAGGTGTGGACGTGGTTGA
GGGTTTGGGTCGCCACGTGCCGGCGACTACCATATTGGACTGGATGGCGCGGTCTCGCCC
TCCACGTCTGATAACCAACCGCCTTCTGGCTCCCGTTCGTGCGGGGAGCAAAGGGGTGTA
GAGATCATAACTGATGGTAATGTTGGTTCGTGGGGAAACTGTGGTTTTTGGATTTCGATC
ATGAGTCTCCCAACGAGTATTTTTTTTACCCCAAACTGTGTAAAGTGCAAAAAGCTACGT
GCCTCGCGTTGGTTTTGCGAAGGGACTTTTGAGCCCACTATCACTATTCCTGAGACACCA
AAGGCTCAATAAGTGCTTCCTATTAAAATTGGGTAATCCTGCAGTTTTCATAAAAAAAAA
AATAGTTGTGGGGGTTGGAGAGATAGTACAGCGGGTAGGGCGTTTGCCTTGCACATGGCT
GACCTGGTTGGATTCCCAGCATCCCATATGGTCCCCTGAGCACCGCCAGGAGTAATTCCT
GAGTGTAGAGGCAGGAGTAGCCCCTGTGCATTGCTGGGTGTGACCCAAAAAGCGCCCCCC
CCCCAAGAAAAAAAAAAGTTCACTGGGAAAAATAATACTAAAGACACAGAGGCTGTTAAG
CCCGTGGTGGTTTGATCTCCCGCACCACATTTTTTCTAGGCAAGCCCACTCCCGGCCAAC
ACCATGAAGGAGGCCTCAACCATAGATCTCATATTTGATTTTTCCCATCCGCTTGACATT
GAAAGTCGAACTTGCCATGCCGGGAGAGGAATAACTGTCTCATAGATACCCTCCCAGGCT
GGGCCAGGAGCCCACAATGGGATCCGCTAGTTAAAACACGTATCAGGTTTCTTCGAGTCA
AAAACCATAACTGCCTGTTACACTTGTGCGGCCCCCCCCCATAATGTTGGGTCTCANNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNCTGCGTCTCTTGAACACACACATCTCTCTCTCCCCCCCCTTACATCTTTCTAA
ATAATTTTCAATTAAAACTAGGGGTTTTTTGGGGGGCTTCTTTTGGCTCTTGGGATCACA
CTCGATGATGCTTGGGTTACTCCTGGCTCTGCACTCAGGAATTTCTCCTGGCGGTGCTTG
GGGGACCACATGGGATGCCGGGGGTTGAACCCAGGTTGTCCGCTTACAAGGTGAACGCCA
TCCCCACTACTCTATCATTCTGGCCCCCTAAAATCCTAAAATTCATTTTTCACCAAGAAA
AAAAATGACAGTATCTCATGTCAGTCATTTTGACTTGTTCTTTTTTCTGTTCTTTGTTTG
AGGCTACAGTTGTGATGATGCCCAGGAATTTTCCTTTTTCCTGGCTCTCTGCTCAGGCCT
TGGCAGTTGTCTAGGGTTCATAGGTAGTGGCGCATTACCCATTGGACTACCTCCAGTCCT
GGTTTTTATTTTTTTATTTTTTGCTTTTTGGGTCACACCTGTCGATGCACAGGGGTTACT
TCTGGCTCATGCACTCAGGAATTACTCCTGGCAATGCTCAGGGGACCATATGGGATGCTG
GGGATCGAACCCAGGTCGGCCGCGTGCAAGGCAAAAGCCCTACCCGCTGTGCTATTGCTC
CAGCCCCATGCAGTCCTGGTTTTTAAAATTTAATATATTATTTTGCTTTGGGGCCTACAC
TCAGCGGTACTCAGGGATCCAACCCTGTTCTCCTGCATGCAAGTCCAGTGCTTTAAGATA
TGTACTGTCCCTCTGGCCTTTTACATGTATTTTTTATTTTTATTTTTATTTATTTATTTA
TTTATTTATTTTGCTTTTTGGGTCACACCCGGCAATGCACAGGGGTCATTCCTGGCTCAT
GCACTCAGGAATTACCCCTGGCGGTGCTCAGGGGACCATATGGGATGCTGGGATTCGAAC
CCGGGTCGGCCGCGTGCAAGGCAAATGCCCTACCCGCTGTGCTATCACTCCAGCCCCTAC
ATGTATTTTTTAAAAGGAGACAAATCTTATTTGATAAGTTTACACAGCCACATTTTGAAA
CCGTTTCTAGCAAATAGAAAAACAAGGCTAGGTTTTGTTCTAATTCATGCTGCTTGGTTT
TTCAGTTTGTTACCATCTATCCCTTTATCAGAGATACTAAATGGTAACATTCTTTGTAAT
ACTGTATAAGAATTGACTCTGGGAGAGAAGCATAACTAATGTAACAGATTAAATGGCTTA
CGAAAGCCAAGATTGATTTATTTCTGTGATGCTTAGGGTTTATTCCTGGCTCTGGGCTTA
GGGATTACTCCTGGGGGGGGCAGGGGTCTAATCAGGGTTGGTTGGGTGCAGGGAAAGCCC
CTAAGTCCTGACCTATTGCTCCAGCCTTGTAAAATTATTGTCTTTTTCAAGCACAGTGGG
TTAGTCTAGCACTGCACCCTCCACCTGTATCTTTTATGAGGACATGTTTTTGTAGAATGC
TTTAAGGTTTTCAGAGGACATTTTCTTGTTTTTCTTTTTTTTTTTTTTTTTTTGCTTTTT
AGGTCACACCTACCTCTGCACTCAGGAATCACTCCTGGCAATGCTCTAGGGACCATATGG
GATGCCGGGGATCAAACCAGGGTCAGCCACATGCAAGACAAATGCCCTCCTTAGCCAGAA
ACTAGTTCGTGAAGCAGTGCATTTCTATTTTTTTTGTTTTGGGGGCACATCCTGTGGAGC
CCAGGACTTCTGGCTTTGTTCAGGGGACAGTATGGTATGCTGAGGATTGAGCCTGGCTCA
GCCTCTTGCGAGGCAAGCGCTCTACCTTTCTCTCCAGCCCTAAAGCAGTGCGTTTCTGAG
TACTCTTCCCTCTGGGGGGAGGGGCTGTTTTCTTGCTGTTTTTCTACACTTAAGAGTGCC
AGCTAGTTTTTAACATTCAATAAAAATGGAACCTTTTGGTCCTGGAAAGAGCTCAGATGG
CTGAAGGGCATGCTCTGCTCTACCTCCAGGGGGTCTGGACTCCATCTCTGGTACCCTGTA
CTCCCAACTACAAACTAGTAATAGCCCCTGAGCACTGCTTGAATGCTAGTCGTTCCCCGA
CCCTCCCCCCCCAACTTTTATATTTGATGTGGTAATAAATCCAGCAGTGGTTTACTTTTT
GTCTGAGTCTGTCCTGTGTAAGAGGAAGAGGGAGAGCTTAGGGTCATTTTGTTTCTCAGG
AAACCCAGCTGTTGGAACAGATTCCGTCATGTAAATTGCCGATGCTGGTGCTCCAGTAGG
AGGGAAAAGAGGCCAAGAAATGTTGCCTGTAATTCATTGTCTACAGTGATTCATGTGACC
CTGACGGATTGCCCGAGAGGAGCAGAGAGTCCAAGAGTCTGGAATGTTTTGCAAATAGAA
TGACTGTCACTGCAGCTAGCCGCCTTTAATTCTCTTCTAAATAATGATAAAATGAAAATA
TTCCATTTCTTACAGGAAGAAAGAAACAAAAGCTTGCTAAGGAGAGAGCTGGGCTTTCTA
AGGTAATCTGATTTTATTTAGATTATATTATATATTTTATACAACTTATATTAAAATTAA
CTTCAAATATGAATTTTGAGCAAATCAGTTTATATCAGCTCTTGCTACTTTATAATTTGT
TCAGGAATGATTAACTCATTTTACTCCTATATAGTCTTCCATTTTTTTCTTGTTACATAA
GCAGCAGGTAATTTACTATATGAGCAGTAATTAAGGGGCAATAAAATAATTTTCCTTTCT
CCAACTTCCTTTCAAAGAACCACATGATAATTTCAAAAGCTGTAATGGTATTCACGCATA
CTCTCACCGATCTGGAATCCCACCTTAGAACCTATAAACACCCTCCACCCCCCCTTTGTA
GAGTGATGGTGACCGTTCACACACTTGGATGTGGTGCTTGAGGGGAGTCCCAGTTAGTTG
TGCTTTATACACAGTTGGCTGCAGTGTGCCTGCAATCACAGATCACACCTTCTGTGTGGC
GCCGGGGATCACACACCACAGTGCTGGGATTGCACTCTGCATGTGGGTTAGGCGCCAGGG
ATTGAGCATATGGCCTCAGGCTGCTCTAAACCATACTTGACCTCTGAGCCATCCCTGGGC
CTGCTGGCACTTTTTTTTTTTTGTCGTTGTATTATGTAAACTTAGATATAAATCTTTTTA
CTCATTTTTTTCTTTTTATAGATCCTGTGTTCATGATTATTTTTAATGACTACATAGGTT
TATCTGCTTGATTTAAAAATGTTCTGTGACATGGTGTAAGTAAATAAGTAAGTAAATGTT
AACATTGTGCATATAACTTTTTGATTGAAATAGTTTCATTGTTTGGATTCCCAGGATTTC
TACTCCTGGAGCAGTAGTGGTTCTTTGTAAAGAAAGTTGAAGCAAGGAAAAAAAACAATA
GAATGAATGTAAAATTAAACAAGTTACATGATGTTATTTTGAAATAGTTGATGAGTAAAG
CAACACAAGCTTACTGCACGATGGATTATGATGAAGTTAAACTGGAGGGAGGCCCACAGT
TTGGTCTCTTAAGCCCAAGTCTTTCTAAAATGTTGGCAATGTTTGTTATTTTTTGGTAGC
CTTTTCTTTATTATGATAAAAATAGAGATAGGCGACAATGTGTATTTTAAATTTATTATT
GCTATTTTGGTTTTGGCCTGTATCCAGCCAGTGGTGCAGAGATTCTAAGATAGGCTTATT
TTATGTTTTAAATTAGAAAAATTTTGTTGTTGTTTTGGGACCATACCTGGCAGTGCTTGG
GGATTATTCCTGGCTCTGCACTGAGGAATCCCTCCTGGTGATGCTGAGGTGCTGTAGTGG
ATGCCCAGAATCACACCTGGTCATGCCCTACCCATTGTATCATCACTCAGGCCCAAGCAA
CTTATTTTAAATTTTATTTTAATTTTTGTTTGTGACCGTACCTATGAGTGCTATGCTCTG
GAGACTGTGGAGTGGGAGAGCAAACTTGGGGATGAGACACACACACACACACCATGCATT
CTGTTTCATGACCCTGGAATGCCACAAATCAAAATCGGGGCACCCCCAGCCACACACACA
CACACTTAAACTAAGCATTCAGTCAAGTCTGTTGAATTTTCTGCCTGGCATTCTTAGTTA
CTAACTTGGCTTACTTGGTCACTGCTCGCCACCTAGCAATGCTCAGGAATCACTCCTGGC
GCTTCCCAGGGGACTATATAGGATGCCAGGGATTGAATCCTGGTCGGCCATGGGCAAGAC
AAACACCTCTCTGCTGTACTAGCACTCTAGCCCCTCTGGCTGAAATTTGGAGGTGAAAAG
GTCTCCCGAGCAGTGCTTAGGAGGCCTGTGGCTTCTTTCAGGGACTTTTTGGCCTGCTTG
GTCTGGCAGTTCAATGTGAGGGCTCAAAAATATGGCGCTGCTTGGCCCTGGTGCCAGGAG
ATTACCCAGCCCGGCCCCACCCCCCCAGATGCTTGGACCGCCAGGCCATATCTGGTGATG
CTCCAGGACCCTTATGTGTTGGAGATGGAATCAGTGTTACTACAAACAAGGCATCTGCCT
TAAAGCCAATAGTATCTATTCAGGCCCTGGCTTTTTTCCTTTTTAAGAGCTGAATACTAT
AGACGCTACCTGGTAGCATTATATTTTACCGTACATTCATTCTGGTAATAATGGCACCCA
GCCTGCTCTGCCAGTCTGGGTGCATAGCTGACCTTGGCACTGGGATCAGCGTGGTTGTCT
CAGATCGGATTGGCCCTGGCCATCCTGAATGACCCTCTTGCAAAGCAAAGATAACTGATC
TTTGATTTTTTTTTTTTTTTTTTTAGTGGGGGGTTTGTGGCTACATGTTGGTGCTCAGAA
CTTAATCCTGACTGCACTCAGGGATCACTCCTGGCAGGGCTCAGGGAACAATATGAGGTG
CTGGGGATTGGACCCAGATTTGCTGCATGCAAGGCAAGCACTCTGCCCACTGTACTTTCT
CCAGCCCCAAACTGATCTCTAGATAAATGAAAAATCTACACAAAATGTTGGTTTGAGGAT
CAAATTATAATGGCAATAAAATTTAAGAAATAGTAAAATATGTCTTTTATGCTTGACAAA
TTTGTACTCTTTATTTTCAGTTTTTTGTTTCTGGGTTTTTGTTATGTTCAGTTTTGGGGG
AGATTTGAGAGCCAATCCCAGTAGCGCTCAGGACTTTTTCTGGCTCTGTGCTCAGGAATC
ACTCCTGGCAGAGCTCACCATATGTGGTGCCAGTGCTCATACTCTGATTGGCCGCATGCA
AGGCAAGTACCCTCCCTACCCGCTGCACTTCCTCTCTAGCCCCTGCCTCAGATTTTTAAG
AACTGCTGAGTAATGCTTTTATTTGCAAGTATATTTTCCCTTGAACTTGTTTAAATATGA
ATATAGAACTAAACCTTGTACATGTTACTAAAGAATTAATCTATTAATCTGTTTTAAGAA
TGAACTACAGCTTTTTTTTTTTTTGCTTGTTTAGAGACATTGGTTTATTTTGGCATAATT
TTGGTACCAGTTATCTAACTTTTTCCAATTACTTTTTCCAAACAGTTACCTGACCTTAAA
GATGCTGAGGCTGTTCAAAAATTCTTCCTTGAAGAAATACAGCTTGGTGAAGAGTTACTA
GCACAAGGTAATAATCTTTGCAAGAATAGGAAAATTAAAGTATTCTTTACACTAATGCAT
GTGATTTTATTTTAATAAGAGATATTCTAAATATTTCAAGAAAAGTTTTTATATAACACG
AAAATTATTTTTCTCAAATAATTTCTGAGGGAAGCGCATCATTTTTCATATTTTATTTTG
AATCAGTTTATGTTGATTTAGAGAGAGAAATAAGAAGATTGGGTTACTTTGGGCTAATTT
AGAGTACTTTTCTGCTCACGCATGACCTCGTTTATAGGTGTGTAAAATGTAAAACCTTAG
GGAATTTATTCATTTATTTATTGTGTTTTAGGACCATGCTCAGTGGTGCTCAGGGTTTCT
CCTGGGTCTGCGCTGAGGGATCACCCTGGGCAGTGCCTGGGGGTCTCAGGATGCTGGGTG
GTTTGAGTTCTGGTCAGCCACGTTTGAGGCAGGCGCTGTTCCCGCTATGCTATGGCTCCA
GCCTAATCGTTAAGAAATTTAAAACAATTTTTTTTGCGTGGGGCGGGGGCAATAATCTGT
GATGCTTGAAGGCTACTTCTGGTTTTCTGTTCACTGGGGGTCTAAAGCAAGAAAGCAAGT
TTTTCAACTGTTGGGCAACTCCTCTGGGGTCCTGATCTCAGGAGCTAGGGTTTGGGGGAT
TAAACTTTTTTTTTTTTTTTTGCTTTTTTTGGGGTCACACCCGGGGCAATGCACAGGGGT
TACTCCTGGTTCTACACTCAGGAATTACTCCTGGCGGTGCTCAGGGGACCATATGGGATG
CTGGGATTCGAACCCGGGTCGGCCGCGTGCAAGGCAAATGCCCTACCCGATGTGCTATCG
CTCCAGCCCCTGGGGGATTAAACTTTTTGTTGTTTTGATTTTTGGGTCACGCCTGGCTGT
GCCCAGGGATCACTCCTGGTGGGGCTTATGGGCCTTTATGAGGTACCAGGGATTGAATCC
AGGTTTGCTTTGTGCAGAGGCAAGTGCCCTGCCTGCTATACTATTTCTCCAGAGCCCAAG
GAGTATTACGCTTTCTTGATGCTTTTTGGAGTGATGGGCTGGGGATACCATACCAGGCAG
TGCTCAGGGAAGCATTTGGAATGCCAGGGGTTGAGCCTGGTTGGGCCACTTGCAAGGCAA
GCACCCTACATTCTGTCCTAATGCAGTCACTGCTTTCTCAAAGGAATGGCTTGTAGTCGG
TATGATTTCTCTTTCCTTGACCATGGTCATACACCTGTTTCAGAATTAGTGGTTTAAATC
TGATCTAGAATTCAGCTTGTATGCTCAAAGTTTCTTGTTTTTATTTTGTGAGGGGGCTCC
CAAATGCAAAGCATGCACTCCAACCTTTGATTTCCCCAGCCTTTAAGGGTTCTTCTTTCT
TTTTGGGAAAGGGTGGCCATTGGGCTCTATGCTATAGTGCTAAGGGGGTATTACTGATTC
TGTGCTCAGGAGTAACTCCCTCAGTCCTTGGGATCCATATAAGGTGCAGGGGATTGAACA
GGATCAACTGCATGCGAGACAAGCATTTTACCTCCTGTGCTGTCTCATGCGCCTGATTTT
ATATTCAAAGTAAAAGGGTCCCATTGGGCTCAGGAGATAGCTGAAAGGCTGAAATACATA
TTTCACATGGCATAGGCCCTGGCGTGGTCCCTAGCACCTCATGGTCCCCTGTGCCTTGAT
AGATACTGAGCACTGCAGAGTTGGTCTCTTAAAAAAAAAAAAAGCATTGCTGGGGTGGGT
TTAACTCAGTGGGGTTTGTGTTTATTCAATTAAAATGGTCACATCATGGCTGGAAGGTAG
TTGGCCTTGCATGTGGCTGCATTGGCCAACACCTTGGTTTGGTGTGACCTCAAAACAACA
AAAATAGGGGAATGAATTTGCAGGTGAAATAATTTTACTGAGGAAGGATCCTAATGATAG
GGAGAAGGTATGGGGAGAGAAGTCATTTGAAGTCTGAATTGTTTTTTGTTTGTTTGTTTG
TTTTTTTGCTTTTTGGGTCACACCTGGCAATGCACAGGGGTTACTCCTGGCTCTGCACTC
ACCGGCCGTGCTCAGGGGACCATATGGGATGCTGGTATTTGAACCCGGGTCGGCCGCGTG
CAAGGCAAACGCCCTACCTGCTGTGCTATCTCTCCAGCCCCTGAAGTTTGAATTGTTTTA
TATCAAATTAGCATTTATCTCTAAACAGCTTTGAAGAATTATTAACAGTAATTTCTAGGA
CAAGGTTTTGGTTTTTTTTTTTTTTTTAACCTCCAATTTTCATTGCTATCATTACAGAGT
TAGACAATGTTGAACTCCAAAAGCCTTTGGGTTTTTGTTTGCTTCGTATTAAAATTTATT
TTGTTTATTTTTTTGCTTTTTGGGTCACATCCAGAGATGCTCAGGGGTTCTTCCTGGCTC
TCTGCACACAGGAATTACTCCTGGCGGTGCTCGGGGGACCATATAGGATGCTGGGAATCG
AACCTGGGTTGGCCATGTGCAAGGCAAAGCCCTACCCGCTGTGCTATCGCTCCAGCCCCC
ATATTAAAATTTTTTTCTTCTTAAAGATTTAGATGATTGTTGCCATCTTTATCATTCCCT
TTTCTAGGAAATGTTTTTGAAGAAGTAATTGTTACTTTTATGGTAAATTAAACTTGAAGA
TAGGGGTTGGAGTGATCGTCCAGCAGGGCAGGTGTTTGCCTTGCATGTGGCTACCTAGGT
TTGATCTCCAACATCCCATATGATCCCCTGAGTAACGCCAGGAGTAATTTCTGAGCATAG
GAGTAACCCCAGAGCATTGCCAGGTGTGACCCAAGAAACAAAAACAAAAAACCAAACAAG
AATTTCCTTACTAGTACAATTATGTGGCTTTTCCTCCATGTAAATGAGGGCAGTGGGGGA
CTGGACAGTGCTACAGTGGATAGGATGCTTGCCGTGCACGTGGCAGCGGACCAGGTCTGT
CCCAGGCACTACACAGGTCCTGTATAAGCCCTGCCAGGAAATGGTCCCGAAGGGCAGAGC
AAGAGTAAGTCCTGAACACTGCTGGGTGTATCCCCAAACAAACGAAAAATATAAGAAGTT
GGGAGTTAATTGTAGTGGTGAAGTTCTTAAATTCTTTTTTTTTTTTTTTAATTTTTATTA
AATCACCATGTGGAAAGTTACAAAGTTCTCAGGTTTATATGTCAGTTATACAATATTCAA
ACACCCATCCCTTCACCAGTGCCCATATTCCACCACCAGAAACCCCAGTATGCCCCCCGC
CCCCACCCCCTACCCCCTACTGTATAACTAATGAATTTCACTTCATTTTTTCTTTACCTT
GATTACATTCCATAATTCAACACAAAACTCACTATAGTTGACATAACTCTCTCTCTTTTT
TTTTTCTCTTTTTCCTTTTCCCTTTTTTTTTTTTTTTCTTTTTCCCCCTCATCCCCCTTC
CTGCGCCTCATAGTATGGTGTACGCCACGCCACGTCGGCCAGCGTGGGGCTTTTGCTTAG
TTCACAGTCCAGAGGTGGCTGCTACATTAAAAACCTTCAATATTTTCAACAAAAACTTAC
TGTTATTATTTGGAGTTTCCCCCCCCAGTCAGACCTGTTCAAATGGACCAATTCACATTG
CTGACAATTATAAATGTTAAGTCGCGCGACGCTACCGCGTCCGCGCGATTTTGGATTTCT
GTATAAAGTCCAGGGAGAATTCTGCCAGAAATTACATAGCCCAGCTCACAGTCCCAGTGC
ATTGCTGTAAGAAGTCTCTGAATTCAAAGTCTTTAGGCGCAGAGGGTCCGATTCGCGCTC
AGTGGCTCTGGGTTTATCTGGGCCGAGGGCGTGCCAGTTACGCCCCCTTCCCATGAGTTC
CTGGGAGCCCCCAAAGTAAAATCCGAATACCTGTGGGTCTGGAATCAGAAGATGGCGCCT
GCCACATGGTGCCGCCAGCCCGCCGCTTTCCATGTAGGGAGACAGGGTGGGGGGGGAAAA
AAAATCCACCCCCAGCAGCACCGAGTTGTAGCCCAGTTTGGTGTCCCAATGCATTGCTCT
CGGGTGCTGCGCTGGATGCCCGAATGTGTTACATCTTTGGAGTCAAAGTCTTTAAGCGCC
GCAGAGGGTCCGATTCGCGCTCAGCGGCTCCGGGTTTATAAGTTCTTACCATAACTTGAA
CAGGTCATTATGTTACTTTAATGACTTTGGATTTNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NGACCCATATGGGATGCTGGGAATCGAACCTGGGTCGGCCCATGTGCAAGGCAAACGCCC
TACCCACTGTGCTATGCTCCAGCCCCAATGTTGAACTTCTTGATGGAATTTCATCTCTTG
TGGAGGATAAAAAGTCATCATTGGGAAGGAGGGTGGAGAGTGGGTATTTGGGTCACTCTC
CTGGTAGTGATCAGGAGAATGGTGGTTTCTGTGTACAAAGAATGTGCTCAGCCTTTGAGC
TGTATGTCTAGCCCAGTAGTCTTAAGTTTTTCTGTAGAGTTCGTTCTTTAGTTTGAATAG
CTTAATCTTCAGATTTTCTCAAGTAAAACTAAAACCTCTCACTGGAGTCAATTCTCTGTG
TCTACAAGTCACCTTGGTTTTTGTTGTTCTGTTTTGTCTTTGTTTGGCTTTTGGACACAC
CGGACAGTGCGTGGAATCTGTTCACAGCTTGGGCCCCCACATGCACTCCAGCCCTTTGAG
TCTCTCCAGTCGCCGGTCATGTTCTTAAGTTGTCTTTGTTGTTGTTTCATCACCTGTGAT
GCTCAGGGCTTATTCCTGACTCTGAGCTCAGGAATCACTCCTGGTGGGTCTCAGGGAACC
ATGTGGGGTGCTAGGGACTGACTATAAACCCAGGCCAGCCACATGCAAAGCCAACACCCT
GCCTGCTGAACTATCACTCTAGCCTGGTCATGTTCTTCCTAATCAGCATTCTTCACATGA
ACTTTAAATTTACTGGCTTACTGTAAACTTACTACAACTTCCATCATTACTAGCCAGGTG
GGAGAGCTGAATAAGGGAAGGTATGAAGTGTGAGAGATTTTTTTTCCATGCCTTTTGGGC
ATGCCACTCCCACAACTCGTAGGATGTAATGGGTTCACCAGTCCAGAAGAGTCTGTATTT
GTCAGGGAGATAATTCAAAGGGCTGGAGCATATGCAAATTCCCGAATTTGATTTCCAGCA
GCTCTGCCAGCTGTGGCTGTAGACCACATCTCTGGTGTGGTATTGAACCTGAGCTTGAAC
TACTGAGACAGGTATTAGAGGTAATCGTTCCTGGACCTCCAGCACCACTGGCCTTACCCA
ACACCCAGTTAATTTCGTTACATACTTAGAATTCCATTAATGATCCTGTCACTTGCAAGG
AGCTCAAGGTGACTAGTAGACTGCAGTTGAGGTTGTGTTAGTAAGTGAATGTATCCTGAG
TCTCGGAAATTATTAGGCAATGCTGGATCTACAAAAGAGATTTAACTGTCTATGCTGATT
GGGTTCAGAAGAGATTTCAGGCCTCCATGGAGTCATTCATAAGCAGTGTGATTGATTTAG
CAATCATGTGTCTAGACCATATGTAGCCCTAGGTTAGATTTCTCATGGTCAGTTTTACTA
ATAATATAACTAAGGATCATAAGAAAGAAACTGGCTGAGTAGATCAAGACATTGACATAA
ATCAGATTTAAGACCCTGGAAAGAGCATTAGGAATGAGAAACAATACCTTGTTTATCAGC
AGCTTGTGGAATAAACGGCTGAGACACACCCTCCCTGCCTCCAAAGGATACTTAGTGCGT
GTCTTCAGACTTCCTGGAGTTCTGGAATGTTGACACTTGAATCATATAGGGGGCAAAAAA
GGAAATGAATAGAGATGGTCTGAAGTCATTTTCTACCATCATTAGTTGCTTTTGTAAAGA
CTCAGAATACATTCTGTTTTTCCATTTGTTTCTGCCGTATCCTTGATTTGCTTTATGGAA
TGACTTCCCTTAAAGAGAGGGAGCAAGTTTGATACTCTTTAGGTAGAGACTCTGCAGTGG
TCCCGGGTTTCCTAACTTGAGAGGTTTAGGACAGGTGAGAGATCAGTTAATGGCCCCGAG
TGAGATGCATCCTTTGTGTGCAGGAGGCCACCATCCGCACAGTCTGCAGTCGCCACCTGG
TATTGCTCAAACAGACCCAGAAATTCCTAAACGTTTGGGTCCTGGTATAAATTAAGAACA
TTACTAGTTCCTAACTCATAATCAGCATGATAGTAAAAATCATATTAATCACGCCAGAGC
AATAGTACAGCGGGTTGGGCATTCGCCTTGCATGCGGCTGGTCGGGGTTTGATCCCCAGC
ATCCCATATGGTCCCTGAGCACCTCCAGGAGTGATTCCTGAGTGCAGGGCCAGCAGTTAC
TCCTGAATACCACCTGATGTGGCCCCAAAACAAACTGACATGTCCAGAAAAGTTCTTTGA
GGTTCCGGGAACAATGTTATAGAGCTAAAAATATTAACTGAGAACAAATACCACATAGCT
AATAAATAAAAGCTTCAAAAGTTATAAGCCTTAAAGTGCCTGTTTTATATATATAATATG
ACTCAGTTTTAAATGTCTTTATGGTTGGTTTTGTGGATGTACTACAGATTTTGAAATTGA
GATTTTTCTTGTCGATCTTTCAGGTGAATATGAGAAGGGTGTAGACCACCTGACAAACGC
CATTGCTGTGTGTGGGCAGCCACAGCAGTTGCTGCAAGTGCTGCAGCAAACCCTTCCACC
ACCAGTGTTCCAGATGCTTCTGACTAAGCTTCCAACAATTAGTCAGGTAAGTGTATGGAA
GGTATCAAGTAGAGATGAGTGGAATCCGAGAGAAGTCTAGGGACATTTGTATTTAAAACG
CGTCTTGGAAACATAATAAAGTCATGAAGGAGACCCAGAAGATAAAAGCCAGGCTTAACA
ATTTTCTGAACATCCAAATTACGAGGCATATGGGTTTCCTGATAGGGCCCTGAGCAAAGA
TTAGAGCGCTAATATTAGGCATAACAGGGAATTCGTTAACTTATTAATGTGTTATTAATG
CAATACTTCATTGGTGGTGGTTTAATGATTAGTTTATTGCTAGTTTAATAATGAATAAGT
AACTATACTGAATGTGAACTTAATTGGTCCTATTGGGCCAAGTGCTGGAGGGAGAGACCC
CAGGGCCCCAGTCACTACCAGCCTGCCCCCATGTCCATCTGTATGTCTTTCTGTAATGGC
CAGGCCTAGGAGAATGGAGCATGGATTTTTTTTTTCAGTGAGGCACAGAAAGTATACTAG
CTTACATATGGGAGTGATGAGGTCATAAATTGTTACACGTAACTGACTACCATATAGCAG
AGTGTTAGGAAGTGGAAGTACGGTAGTAGGGGTAGAATATGGAACAAATTTTATGTTGAA
TTTGGAATCCTGATTAAATGCCTTTGATAATCACTTTTTCTAATTTCTTTTTTATTTCCC
AGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGAGATGGAGC
ATGGATTTTTTTTTTTCAGTGAGGCACACGAAAGTATACTAGCTTACATATGGGAGTGAT
GAGGTCATAAATTGTTACACGTAACTGACTACCATATAGCAGAGTGTTAGGAAGTGGAAG
TACGGTAGTACGGGTAGAATATGGAACAAATTTTATGTTGAATTTGGAATCCTGATTAAA
TGCCTTTGATAATCACTTTTTCTAATTTCTTTTTTATTTTCCCAGAGAATTGTCAGTGCT
CAGAGCTTGGCTGAAGATGATGTGGAATGAGAAACAAATGTCAACTTAATAATCTCAATT
AAAAATATTTTAAACTTTTAACTCGGAAGATGAACAGCTCTGGGGGAATAAGGGCAGATA
CGCTTGTTGTGGACTGTCATACACTGAAATCTACCAAAGTTCAGTTTTACTTTGTGTAGA
TCCATTTGTCTTATTTATTTTTCCCAGTGAAAAGTGTATTTTGATAGAGAGCTTTACATT
TTATAAATACACTATGAGTTACTGAAACACCATTGATTTTGTTTATTCCTAAAATGTGTG
ATTAAGGTGATCATACAGTCTCACATAATTTGCATTAAAATTAATCTGTGTTCGGATTTG
AAAGATAGGAAAGCATAGTAGAGGAAAAAGCTGAAGAATGCACATTTTTCAAGCTAAGTA
CTTTCTGCTGTGTATCCCGAAATGCATGGAAACGGTATATGTCAGAGCTCAGCAGTGAAA
TCTTTGAGATCACGTTTTCAGTCTGACCTCTGAAATAATGTGACGGATGCTCCTATACTG
ATTATAACTCCCATCCTGTGTTTTTCTTAAATCAGTGGATTTGAAGGTGTTCTGGGTTTT
AGATGGATATGTGTAGTTACAAGTAATACTGTAATTAGATCTATGTACCTTTCTGATCTA
ACCATGTGAACCTAGCTAGTTACTGTTTATCCAGTTACTTTTCTCATTTATAAAATGAGA
CTGGTCTGCTGATTCAGAGAATTGTTCTTCTCAACTTCTATTTCTAATTTGCTAATTTGG
TTCTGGCAGTATCTTCAAACCCAACGTTAACTTGAGGGGTGGGTATACTTGGGCAATTAA
ACCTTGCCAGTGGAGGTGGTTTTTTTTTTTTTTTTAGATGCTCTGAATTTTGCTTGATTG
CCCAACACTATTTCTGCGTTGATCTTATTTTTTAAGGTATGACACACGGGCCTGAGAGAC
TGAGGGATGTGCAGGAGTTAAGGCACTTGCCTGTCATATGGTCGACCCCATTATGACTCC
TGGCACTGTA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1121, 5475..5521, 8565..8646, 16223..16365, 17865..17909
1001..1121, 5475..5521, 8565..8646, 16223..16365, 17865..17906
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved