Sorex_araneus Locus ENSSARG00000001120
snOPY snoRNA Orthological Gene Database
Sorex_araneus ENSSARG00000001120
Sorex_araneus
ENSSARG00000001120
GeneScaffold_6038
SNORD58
1239..1303
3948
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNCTTTGTATAAACCCGCATTCCAAATTTTAAGCTTTAGATCAATCCT
CCACTTTTGCCCAGATTCTGGCCCCCTTTCCCGGCACGCCTGAAGAACCAGACTTGGTAG
TTTTAGCCTGCCTCCACATTTGTTTATTGGGAAATCGGGGGGGTGGGTCTTTTATTCTCA
GAGTGGTAGTCGGAGAAAGAAGATAATCTCTTACTTTCCAGAACACTCGGGAAACGGCTC
AGGCCATCAAGGGCATGCACATCAGAAAGGCCACTAAGTATTTGAAAGGATGTCACTCTG
CAGAAGCAGTGTGTGCCCTTCCGGCGTTACAACGGTGGCGTTGGGAGGTGTCCCCAGGTG
AGGATTCTCGGTTGCGGCTGGGAAAGACCGATTAATAAAAGCGGCTGGTGGAGGGGGGCG
GGAATGGCTCATCTTTACCGCCAACCCACCTCTCGCTGGTTGCTGTGATGACCATCTTAG
GACACCTTTGGATTGACCGTGAAAAAAAAAATGTTCTGAGCAACCTTGGATGTCGGGTGA
AATGGCTTCAATTTGGTTCTAAGGTTGGGGAAAGTGACTGATGATTTCTCTGTTTTCTTT
CAGGCCAAGCAGTGGGGCTGGCCGCAGGGTCGTTGGCCCAAAAAGAGTGCTGAATTCTTA
CTGCACATGCTTAAGAATGCAGAGAGTAATGCTGAACTCAAGGTACTGGCACATCAACAT
TGTTCTATACATGTAACTAGGTTAGTGGTCTGGTTAATTTCTGGTTTGGACTTTAGATTT
TTGTTTCCCAAAGTGGGTGATGGCCATGCATAGCTACAATGGGCGGGGGTCAGCAGGTTG
GGGGTGGTTTCTTTCTGCGTGGTTGCTTCTCTGAAAGAGGCTTACAGTTGCCAACAAATC
AAACCATTGTCTTCAAAGATGTAGCTATTCTCGTGTTCCTTTATTTACCAGGGACTTGTA
CACTTTCTTGTGCATTAATCCCTTTGTAAACCATCCACAATGGTTTGTGGATGATTGTTT
GGGGAAGGGGGGCCCATCTGGCAGAGGCTTCTGGCTCTGCACTCAGAGATCAATCCTCTT
TGGGCTTGGGGGGGGCCATAATGTGCTGGGCATTGAACTCCATTTGACCAGGTGAAAAGC
ATCTCGCCTGTTGTGCAGTCATCTGCCCCCAAATGGTTTTCTTGGGGTCAAACCTGGTAA
TTCCCAAGCCCAGTTTTCCTGGGCCAAGGTCACATGTAAGATAGGTTACCAGAATGATTG
CCTTAGCATGATGTGAAAATGGCTTGTTCTCTACAAAACCAAGATTGCTGGATTTTATTT
CAAAGTGATAAAACTGATAAATCATAAATATAAAGGATTTTGGGGGGTTTGGGGTTTTTG
TTTTTAACTATTATCTTTGGTTTTCTTATTTGAGAATCTGGACATAGCGTTGGAATAGGA
ATAGGCTTAGGTCAGTTTGACCTCTCTGTCTGCCTGGCTCTGCACTCAGGAATTATTCCT
GGCAGTGTTCGGGGGACGCAGAGAATCAAACTTGGGTCTGCTGCATGCAAGACAGATACA
TGAACCGCTGTGCTATTGCTCCCCGTCCGACTTTGAAACTCTTTAACTCACCATTATCCT
TGGAGCTGCCATTTAAGAACCATTGCTTTTAGCACTGATCCTTGGGGTCTGTGTTTTCGT
GTTTAGAGTGAATATTATTTGAAGTCTACAAGGTTTGACTTCCAAAGATGATTGCTGTCT
GATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAGCTCTCCTTG
CCACATTGAGATGATTCTTACTGAAAAAGAACAGATTGTTCCTAAACCTGAAGAGGAAGT
TGCACAGAAGAAAAAGGTATTTGTCACTGGGTTTCATTTGCTTGTGATCTTAGAAAGCAT
TGTTGGTTGCTGTGATGACTAACTTAGGACACCTTTGGAATAACCGTGAAAGGAAAACTG
TTCTGAGCAACCTCTGACCATTTTAACTTTTGTGGATCTAATTGTCTCTTCACTAATAAT
TAAGTAGATGAAAACTGATTTCTTCTGGTGGCCCTACTTAAATCTATAGCCATTTAAGAG
GCCGCATATTCATATCAATAGGCTTCTTCCCATCTCTAAAACCTACCTCATTTTCAGGAA
ATGTTTGCAGATATTTATGCTCCATCTGAACAGTGATTCTAGACCCCTCCCTATACTTGA
ATTTTTTTTCTGTTTTGAATGTGATACTCTTCACTGCACATCCAAGCACAGTGTTCTCTT
GATAGTGCTTCATGGTGTATACAAGTTTCAACACCACAGTAATTTATTTTCCAGTTTTTG
TGCTGAAATTTAGTCCTTAGGGAGGGGGTTTCTCCAAAAGACTTGACTTTACTTTTTCTT
TTCCCAGATATCACAGAAGAAACTGAAGAAGCAAAAACTTATGGCCCGGGAATAAGCTCA
GCATAAAATAAAAATCTTAAGTAAACCGATTTGAGTGTGGTTGTATTTTTACTAATAATA
CTACAAAATGAATCAAGTGAGTTTCCTTATACTTGGGATGGAAACAATTGATGCAGCTTA
CCTATTAACAGTTGGATTAAAAGTATTTTGCATCCCACATGTCCTTCACACACTGCCAGG
AGAAAGCCCTGGGTGTGGAGTCGGGAGTGACCCCCTGAGCATCACTGGGTATGGCCCAAA
TTTTTAAAAAGACTTAAGTAGTTGACCCAAAAAGCAATGCGCACCTTTGGAAGTCTTGGG
GGCTTACGTCTCCGTTTGTTTATGTCCTAGAGAGAATTGCACCTTTTGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1067, 1069..1136, 1383..1481, 2624..2719, 2820..2826, 2929..2948
1001..1067, 1069..1136, 1383..1481, 2624..2719, 2820..2826, 2929..2945
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved