Sorex_araneus Locus ZSWIM5
snOPY snoRNA Orthological Gene Database
Sorex_araneus ZSWIM5
Sorex_araneus
ZSWIM5
GeneScaffold_2676
SNORA58
10760..10884
67594
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTGCTCTTCTTTGGGCTCGAAACAGGTAA
CGGAGATACCCCTTTCTATCGAGTCATGTCCTTGTCTCCCTGCAGCTGGTGAAGTTTCCC
GCACTCAGCGCGGTGTCCGGCATAGTTGCACTTCGTAAGGGCGGCGAGGGTCCACGTTAG
GTCCGGGGCATCCGTCTGCTGGACAGCGGCGCGGTGGAGAACGTGCTGCAAGTCGGTAGG
TGCTCGCCCGGCCCCGGCCGGTCCCCGCACTCCCCTCCCGCAGGTGCCTTCGCCTCTGTA
GAGACCCGGGCCGAGCCCCCGGCTTTCCGCCCCACTTCCCCGCCGGAGGACAAACAAGCC
ACCGGAAAAAAAACTTTTCTTAACATTTCATTCAGGGCCACTGCAGCTCGTTCCCCCACT
GGCCTCTACTCCCTTTTCTTTTTGTTTGAAGAGCCAATAGGTTTCCTTTTTTTTTTTTTT
TTGACTCTTCATTCTGCGTCCCACGCCAAAGGCTGAGAGAGGACGGAGCGGCGTGCCTCT
TCGGACGGAATCATTTCAAAAATGCATTCCCTCCCCCCCCACCACCTCATTTAAGTTTAG
AGAGGAGAGAATTGTGAGGGAATCTGGGGCAAGCGGTCTTCCAGGGGATGTTTGGGGACA
GGCTGTCAAAGGCAATCGACTGTCTCAGCCGATTGCAACTGGACGTACTGAACTTTAATA
CTGTAGGGAAGGAAAAAGCAAGCTAACAAAATTCTGTGCATTTTAGATAATTTCAATTGT
CTGCTTTCATGGTCCTTTTCCCTGGACCGGTGATACTTAGGAATCTAGGCTGCGGACTAA
CAATAACCGAAGATGGAAATGTGACAGCGTCTCTCCGCACCCCCACCCAAGGCAAAAAAA
AAAAAAAGCCACACAATCTGGAGTGGGGGTGGGGTTTGTCTTCCTTGTCAGACTGGGGTA
AATCAAAGCTGCTCACGTTGGGTGTTTCAAATGATTCTCATTTAATAAGTCTTCCTATTT
GCTTTTGTTTTATGGCCCTTTTTTCCGGGAAAATGAAAAATGATCCCCCCACCCCCACTT
CTTAGGAGCTTCTATTCAGTTTTTTTAAAAAATCTCATTAAATATACAAAATAAATCTAA
GGCTTCTGATTTGTGGACTGGTTAAGGAATATGAGAAAAAATGACATTGTTTAACATTGA
CTTGCTATTTAGAAAATGAGAACACTGATTTATTTTTTTCTCTCTTGGGTTATTATAGCA
TTCCGGAAGTGTACATTATCTTGATCATTGTACATTATACGCTCATATTTATTTTTTAAA
TACTGGGTTTTGAAGGGAGTTGGAAAGAGGTTAATTTTAGAATTAGATAAGCATAGGAAC
GCAAATACACTGGCGCCCTAAACATCTAGCTGTCTTCTCCGCAGGTAAACATTTGATTAT
TTTTGCTTTGAAGAGAAGTTCGTTGTGATTTTAAGTAATCTAGTTTTGATTGAAGAGGAT
CATTGAATCCTATGTTTTTTTTTAAAAAAAAAAACACTTGTATTGATATCACAATTTGTT
CTGCAAATGTGAATTTAAATTTATCTAAATTTATCCTGTTCCAGAATGTAGAATTTAGTG
ACAGTGGATTGAAAAGTTTTATTTATTTGAAAGAGGCTAGTTCATGTTATGTTTTTGAAA
TAATGAATTAAATAAGCAAAAAATTGAAGCTTATAGTTTTAATACTGAAAGCATGAAAAT
AAATACAGGCATTTCTTCATTATCTCTTTAGTTTTTAAAATTTAAGTCAGTTTTAAGATT
CTTGTTTGACATAGACTGAAAGTTAAGTGGTCATTTAATAGTAAGAGATGTATTTAAAGA
ATTTTCAAACTTGAGGGGGCCAATGAAAGAGAGGAAGAGTTTTAAAGAGGCATTTTTTGA
AATCAACTTCAATGTTAAGTTCCAAATGAAATCAGCTTTTGTGGATGGTTAGATGTTTTT
CTTTTTTGATATTTTGAATATTATCAGGGTGATGAGCTTGTATATTGCAATTTTGGATAC
TGGGAAATAGGAGATTCTTGCTTTGGAGCTTTAGATGAAACTGGGAGATGAATTAAATCA
GTTTCAGGTTATGTGAACCCTGAGCTGTGCAAAGTTATTTTTTTTACTTAAACATATGCT
GTTGAGTGTGACAGAGAGGGATATTCCAGTAGGTATCATTTTGAACTTTGTATCTTGGCG
TGAACCACCTTTTAATAGTAAAATTAGAAACTCATCTCTTATCTCTTGAACTTAAAATTG
TATGTGACTTAACCTAGATAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNGTCAGACCCCAGTCAGCCGTGTGCAAGTCAAGTGTCATAACTACTGTACTGT
CTTATCTTTCTGGATATACTTACTTTTTAAAAGACCTGTTACAGTCAGAAAACAGTGTAT
GCTTTTTAGGGATACATAAGAACATTTTTATAAATTATAAGCATAAGAGATTTTTAAAAT
AGGAGCTGTTCTCAGTGTACATGGCAACCACAAAACCTTAACAATGCTTAGGGTCACCCA
TCAGTGCTTAGAGGAGACACTGTTGTTGGGGATCAAACCCTATCACATGGTAGGTATATG
CTCTTTTTTCCTGAATGGTCTTTTTTCCTTATGCTTAGAAATTTTAAATCATTTTTGGAG
GGAGTGAGACCTTTCAACCCAGTGCTTTAGAGTCCTTACCATTGTTCTTTCTCTCCGGCT
CTTGCTTTTTTATTTATTGTTGGTGTTGGGGGGCACACCCTGTGGTGCTCAGGGTTTACT
TCTGGCCCTGCACTCAGGGATCACTCCTTGCAGGTTTTGGTGGACCATATGGGGTGCCAG
AACTGAACTGGGTTGACTGCTTGCAAGGCAAGCACCCTGCCCGCTGTGTTGTCTTTCTGT
TCCTTGTATCTTCTTTTTTTAAAAAAACAAAACAAAACAAAACTTAATTCCTAACACTCC
CTCTATCTCAATACATCCCACACACATTTTAATGTTCAGTAAATGATGAATAGTCAATAT
TATTATGAATGGACATTTCAGTGTTACAAAGCTAAAAGAGTAAAAGAGCAAGGGAGAGAA
ACTTGAATCCTTAATGTAGTGCACTATTAGAAGATCACTGTCACTGTCATTGTCATCCCA
TTGCTCATCGATTTGTTCGAGCGGGCACCAGTAACATCTCTCATTGAGAGACTTATTGTT
ACTGTTTTTGGCATATCCAATACGCACGGGTAGCTTGCCTCGAGGGCTCGATACTCTCCA
TAGCTTGCCAGGCTCTCCGAGAGGGGCAGAGGAATCGAACTCGGGTCTGCCGCGTGAAAG
GCAAATGCCCAACCGCTGTGCTATCACTCCAGCCTCACTATTAGAAGATATGGAAGGAAA
TTCTTCTGTATACAATAATTTGATAACATTAAGTGGTACGAATATTACATATCTGTATCT
TTTGTTTATTATCTACTTTATGTGAATAATGGTGATAAATGAGAGGGTCTTTTTTTTAGG
GTGGGGGAATGTTTTAAGCTGTATTTGTCAGTGCTCAGGGGGCTACTTCTGGCTCTGTGC
TTTGGGGACTATGCAGAATAGGCTGTATCTAAGAAAAGCATCTGACTTATATATTTCTCT
GGCCAGTCAAATGAGAATTTTAAGTGAATTCTTATTGATTAATTTCTGAAACATAGAACT
CACATTTTATCATTAAAAATTTTTTTTGGTCTGCACCTGGTGGTACTTGAGGGGTTATTC
TTTTTTTAAAAAATTTTTTTTTATTTTTAATTAGTGAATCACTGAGGGTACAGTTACAGA
TTTATACATTTTTGTGCTCATGTTTCCCCCATACAAAGTTCGAGAACCCATCCCTTCACC
AGTGCCCATTCTCCACCACCAGTAAACCCAGCGTCCCTCCCACCCTCCCCAGTCCCGTCT
CCTCCCACCCCACGCTGCCACTATGGCAGGGTATTCCCTTTTGTTCTCTCTCTCTGACTA
GGTGTTGTGGTTTGCAATAAAGGTGTTGAGCGGCCATTGTGTTTAGTCTCTAGTCTACAT
TCGGGCACCAGTCACCCCTCCCCCGCATGACCTCCAACCACATTTTACTTGGTGTTCCCT
TCTCTGAGTTGCCCAGAATGAGAGACCAGCCTCCAGGGGTTATTCTTGACTGTTTGGGGG
TCACTCATGGTGCATGGGGGACCATGATGGGATCAAATCAGGTCAGGCTGCAGGCAAGGA
CCTTTACCCCTTTTGGAGACGGCTTTGGGGCCACGTTAGCCTACCAGAACTTCTATGCCT
AAGAAATCATGCTCAGATTAGCTTAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNGTTACTACTCAGGAATGAATAGCAATTGGAAATACCAGAATAGCAACTTGAG
GGGTCAGAGTGATAGTACAGCAGGAGAGCATTTGCCTTGCACGTGGCTGACCCGGGTTTG
AGTCCGGGGATCCCATATGGTCCCCAGAGCATGCCAGGAGTAATTCCTGAGTGCAGAGCC
AGGAGTAGCTCTTGAGCATTGCAGAGTGTGACCTAAAAAGACTAAATAAATAAATGGCAG
CAACTTGAGAAATAATAATAGGCAAATTTCAGTATTGGTGGAAATACCACATATTTGCCA
GAATACCATCTGTGTATTGTCTTAAGACTTACATAACATTATTATCTTCCTTTTTTCAGA
TGATGAAAAATATGCACAGAGATTTTAGGAAATTCTCCCAGGCCACTCAGATAAGACTTT
CATTTGATTTCAGGCTACATATATATACCAAGTAGTCTCTTCCAGCTCTGTGCTTGGGGG
TCATTCCTAGTGGTGCCTGAGGAACTGGGCAGTGTTACAGATCAAACATGAGCTTCCTTC
ATGCAGTACCTGTGCTCAGCCTGTTGAAGTATTTCTCCGTCCCTTTAGGCACTCTTAAAC
ATGATGTTAAATTATCTTAGTTTTTTGTCATCTAATTAAATGTATCAAGAGATCTGTTAT
CTTCACACTTCAAATAGCCAGATGTGGCCCCAAAACCAAAAAATAAAAATAGTATATGTA
ATTTTTGTTAAACCTTTTTTCTTTTGCTTAGGGCCACACCCAGTGGTACTCAGGGCTTAT
CCTGACTTTGCATTGAGGCATCACGCCTAGCAGGGTTCAGGGGTCCCTATTGGGTGCCAG
AGATCAAACTCCAGTTGGCTGTGTGCAAGCAAGCACCCTACTTACCCACTGTATTGTTGC
TCTAGCTCCATTAATTTTTCTACTTCCTCTCTGTGTTTATTTTCTAAGTATATTTTTTTA
ATAACGATTAAAATATTTTGTTCAATAAAAATGGAACTCTGGTTTTGAAAGATATGTATG
TACGTATACACACACACACACAAACACACACATACACCCTTTTCAAGAGTCATGTAAAAG
TATACTAGAAAACCCTTTAATGCAAGGGTATTTCTAAGTCAATGCCAGGACTTTGGAAGC
CTCGTTGTGCTTCAGCTATGGTTGCTGGCACAGATGGAGAGCGGAGACCACTATCTCATA
AAGCTGATACTTAAAAGGGTCGGTAGCTGCTCTTCAGAGGTTAATACAAGGAAAACCTCT
TGATTTGCCAAAGGAGTCTTGGGAGGAGAGCAGATGGCCACAAGAAGGGCCCTTCAGCTT
ACTCAGCTGCTCCCAGAAGCTTAGGGTGACCTTCTGATACAAACAAACCAAGTAGCTCTC
AGAGTAATAGGACAGCATCGTTTGTATCCCTGAATAATAATCATTCTCACATTGCATCTC
TCACACCCTCACCCAGTGAGTGGGAGCCATCTGCTTCTTGTGAACTTATACAGGGCACTG
GCCCTGGATGGTTTGGGTTGCTATTAAATAATATCTTTGGGAGATAAGTTCTTTAAAAGG
TTATTTTCACATAAGTCTAACAGACTTTCTTTCTGAAGAGAAATTTTGTTATTTTGCTTG
TCACTCTCACTGTTTTAAACCTTGGTACGCAACTGCTTTGCTAGGTGATGGAAGGGAGAA
AACGGAACTGCCTGAACTGCTGAGGCCTTCCTGAAACAGNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTCTACCGTCTCAGGACGACCTCACCAA
GATACAATCTGCTTAAAACTCAGGTATGCAGTTTTTGTAACTGAAATCTCCAGGCTTTCT
CAGAGTTGGGATGGGTTACCTCCCCCTACTTCCAAAATGCTTGTAAGTACTGATAGTTAC
CCCCACAAACCAACTCCAGCGCCACCATGTATGCTCTACTACCAGTCTTGCTTCAGAGAC
CCATAAAAAAATCTCAAAAGAGCTCAAAAGCCGCAGTTAATCTCGGACCCACACATGGCT
GAACAGACTGGTGTAAATCAGGTGAGCTGGGGGGTAGTCTGGTGTCTGCCCAAGCAGAGC
CCTGGCAGTCACTTGCTTCCATAATCCAAAATCGCCGCCATACCCCTGGCCTGACTCCAC
CGTCTCAGGATGGACCTCATCAAGATACATTCTGCTGAAAATTTGGGTATATGGGTTTTG
TGGCTGAAATATCTAGGCTTTTTTGGGGTCAGGATGGGTTACCTCCCCCCACCTCTCTAT
ACTTCTGGAAGCCTCGGCAGTCACATCCACATCTCAAACTGCCACCCATTTGAAAAGCTA
CTCCAGTCTTAGCATCCTGATAAAAATACCGAATGCTCTGAGCAAACACCATGACCTCTT
AACACCTGTACTGCAAACCATAATGCACCAAAGGAAAAGGAGAGAAAGCAAGAAGGAAAG
TGCCTCCCATAGAGAAGGGCTGGGGGTGGGAGAATGAGGTGTTGGGGGATGGTGATAGGG
AAACAGGGGACATTGGTGATGGGAAATGTACACTGGTGGAGGGATGGGTGCTGGATCATT
GTATGACTGAAACCCAATTATGAACAGCTTTGTAATGACTTAACTCACGGATATTCAATT
AAAAAATTAAAAAAGTAATGTGGAGTTCATGCCCAATTCAATCAGCTTAATCAATGGCTG
AATAAATAGCAGTACTACTACATTAAATTAAAAAAAAACTAATGAAACTTGCTGTTTTTT
ATTAAAATATATGGAAAGCTGGCAGAAACATAAAAGCTGTTCCTCTGAAGCATAAGTATG
GATTATAAAAAATAATCTTAGTATTTCATTATTATTTGATTGTGTAAAAGTTATGATTCT
GCTCACCATTAAGAAAAAATATTCAATTATTGGCTGGCTTAATTTTAATAATAAAATCAG
ATTTTATAAATTTGCCTAATTTTCTCTATTGAAGATATGAATAATTGAGTTAAGGATTTA
CTTTAAATTTTTCTGTGATAATGTTGGACTGGAGCAATAGCACAGTGGGTAGGGCGTTTG
CCTTGCACTCGGCTAACCCAGGTTCGATTCCTCCATCCCTCTCAGAAAGCCTGGCAAGCT
ACCGAGAGTATCCCACCCACACGGCAGAGCCTGGCAAGCTACCTGTGGCGTATTTGATAT
GCCAAAAACAGTAACAAGTCTCACAATGGAGATGTTACTGGTACCCGCTCAAGCAAATCG
ATGAACAACAGGAAGACAGTGCTACAGTGCTAATGTTGACTTGCAAGACTTGTAAATATT
TACTTTTTCATTAGTTACTGCATCATGCCACCACCCCTTCTACTATGCCACTCTTCTACT
ACTGTCCCTAGGATTCTACCCATCCACTCCGTCTATCCTGTAACTTCAGTTCTGTCTTCA
GAGTGTTAAGGGTTTGTTTTCACTGGACATTGTCTACTCCCTTTCTATGTCCACATTATT
ATCGTACATGAGCAAGATCATCTGGTATTTGTCCTTCTTTCAAGTTATTTCATCAGGACT
GGAGCGATAGCACAGCGGATAGGGCGTTTACCAAGTTATTTCATTGGTTGAATTTTAAAG
AGGTGTGACATTGTACCTCTGAAACATACAGCATACAGTCTTATAAATCAACATTACCTT
TATTAAATGTTTTAAATATTTAGGTGTTAATTTATTCATTCATCCATAAACAAATATTTG
TAAACCTTTAAGTGTGTCAGATGAAAATATAAAAGTGAAAAAACAACTTCAGCTTTCAAG
AATGGTTTTGTTATTTTTAGAAATTTTAAACTAAGATAACTTTTTTTTTTGCTTTTTTTT
TGTGGGGGGTCACACCCGGCAATGCACAGGGGTCATTCCTGGCACATACACTCAGGAATT
ACCCCTGGCGGTGCTCAGGGGATCATATGGGATGCTGGGATTCGAATCCGGGTCAGCTGC
GTGCAAGGCAAACGCCCTACCCGCTGTGCTATCACTCCAGCCCCTAAGATAACATTTGTT
TGCAGGAATATAGGGGTACAGTGTTATCACACCACACCCACCACTAAAGTGCCAGTGACC
CTCTAACATGGTAATTTGGACTCCCTCTCACCTATCAGCCCGCCTTCCCTTGGAATTGGC
AGCCTTGGTTCTCTGGTCAGAGTCTGAGGGCTTGTTATCATTAGACACTATTCCCTTGCT
TTGTTCCTCTTTATACTACATTTAAGTCAGATAACCCAGTATGTGTCTTTGTCCTTCTGA
CTTACTATGTATAGCATGATATCCTCCAGTTCCACCTATGTCATTGCAAAAGACAAGATT
TCATCTTTTTAAATGTCTTTAGTATTTTATTGTGTGCATATACCATTGTCTTTTAAAAAA
ATTTTATTGACACTGATTTACAAAGTTGTTCCTAACAGAGTTGTTTCAGGTATACAATGT
TCCAACACAAATCCCATCACCAGTGCTCCCCCTACCCCCACCAATGTCCCCAGGTTTCCT
CCCACATACCAGCCTGCCTCCTCGGGAAACATATAACAAATTTATTTCATATTACTTGTT
TCAGTAAAACTTAAAGGAATGGCAGATGGAATTATTAAAAAATAATAATAAAAGTCAATT
TGTGATGAATGATTGCTAAGGGATTTTAACAATATAAATAATACATTAATTAATCATTGA
ATATATGTAAAAATTCTTCATCTAGCTTGCAGTATATATATCAGTGTTGTCCCGTTGTTC
ATCAATTTGCTCGAGCGGGCACCAGTAACATCTCCTTTGTGAGACTTGTTGTTACTGTTT
TTGGCATATTGAATACAATACAGGTAGCTTGCCAGGCTCTGCCATGAGGTTAGGATACTC
TTGGTAGCTTGCTGGGCCCTCCGAGAGGGGCAGAGGAATTAAACCCGGGTCAGCCACGTG
CAAGGCAAATGCCCTACCCGCTGTGCTACATATACCTTTCCTAATTTGGTAGAGGGCAAT
CATAAGCACCATTAGCAAGTGTCATGTTTAATGCCACATGTTGGGAAGTTTGTCCTGTCC
TTTAGAGAAACTTTTATTTTTTTTTAATAATTTTTAAATTTTATTTTTATCAAATTGTCC
ACAATAATTAATTACATTTAATATTTCAACACCAATCCCACCACCATTATATCTTTGTAG
CTTCCTACTTAATTATTTTTGATACTTTGTTCTTTCTGTTCAATCTTTTACAATCTTTGT
TTTTTCCTAGTTCTTTTTTAAAAAAATTTATTTTCAAAGAGTTGTTCACAGTAATTGATT
ACATTCAATATTTCAGCACCATTACACCTTCCCACCACCATTATTTCGAATTTTCCCACC
ACCACCCAAGCCTGTCCCACAGGCAGATGCTAAATAATTTATTTTATATTGCTTATTATG
AATAATTGACTAAAAATGATCCAAAAAGGTTTCCTTAAAGGAATGGTGTGAAAATTGTTG
TATCATCTTGGAGCTATTAAACCCTTGTATTAGAGACCATTAACGTTGTTAGAATTTGAG
TCTTGTGTGCCAATATATGTACATATATACATATTTTTTGGACAAGATTCGTTATCTTTT
ACTTTACAGCCCATCAAATGTGGTATGCTACTCTTGGTATATCAGTGGCATAATGTATGA
AATCACAGCCACATACTCCTGGAATTCTAAAATTTTACATAGGGTACTAGAACTGTAGTT
AATTTTTTTTTTAACTGGTTGGTGATTTGAGGGTCCAGAGGTATCTATGCAACATGTTGC
TCTCTTCCGAGATTCATTGTGGGTCTCTGGATCATGGTTGCAAATGTGCTTAATGACACC
CAGAGGTAGTTCGTGAGCATAATTGCCAGGAAATCAGAAGGGCAGGGAGATGGGAGAAGG
AGCCCATTCATGAGTCCGAGCAAACCTGGAGGTTTCATTCACAAGTCCGACATACCTGGG
TTTTTCAGTGGATTCAGTCTCATGCATGGGGAGCTGTGAAGGTTGGCTGTGTGCATGGTA
GCCATTGGTTTCTGGAGGTTTGCCGCTTCTGGGGTTCTTTTGGAGCAGGTGGAGGGACAT
ACCTGTCCCCCTCCATGGTGATCAGATCAGCCTGGCAAAGGGTGGGAAGACATCTCTGTA
CGTGTTGCTCTCTTTTGAGATTCATTTGTGAGTCTTTCCTAGTTACTTCTTTTTGGTACT
TTTGTTCTTTTTGTTATCCTGAATGGGATTGTTTCCTTTATTACTTTCTCTTCTATTTTA
TTTGTATATAGATATGCACAGAGTTTTATATATTGATTTTGCAGTCTGCTGGTCTGTTAA
TTTGCTCTGAGATTCATTTGTGAGTCTTTCCTAGTTACTTCTTTTTGATACTTCTGTTCT
TTTTTGTTAAATTGAATAGGATTGTTTCCTTTATTACTTTCTCTTCTAGTTTATTTGTAT
ATAGATATGCAATAGAGTTTTATATATTGATTTTGCAGTCTGCTGCTTTAGTGTATTGGT
CTGTTATTTTCCATGGAGATCATGGAAGACCTTACAGAATAGGTATATTTGAATTTAGAA
TTAAGGATGCCAAAGACAGAAGGTAACATTTAGTATGGAAAGTTCATATTCAGACATATA
GAGTATACAGATAGCTTAATTTGGAATTCATAAGAATTTTAGTAAGTTTGTATGTTGAGA
AATGGTAGGAAATGTGCCATAGAGATAGAATTCACACCGTAAGAAGTTTGAATTTTATTC
TGTAATCAGTTGAGCTTTTTGAAAGATTTTAAGCATTTGAATTCAAGAAATATCTTTGTA
ATTTTTTATGTCAGATTCCAGATTCAGTGTTCTGTATCAAGACTGTATAATTAATTGTTT
TAGTAGGAATGACAGATTTTCTTTGTCTCTGCATCTATTGATGTGAACTTAGAATGTTTA
TTACTTCTTGTACCGATGGATGTATCACATTAATTGACGTGTATCTAGTGAATCATCCTT
GCATCCCTGGGGTAAATCCCATTTCCTTGCATCCCCCTGGTAAATCCCACTTGACCATAC
TGGAGCCATTCAGGGTTACACCCAGTGATGTTCAGAGGAACATGCAGTGCCTGCAATCAA
ACTGGGTTCAGCTACATGCAAGGCATGTGGCTTAAATCCTATACCATCCCTCCAGCTCCT
AGGACATTTTTAGTTTTATAAAGTACTTTGAAGAGACAGGTATAGTAAGTATTCTCATCC
CAAATTTACAGAGGCGGAAGCTGAAACTCAGGAATAAAGTGAATGGCATTGTAGTACATA
GTCAATAACAGATCCAAGCTAATTTTTAGTGTAATTTTTCTCTAACATATGAGCCTATTA
GAATATCTGGTATAGCCACATCTATACCAGAGAGAAACTTCTTAGTTCTTCTTAGTTCAA
TAACTTAGCTATCCTTAGTTACTGGAAATTAATATTAACTTTTTCATAATGTGTATCATT
TTTGTATTGGGTTTAAATATGCCTTTATAAGTGTTAATTTTGCATTTTACTTAATGCTGT
TAAGTTTGGGTTTTTTTAAATTAGCTATAATTACTGAAACTTGAACTTCAGAAAGTTTTC
TCTCTGCATTTTTGGTTTTGATGGAGTCTGAGCCATACCTGGTTGAACTCAGGGTACATT
CCTGGCTCAGTGCTCTGAGATCACTCCTGGTGGGGGGTGACCATAGGTGGTGCCAGGAAT
CAACCCAGATCAGCTATGTGCAAGGCATGTACCTTACCCACAGTCTTATCTCTCTGGCCC
TCTGTGCATTTTTCAATTCTGAAAATTTACATTGTTGTAGCAACTTCATGAGGTTGTTAT
GATGACTTATTAAAATTACCTAACAGCTCTGCAACATAATAGGTAATTAGGGCATTTGCC
TTGCACATGGCCAGCCCAGGTTCAATTCCTCCAACCCTCTTGGAGAGCCCTGCAGGCTAC
CGAGAGTATCTTGCCCACACGGCAGAGCCTGGCAAGCTACCCGTGGCATATTCGATATGC
CAAAAACACTAACAACAAGTCTCACAATGGAGACGTTACTGGTGCCCCCTGGAGCAAATC
TATGAACAAAGGGAGGACAGTGCTACAGTGATACAGTGATATTCTGTTAATATCTCTAGG
CCTAGCAGAAGTTTGATACTTGATATCTCAGACTTTTTTCCAGTGACTGTATCATTAGCT
GATTACATATTTTTTTGTAAAAGGTTATACTCTTACTTAGAGTAAAAAATACTCTAGAAT
GTATTTGCTAGTGATTTTCCTTATTGTACAAAGTTCTTGTAAATAAAGATAAATATACTT
TTATATTCTCAGCAGGTACTATCACTCCAGCCCTTAGAAGTCAATGTTTTAAGAAAAAAA
AGTCAGGGACACAATTGTACAATGAGATAGGGTACTTGCCTTGCGCACGTCTGACCTGGA
TTTGATCCCAGACACCCATATAGTCCCCCAAGCCCCACCAGGACTGATCTCCAAGCACAG
AGCCAGGAGCAAGCCCTGACCACTGCTGGGTGTGACTCAAAAACAAACAAAAAAAGACAT
TGCTGGTGGGATTGGTGTTGAAGTATGTATGCCTATAATCCAGGTATCAGTAACTTTGTA
AATCACAGTTTTTTAATTAAATAAAAATTACCCTATTCCCTAAAAATGAGAATAAGTCCT
TGTCTTCCTTGGTTTTCTCCCTGTCCTCATGGCATTCTTTTGGTTTCTTTGTAGTTTAGT
AGCACTCTCCTTATTCTAGACTGTATAATACTATTCAAATTGTCTTTGCCCTAGCAGTAC
CTAGAACTCAAAATCTAACGCAAAGGCTCTTAACTTTTGGGATTCCTTATTAACCTTTTT
GAGATTATGATGAAAAGCTATGAGCTGTTCCCTCTGACAAATATAATTATGTACAAATCA
AAGTTTGGATATGAATCGAGAAAGTTCTTGTACTTTCTGAAGATTTTGTTTCTATTTAAA
AAAAAAAATTGTGTGTTCTAGCGCCAGACAGCTAGTACAGGAGGTAGGACACTTGACTTG
CACGCAGCCCAATTCAGTCCCTGGCATCCCATATGGTTTCCCAAGGTGAACACAGCTGGA
TGTGGCCCAAAATCAAACCCCAAAAATGTGTGTTCCTTAAACATCACACCTGAGTTTCAT
TGGCTTTTGCGCTGTGACGAGCCTTCATATGTATAGAAGATATTCATAAAATCATTTCTG
ATTTGATAAAATTGAAGTGCAAATGAGAATCTTCAGGTTTCTTACTATAGAATTTCTCAT
TGTGCTGTCTTTGTTTCCTTAGGCTTCCATCTCAGTGGCACAGTAACTGAGCCAGCCACT
ACTTCGGAACCAGCAGTGACTTATAAAGTTGCAATCAGCTTTGATCGATGCAAAATCACT
TCAGTGACATGTGGCTGTGGAAACAAGGACATATTCTACTGTGCTCATGTGGTAGCACTT
TCACTCTACAGGATTCGTAAACCAGACCAAGTTAAATTGCGCCTTCCTATCTCAGAGACC
CTTTATCAGATGAACAGGGACCAGCTACAAAAGTTTATTCAATATTTAATCACAGCACAC
CACACGGAAGTTCTTCCAACTGCACAGAAACTGGCAGATGAGATTCTTTCCTCCAATTCA
GAAATCAATCAAGTAAATGGTAATTATACAACATTTTTATGACTCTATGTACTTTTGCTT
TATTTCATGTTTAGCGATTGGGTTATTTTTGTTGTGGTGGTAACATTCTTGTTCATCCTT
TCATAACAACCATATTATTTAGCTTTTTGCTTCTTGTTTATTTTTTATTTGGGGTTTTAG
TGCCGTACCCATTAGTGTTCAAGGGCTAATTCCAAGTTCTTTGCTATTCCAAGTTTTCTC
CTCATGTTGCTTAGGAGACTATATGTGATACTGGGGATTTGAACCAGGGTCAGCTACATG
CAAGGAAAGCACCTCAATTTCTGTACTATCTCTCTGTCCCTCAAACCTTTAATTTCTTAA
AAAGACAGTTATATATTATTTCTATTTACAATACCTGCCCCCAAAGCAAAAAAATAATCT
GTGTCACTCAGTGAAATGAAATGTAAATGGGAAACTCCAAACAATAATAGTGAGTTTTTT
GTTGAAATATTGAATGTTTCTTTGTAAAGAGAAAGTAAAGTGAAATTTATCAGCTACACA
GGCAGGGGGTGAGGGCTGGGGGGGCGGAGGGGTTGGGGGGAGGTTTACTGTGGTTCTTGG
TGGTGGAATATGTGCACTGGTGAAGGGAATTTGAGAATTGTGTAACTGAGACTTAAGCCT
GAAAGCTTTGTAACTTTCCACATGGTGATTCAAAAAAGAAAAAAACAACAACAGAAAAAA
AAGATTTCTCTTAATTGTAGTATTTCAGGAGTCTAGGGCTGGAGAGAGAGAGAGAGAGAT
CAGAGGGCTGAGTGCAGGCTTTGCATAGGAGACCTGTGTTTGAACCCTAGCCCCATATAT
GGTCCCTCTGGTACCACTGGGAGTAACCTCCATGCATCTGGAATAGCTCCTGACCATCGC
CAGGTGTGACAAAAAAACAAAACCAAAAAATTTCGGGACTCTACAAGTATCTGTAAGTAT
TATGTTTATGAGCCATAAAATGGAAGCAATAGGGTGTGCTTGAAGGGCAAAGAAAGTAAG
TGAAGAGAAACTTGCTCACTCATTCAATCAGCAAGTATATATTGAGTACTGTGTGCAAGC
AATTAGTGCTTATTGTTATGGGCATAAAACAGACATGGTTCCTGCTTTCAAGTAATTTAT
AATCTAATAGAAAAGATAACTAAATCTGTGCTTTTATAATGAAGTCAGACTGTAGGGACT
TAATCATAAATTATTGAAGGATTTTGAAAAGAGGAGCTATATGAGCCAAGTTTTCGCTTT
GTATGTTCCATTGTATTCTGGGTATCATGCAAAAAGGTCTTCATCTATGTTAATTCATTT
AGTTTTCAACCTTTTCAGATAAGTGTTCATAACGATTTCTGTTTTATAAATAAGAAAATT
AGTATAACCAAGAACAACATGACTTCAGAAATTAAATTCTTTTCTGTTACTTTATATAAC
CTTTTTATTTTTTATTTTAATTAATTGATTTTGGAGGTTGATTTTGTGTCACACCCAGTG
GTGCTTAGGGGATGCTTCGTTTGGGGGCTGCTTTATGCCTGGTATTGCTGGGGGACTGTG
TTGTGCTAAGGATTAAACCCAAGGCTCAAACATGCAAAGCGAGTATCCAGCCCTTTGAGC
TATCTCCCTGAGCCCTGCCTTCCTGTTGCTAGAAGATAATGTTGGTGAGGGCCAGAGAGA
GCTTAGCTGACTGAATGTATGTGGGCATTGGGACACAGTATGATCCCCAGGTACTGCTGG
GGGCAATCCCTAAGTACAGATCGGGGAGTAACCCCTGAATACTGCTGGGTGTGGCCCAGA
AAACAGAAACAAATGAGTTGACCACACACAAGGTAAACACCTTAATTCATGTTATAGCAT
CTCTTTTAATGAAAATTTAAATGTTCTAGTGAATGCAAATAGGAACTTTTCTCTCTCTTT
TTTTTTTCCATATTTTTGTTTGGTTTTATTTTGGGGGCATATCCAGCATGCTCAGTGTCT
ATAACCCACTTTGCTCTCTTCCGGCAGTGCTCCAGGAACCATATGGGGACAAACTTAGGC
CTCATGCATGCATGCACTGCAGCCCCTTGAGCTATCTCTTTGGCTCCTACTTGGTTTTTG
TATGTTTGGTTGGTTGGTTTTGGGTTGGGAGCCACCCCTGACAGTGCTCAGGGCTTACTG
TGACTCTGTGCTCATGGATCACTCCTGGCAGTGCTTGAGGTACTATATGAAATGCCAGGG
ATTGAACTACATTAGGCCATGTGGAAGGCAAGTGCCCTGCTCAGCACCCTTATCTTTTCT
TAACAAAAAGATTTTAAAATTATCTTTCTTGTGAGTGAAGGAAAACTAGAGAGACTTGTT
GTATACTCCAGACTTATATCTAGTTAAAATTATAACTTTAATTATAGCTTTTGGGGCTGG
AGCAATAGCACAGCGGGTAGGGCATTTGCCTTACATGCAGCAGACCCGGGTTTGATTCCC
AGCATCCCATGTAGTCCCCTGAGCGCCGCCAGGGGGATTCCTGAGTGCATGAGCCAGGAG
TAACCCCTGTGCATCGCCGGGTGTGACCCAAAAGGCAAAATAAATAAATAAACAAATAAA
TAAATAAAGCATAAAGTCGGAGGAAATGTGTTTGACTTTTGTCAACACTAGGTTTCCATC
TGAAGCAGAACATAAGAAGACAAGGCCAGAAATGAAACTGTGGCATGAAATGGAAGGCCT
TGAATGCCATAATTTTGTAAGAATAGCACCTTGGGGGCCAGGAAATAGTACAGGGGTCCA
GACATGTGGACAGTAATTTGATCCCTGGCACTGTCTGGTATGTCTCTGAGGAATACTACC
TGAAGATCCTGCACTGCTGGGCTGGCCTTTGTGATCTCTCACACTGCAGCCTGGGGCCCT
GGCGTTGAGCCTTCTAGTTCATTTGTCTGGGAATCGCATAAAGTGGTCCAGACTCCCTGA
GTATAATTTGGGTGCCCCCCCATAACCCCTATGCCCCCCAAATAAAATAGTACCTCACTA
ACATCTTTGGAAATGAAAGTAATATAGTCCCAACTATGTTCAGAACTACATTTGAAGAGA
AGTAGCATATAGTAGATATCTTATAGAACGTCATATGTATTCATTTGTATTTTCAGAATA
AATGAATGATTGAGCACTCTAAATTTCTGGAGAATGAGAAGCACCTGGGTTTTATTCAGG
CAGGATTTTAAAATAGAGAGCCAAGAATAAAGGTAGATTGATTAAACATGACATGATTTG
TACCTGTTACATGACGACATTGTGAAATGTTTGCTATAGTCTGCTGTCCTTTGGAGACAA
GTTTCTAAAAACTTATCACAGAACCCTAACTGATAAAATGAAAGTGTAAGATTCAGCTTT
TATGCAACAAATATTTCCTGGGTGCCCATCAGGTTATCTGCATTGTGATATTGGTGATGC
AGCTATCAACAAGGAGCTAACAACTTCCTAGGGGAGAATGTATAAATAGTGTTTTTAACT
GTTGTTGAGGTAATTCCAGATATGAAAGATATTTTGAGCATAAATTTGGGTGAGAGGAAT
TTGGAGCCACACATGGCTTCGCAGAGTGAACTCCTCATGGGGCCCAGGGAACCATTACAG
TGCTGAGGATCAAACTGGAGTCAACAGTGTGCAAGGCAAGTGCCATACTGTGCTAACTCT
CCAACCCTATTGAGTATAAATCTATAAAATTATACTATATACGATTCTGCCTGTGCTTAA
TGGGCCAACATTCTCAAAATTTGAAAGTGTTGATTCCACTGAGAAAGTATAATTTAAAAA
ATGGAATTTTTAAGCGTAGGAAGATAGAACACTTGCTTAGTATGTGCTAGACCCCAAGTT
TGATCCCTGGTACCACATGGCCCTCCTGGGCCCACACACCAAACCTTCAAGCCCACACCA
CTGAGCCAGCCTTTATCAGGAATCCTCAAACTCAAGTAGGGTTGGCACCTATAAAAAATA
AAAATGGACTTGTTAATTTTCTAAGAAAGTTTTGGGGGCAGAGCTCCTGAGCATCTCACA
GTTGGGGGGCAAAGGGGCAGCACAGGAGCCACTCCCAATGGTACTCCACCCAGCCATGAA
GGACAAGCAGTTCAATACTCGGGTGCCATGGTGTTTAGGTACCACCAGAGTCAGTCAGCA
GTGTAGAGCTTGGAGGACAGTGCAGTACTAGGGATCAAACTCTGGGCCCCATGCAGGCCA
GGCCTGTGCTCTGCCCTATGAGCTATCTTCCCCAGCCCCACTAAGAAAGAATGTTTATTT
TAAAATAATATGTGTACTTTAAGATTTCTTTGAACTTCATAGAAAGACAAAAACAAACAA
AAAAACATAAATTTCACTCTCCTAGAGAAAAAATAACTATTTCTGTTTTGTACATTTCTA
TCTGGAATTTCTTCCCTGCACCCACCCCTAGTCCCCAGATAATACTTGTAGACCTGGGAA
TAAAATTAATACAAGAAAGGATTGTGAAAATACAAGTTAGACTTGAATGTACTTAAAACT
AGGTTTGTATCTCTTACATAAGTTTAGGACCGTGTAATTAACAAAAGCCCAGATCAAGAG
AAAATACCTGTTTTTTAATAGAGTAACAAAGTGTTGGTCTTGATGAATATTTGTCATATG
AACCAAGACATTCATTCCACCTTTCCCGTTCATCGCAGGTGCCCCAGACCCCACAGCTGG
GGCCAGCATTGATGATGAGAATTGTTGGCATTTGGATGAAGAACAGGTGAAAGAACAAGT
GAAACTCTTTCTCTCTCAGGGTGGTTACTATGGCTCTGGAAAACAGCTGAATTCAATGTT
TGCCAAGGTAAGGTTTGAAAAGATTCCCCCTCCCCGCTTAAAGTGAACTAGGCCTGACAC
AATACTGGCTTCATGCATGCATTGACCTTGCAGTACTGAATGCTGAAACTTAATCGAAGG
GGCTAATCAGGAGCAGACCTGAGCTGGCTGCATTGAGGGAGCAACTACTCTCATCCCGGC
AGTCCTCTTCCTTCTGCTCCATTTTCTATAAAAGAGTTGATGTGGCAGTGGGATTTTGGT
TAATGTAAATCCCCTCTACTACCAACTAAAAGCTGCTTGATGAGGCCTTGAATATTTTGG
AACTAGAGAATCTTTCTGCCCTTCTCTTCTTCCTCTCCCTTTTCTTGTCACTATACAGTT
AACTCATTTAATGTGTAAAGTTCAACCATTTTTAGAATGTTCATAGATAATATGTGGCAG
TCATAGTGTTCAACTTTAGAACATCTTCATTACTTTTTTTTTCATCACTTAAAAAAAAAT
CACATCTGGGTGCTTGCACACATCTCACCCAGGTTCCATCCCTAGCACCCCATATGGTGT
TCTGAACACCACCAGGAGAGATCCCCTGAGTGTAGAACCAGGAGTAACCCCTGCGCACTG
CTGGGTGTGCCCTTCACCCAAAAAAAATCAAAATACACCCCCCCCCCATGTAAAGAAATT
AAACAAACCACATGTAACAGGAGAGTTAGTACAGAGGTTAAGGCACTTGCCTTGTGTAGA
CTGTGGCCATGACAAAGGTTTGAAACCAGCTTTACATATGGCCCTCCAAGCAACTCCAGA
TGTGGCCCCAGAGTACAGAGCCAGGAGTGGCTCCTTAACACTGCTGGGTGTGGCCCCCAA
ATAAAAAATAAGAATAAATAAAAAGAAACCCACACTCTATCACATCTATACGACCCATGC
CCATCTATGGTGAATCCAGAGCAATCACTAATCTATCCTCTGAAGATTTTCCTGTACTGG
ACTTCTTTAGAACCAGAATCATATTGTACGTAGTTTTTTTTGTGACTGGCTTCTTTTACT
ACCATAATATTTTCAAGGATCACTAGTGTTTTATATTACCGATATTTCTTTGTATGTTCA
AATAATATTCTATTATTTGTAATATCCCACATTGTTTAGTCATTTATCTATTGATAAGCA
TTTGGATTTCTCCACCTTTTGGCTACTTTAAACAGTGCTATAAACATTTTTTGCACAAGT
TTCTATGTAGATGTTTTCATTTCCCTCTAGGAATGAAATTAATGGGTCATATGTTAATTC
CACATTTAATTATTTGAGGTACTGCTAGACCAGTTTCCAAAGTGATCGTATCATTTGATA
TTCTCACTATGTGAGAATTTTAATTTCTTTATCTTTTTGCCACCCCTTTTATGACTCTTT
TTATTTTATCCATGCTACTGCATGTGAAGATATACTTTATTGTGAGTAGAAGACTTTCTT
GATACATGCAGATAATCTGTCTACAAACCCACAGACCTTTTTGATTATTGGAAATGTGCT
TAGATATTTCTTCTCTTCATCTTACCCTTCCTTCTACTTTTTTATGATGTGCAGTCACCA
ACACCTTGTCCTGCCTTATGTATCAGGTTCGAGAGATGCTGCGGATGAGAGATTCCAATG
GAGCCAGGATGCTGACCCTAATAACTGAACAGTTTATGGCTGACCCACGACTTACTCTCT
GGAGACAGCAAGGAACGAGCATGACAGATAAGTGCAGGCAACTCTGGGATGAGTTAGGTA
AGTACTCAGATTTCAGAGCAGTGCTGTTTGTCCTAGCAGGTTATCCCCCTAGTAATAGCA
TTATCATGAATTTCCACTGTCAATCATTCTATGAACCTTGCTAAGGGAACTTTAGGCCAG
CTGCTGGAAGATTCAGGATCTATAGAGTCTACCCAGAGTACTTCTGAGCCCACATTGCTT
CCACAGTATTGCACTCACTGTGACTCCAGCATCTCTTTCAGATATCATCTTAGGAAAGTT
CTTGTTGAGAGGAAACCTTTCCACTTGGCTTTTGTTGCATAGCACTAGCCTGGCTCTTCA
AAAATATTGACAGTTTGGGGCAGAGAGATAGTACAGCAGGTGAGGCTCTTGCCGCCAACC
CAGGTTCAATCTCCCACATCCCATATGGTCCTCTGAACACCTCCAGGAGGGATTCCTGAG
TGCAGAGCCAGGAGTAACCCCTGATCATCACCATGGTGGCCAAAAACAAAATACAACACA
CACCAAAAACCAAATACAGATGCTTCGTGACTTAAGATTTTTCAACTTTATGGTGGTGTG
AAAGTGATACACATTCAGTAGAAACTACTTTATTATCTTTATCTATTTTAAATTTTATAT
TTTCCAAGTTGTTGTTTAATACTTAAAATGCCGCTTCAGCACCCTGACCACCACCGTTTC
AGTATTATTCCACCACTGCCCCAAGATCCTGCTTGCCTGCCCATTTTTGTCACCACAGAT
CACTGTTTTATTGGCATTGTCTCAGAGATTGTTTCCTCTTGAGGACTGTCTTATCTGTTA
TGTTACTTATATCACAGATACAGGAATGATAATTTGGCGACTTTTCCCCCTGTTGTCTCA
CTTCCCTTAGCTTGATACCCTCCAACTCCATCCAGATTGCACCAAACTGCATGATTTCAT
CTTTTCTCATAGCTGAGTAGTATTTCACTTTAAAAACTGGTGTGTGTTTTTATCTCACAG
TTTTATTATCCTTTCATCTGTTGTGGGCACTGAGTTGTTTATAGACCTTGGTTATTTAAC
ATGAATAATGTTGCGATGGAATGTTATTTTATCCATGCTACTGGGTGTGAAGATATATTT
TATTGTGAATAGAAGACTTTCTTGATACATGCAGATAATCTGTCTACAAACCCACAGACC
TTTTTAATCCTTGGAAATGTGCTTAGATTATAGTGTGCATATATCCTTGGAGATTAGTGT
TCTTGGGGTAGATGGCCAGGAAGTGAATAGCTGGGTCATATAGAAGTTCTAGTCTTATTT
ATTCAGGAGTCTCCAACTGTTTTCCATAAGGGTTGGACCAGACAGCATTTGAATTTTGAG
TTAAGACATTGTTTTTCACTTTCAGTATAAGTATTCAGTAAATTATATGAGATATCCAAT
ACTTTATTATAAAACTATACTTTATAATAAAGTATTATAAGATAGTTAATATTTTATTAT
AAAGTCTATTATAAGCTTATGATTGGGCAAAGTCATCTAATCAAAACTTTTTCTAAAAAA
CAGATTATATTAGATGGTTTTGCCCACTTGTAAGCTGTGGTCAGCCCCTTTTCTTAGCCT
TCTGAGCCCTCTTAAGCTAGACTAGGTTAATCTACCATGCTTGTTAGGTTTGGTACAGTA
AGTGTTGAAGGGGGGACACAACCAACAGTACTCAGGACTGATTTTGTGCTCAGGCATAAT
TCCTCACAGAACTCAGGGGATTGTATATGATGACAGAGATTGAACTGGGATCAGATACAT
ACAAAGCATGCTCTTTGACCCTGGTACTCTCTGGATTAGATGTTTTTTTATCTTTAAGAT
ATTTTCAGTTTAACAATATCTTTATCAAGACATAACACCCTGGTCCTGAGCGATAGTACA
GTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNCAGACTTGTTTTTGAGCAGTCGTTTTTCCTTCAGTCCTTACTCTTC
AGTTACCAACATTTTTTTTTATTCCTAAACCTTCAAAATATCCACCTAACTTTTTATTTC
CTATAACTACTGAAATGATTGAAGGGTTTGGAACTTTCAGATTAAAATAAAAAATGTGGG
CTCCTGAATAGTCTTTATTGTATCAACAAGATAATCTTCTCCAGTCATCCTTTGTCTTTA
TCATTCTCCTGCTCTAAGACTAGTCTTGCAGTGCTAATTCTCAGCTACTTTCATGTCTTC
AGTATCTTCCATATTCCTTTTTAATGCAAAAATTTCATTCAATTCTATTTATACTCTACC
TCTCTATTCAGTATGTGAGATACTTGGCAACAAAAGACATTGTAATAGCATTAAGAAAAC
TGACATATGAAATCCAAAAAAGGGCAAAAGAGAGCTGGAGCATGCTAACAGAAAAGATTT
GTTTTTACTTTGGGGCCACACCTGGTGATGCTCAGGGCTTGCTCCTGACTCTGTGCTCAG
GGGTCATTCCTGGGGACGTCTAGGATCCTATACAGTGCCAGGGATGAAATTCAGGTCAAC
CACATAAAAGGCAAGTGCCCTACCTACTGTGCCCTACCTACTGCACTATCTCTCCAGTCC
TTGGATTGCTATTTAGTTGTGGTTAGTCTTCAGACTTGATTCCTCATACTCAGAGCAAAA
AGGGAAATAGACTACAATAATGATCCTAGTGAAGAAGCATTCAAATTCCTAAAGGAGAAA
TCTTTCCTATGAATTAGTTACAGATTTCAGCTTTTCTGAAAATAATATAATTATGTTTGC
TGAAAATAATTAGGAGAGTACAATTTTTTTTCAAGTGTGGGCGTGAAGCAATAGTCTAGT
GTGTAGGGTGCTTACCTTACATAGGATCAACCCATATTTGATCCCCGGCACCGTATAAAG
TCCCTCATGCCCATCAGAGTGATCCATCCAGAGTACAGAGCTAGGAGTATTCCGTGAGCA
TAGCTGAGTGTGGTCCAGAAACCAAATATATATACATACACACACATATGTACATATTTA
TATAGCTAGTCACAATATTGTTAAAGTTTGTGCTATCAATACACAAAATTACTATGTCCC
ACTACTGCCCCACTTACTTCTGGTCTGGTCTTTTCTCCTCTCTCTGCCTCCCACTATTTG
TTAATTGTTCTAATATTCCAGTACTAATAGTTTATCATTGTTCATTACTGTCTTTTTTCT
TGTTTTGACACTATTCCACAAATGAATAAGATCAACTGGTATTTCTCTTTCATCTAACTT
GTTTCATTTAACACGATACCTCCAATTCCATCCACATTGTGGCAGACTGGGTGATTTCTT
TTTTTTTCTTACAGCTGTGTAGCATTCCTTTATGTATATATGTTGTAATTTTTGGAGAGT
ATCTTACATACTCATAACTCATTCTTTAGTCATACCCCACTTTTTAGTTATACTGGGAAA
GTTCTAAGTGGCATATTTTAAAAGTTCTAGTAAAATTATAATGAGGATTTTAGTTATTCT
GGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAATAACTACATTGTTG
AACGTTTCGTCTATCTGGTTAAGAATTACATTGACATTTTTCATTTAGTTCTCATAATAC
TCTCAGATAATATATGTTTATGCAAAGAAATAGCTCTGTTTACTTATAGATACTGGGGTT
AAAATAATTAGAGAAATTTGTCTCTTATGACATAATCATACTTTCTGTGATATTGAAATG
TTACACTATTAGTCTATCCTACTAGTCCAACCAGTTGTTACCAGATCACATGACTCAACA
ACACATGAAACTTAGAAACTGTGTCTAAACTTTTTCCTTAGAAAGATTATGACATGGACT
TTTAACCAGGCCTAGATATAGACATCTCTGTATTTTTAGATGAAATAAATTATCTCAGAA
AAGTTAAGTCAAGGTCACACACTTGTAGGTGGTGGTTTTAATGCTGAATCCCAAATCTTT
CATACTCCAAACCAAATATCCTCTGCAAATCTCACTTAATTCTATCTTGTTATTCCTTTT
TTCCTTCCGAGTGCACATTTCTCAAGAATTTTAAATCAGGGGCCTGAGTGATAGTACAGG
CAGGTAAAGTGCTTGCCTTGCATGTGGCTAACCCAGGTTCAATCCTCAGTACCTCATATA
GTACCTATGCACTGCCAGGAGTGATCCCTGAACACTGAGCCAGGAGTAAGCCCTGAATGT
CACTGGGTATGTCCTCCCACCAATTATCTTTAAATTAGGGCCAGAGAGATAGTACAGTGA
GTAAAATGCTTGCATTACATGTGGTTGATCCAAGTTCAAGCCCCAGCACTGCATATGGTG
TCCAAGCCCTGCCAGAGATAACTTCATCTGAGGCTTGAATTTCTTGGACTAATTTCTATG
ATGATCTTGAAATTGTGTTGTGGGTTTGGGCTTCACCTTTGGTGCAAAGATATGTGAGAT
AATGTAAGAGGAGCTGGCTTCCAGAGTTCTTAAAGTCCTTATGTTATACTTAGGTTTATT
TCAGAAAGCTCATGCTTCTGACTTTTTTTTTTTGGGGGGGGGGGGCATGCGGAGAATGGA
AGGCACACTCAGATGTGCTCAGGGCTTCTCCTGGCTCTGTGCTCAAGATCACCTTTGGTG
GTGCTTGGAGAACTATATGAGGTGTTGGGCATCGTACTTGGTCAGCTGTAAAAAATTACA
AAGATGCATGCGGGAGGGGGAGATGAGATGTGATGTTGTTNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNACTCCTGGCTTTGCACTCAGGAATTACCCCTGGCCGTGCT
CAGGGGACCATATGGGATGCTGGGATTTGAGCCCGGGTCGGCCTCGGGTCGGCCTCTTGT
GCAAGGCAAACGCCCTACCCGCTGTGCTATCTCTCCAGCCCCAATAGCTGTTCTTTCTTG
ATATTTATTTATTTTTGGTTTTGTTTGGGGGCCACACCCAGCTATGCTCAGGGCTTACTC
CAGTCTCTGAACTCAGGGATTACTCCTGGTAGTACTCAGGGGACCATATGGAATGAGGAT
CAAACCCAGGTTAAGCATGTGCAAAGTAAGTGTCTAACCCACTGTACTATTGCTCTGACC
CCATGATTTTTTTTTTTTTTTTTTGCCTCATGATTTTATAATTTTTTTTTTCTTTTTGGG
TCACACCCAGCAATGCACAGGGGTCACTCCTGGCTCATGCACTCAGGAATCACCCCTGGC
GGTGCTCAGGGGACTATATGGGATGCTGGGATTTGAACCCAGGTCGGCCTCGTGCAAGGC
AAACGCCCTACCCGCCCTACCCGCTGTGCTATCACTCCAGCCTCTTGATTTTAAAAAAAT
CTAGATATTATCTTTGTTTTCCTACAATGAAGTAAGGCTTTATCTCTTTAAGGATCATCC
CTGAGTATTCTTTCAAAAAAAATTTTTTTTTTTTTTGCTTTTTGGGTCACAACCCAGCGA
TGCTCAGGGGTTACTCCTGGCTTTACACTCAGGAATTACTCCTGGCGGTGCTTGGGGGAC
CATATGGGATGCCGAGGATCGAACCCGGGTCGACCGCGTGCAAGGCAAACGCCCTACCCG
CTGTGCTATCGCTCCGGCCCCTCAAAAAATTTTTTTTCTTATTCTTTTTAAGATAGGCCT
AAGGGCCAGAGAGATAGTGCAGTGGGTAAGGCACTTGTCCTTCACAGAGCTGACCTGGGT
TCAATTTCTAGCACCACATATAGTTCCCTGAAAAAAATGCCAGAACTGTTCATTGAGCAT
AGTTAGGGATAAATCCTGAGCACTGCCCAATGTGGCACAAAAACTAAAAGAAAAAATGAA
AGAAAAAATGGTTTGACTGAAGAAATTACAAATCTTTAAACTCTCTTTTCTTTTTGATGA
ATAATTCCGCCTTTAAAATAATGTATATCCTCTTGCATTTTACTAATAGCAGTCAAGAGG
ATCCAAACTATCTTTTTTAAAACCTTGCATAGCCAAGATGTGTATGTACACATACAAATG
TGTATGTGTGTGAAAATCTGAGATCCTGTATTTATTTATTTATTTATTTATTTATTTATT
TATTTATTTATTTGCTTTTTTGGGTCACACCCAGCGATGCTCAGGGGTTACTCCTGGCTT
TGCACTCAGGAATTACTCCTGGCGGTGCTTAGAGGACCATATGGGATGCCGGGGATCGAA
CCCTGGTCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCACTCG
CGTTCGATTCCCACGCTATTCCATTTGGTCCCCCTAGCACCACCAGGAGTAATTCCTGAG
TGCAGGCCAAGAGTAACCCCTGTGTGTCGCCGGGTGTGACCCCCCCCCAAAAAAAAAAAA
AACTATTCTGGCTTGCTTGAGTGGAGTGTGATGTGGTCAAAAATAACACTATCTCTTGAC
TGTGTGGAGTATGTGATATCTACTAGAGGGTCAGACAAGACCCAATAATAATATTTTCTT
GTTGTTTTGATTTGAGGGCCATATCCAACAGTGCTTTGGGGCTATTCCTGGCTCAATGAT
GGTACTTAGGGTACCATGCAGTGCCAGGAATTGAACCCGGGTCTCCTCCATGCAAAGCAA
ATAACCCATTGCACCATCTCTGTAGCCCAGTGTGATAGGTTTTTGTTTTGTTTGTTGTGT
GTTGTATTTTCTGTTTTCTTTCCTTTATTTGTTGTTATGAGACCACACCAGCCTGTGCTC
AGGGATTACTCCTGACTCTATGCTCAGAGATTTCTCCTAGAAGTACTCAGGGTATGATAT
GGGATGCCAGGGATGACTGATTGCAAGGCATCTCTCTGGCTCCTCAGTGTAATTTTAAGG
TAAAGTTTGTCAGTTGTATACAAATCCAAATAAATAATTTTCCCTGTAAAGGGGACTATT
CAAATTTTACTCTTCCCAACAATATTCAAGGCACTTAAAAAATGTTTCATTTAATTCTAA
GTGTTCCTACAGAATAAGTGTTGATACAATTTTCATTTTGCAGTTGAAGGATTTGAAGCT
TAAAAGCTCAAGATCAACTAATAATTGAAACATTTTCTGAACATCTAGCTCTCTTCCCAT
CCTTGTGTTTCCTTTGTGTTGCTATTATACCCTAAAATTTTGCTTTAACACTTATCTTAT
TTAAATGGCATTATTTATTTCACTCTTTCCCCTGGGAGGTGGGATTAGGTTCTTATTCTC
TCACAAGGACTCAAAGTTCAAATATGTCTTGTTCATCAGCATAGGAATGCATGCAGATAT
CACAGTAATCCTGATATTTAGGAAATATCCTTGTTTTTAGGAAATTTTGAGAAAGAAAAT
GAAACCCAGTTTTGAAATTTTTTGGTAGATTTATTCTTTTATATAAAGAAAACTGATATT
TTGAAATTTTTCTTACCAACTTAAAATTGAAAAAAAGAGTAACCTGAAATATTATGACTT
GTACATCAAAGGAGAAATAAGAGTAAACTGAAATATCATGGCTTACATACACATCAAAGG
AGAACTATCAAGATTATGGGTTGCTTTTATTTTTCAGGTGCCTTATGGGTGTGCATCATT
TTAAATCCACATTGCAAACTGGAGGAGAAATCCTGCTGGCTGCAGCAACTGCAGAAATGG
AATGACCTGGATGTCTGTCCCCTGGAGGATGGGAACTATGGGCATGAATTGCCCAACATC
ACCAATGCACTTCCTCAGAATGCTGATCACAGCCCAGGTAGACCCAAAATACTTTTGGGG
TTATTGTGCTTAGAGCTTCAAAAGGTCAGAGAATCAAAATCCTACAGAAAAATGAATGGA
CAGTCTCTTAGTTGTCATAATTGTCATCCTAAATTTTAAAAGCCTGTTGGTTAGAGGGAC
TGGAGCGATAGCAAAGCAGGTAGGGCATTTGCCTTGCACACAGCCGACCCGGGTTCGATT
CCTCTGCCCCTCTCGGAGAGCCCAGCAAGCTACGGAGAGTATCTCGCCCGCACGGCAGAG
CCTGGCAAGCTACCCGTGGCATATTCAATATGCCAAAAACAGTAACAAGTTTCACATGGA
GACGTAACTGGTGCCCGCTAAAGCAAATCGATGAGCAACGGGATGACAGTGACAGTGGGT
TAGAGGTAAAGTACTTGCTCTGCTGTGGACAAGTCCAGTTTGAATCCCCAGTTCAACATA
TGTTGCTTTTGAGAACTGCCAGATGTGGCCCAAACCCCCCCACCACACACACATACCCCA
CATAAAATATTAGAAAAAGTTTGTCTTTCTCTTTTCTTTTTTTTTTTTAAATGCCAAAAC
TTTAAAGGCAAACTTTTATCTTTGACATTAAGAGATGCGGTTCTTACCCACATTGAACGT
ATCTTGCACTGCTTAGGATAAATGCATAGAGCCCTTCAGAAAAATCCTCTGTTCCCTTCA
AGTTCTTCGTGACTAATGAATCTTGGTCTCAGGGATGTTTTTATCTTAAACGACCTACGT
GAGGGCCTGGAGAGATAGTACAGCAGGCACTTGCTTTGTATACAGTGAACTGGGTTCAAT
CCCTAGCATTCCATATGGTCCCCTGAGCACTGCCAGGAATAACACTCCCTCACCCCCGCC
ACCCCCCAAAAAAGATCTGCCTGAAAGGACAGATGAATGGAAGGCCTACAAAAGACAAAA
CACAGTTTTTCTTCCCACCATCAGCCCCCCCTCAAATTTTCTACAGCTAGGGAGGGTCAT
TCTCCCAAGTTACTATTAGGACTCATATTCCATTTCAAGATAAAGAGTATGATAATGTTA
TTATTATATCGTTATACTGTCACTTGAACTTTCTAGCCTACAGCTGTCACCAGGCATCAG
CATTTATATCAGTTCTATTTTTTAATTTTTGGCTTTTAGGCCAAACCCAGTGGTACTCAG
GGCTTCCTGCTGGGTCTGCACTCAGGGATCACTCCTGGTGAGATTCAAGGGATCAAACTT
GGGTCAGTCTCATACAAGGCAAGCACCCTCCCCACTCTATCTCTCCAGCAACTCACATCA
GTTTTAGGCAATCTATCTCAGGCTCTTGAAATTGGCAGTTGGATAGTTTTTAGCACATCG
GTAACATTTATTGGTAGAATATTTTATCAGACATTAATTTTACATGCAGTCCCTTTTATG
GGAGAAATCTACTGATTTTTCAAGGAAGGAATCATTTAAATTATTATTCTTGCTTTGTCT
GTATATTTGTCATAATTGTTTGTCTATATATTCTAAGTGTGTAAGGTAATGACTACAATT
TAAGTGTGAAAGGTAATGACTTCATTAGTACTCATCTAATCTCCACANNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAGCATACAGAGAATC
CACAAGGAAAGAGAATTACAGACCGATATCCCTGATGAACACAGACGCAAAGATCCCCAA
CAAAATATTAGCAAATAGATTCCAACAACTCATTGCTACTTATATGTAATTTTTTTCTCC
CTCTTTCTTAAAGTACTTACCTGATTTAAAGCTGACAATGCTCAGGGGCTACTCCTGTCT
CTGCACTCAGGAATTACTCATGGTGGTGCTCAGGGGACCACATGGAATGCCAGGGATCAA
ACCTGGGTCATCCATGTGCAAGGCTATTGCCCCAGCCACTGTACTATCACTTCACCACCC
GCCCTTGAAGTTTTTTGACTATTGGCTTGATAACACTGCTCACTCTGTCATTACTTCTGT
CCTAATTCTTGATGATTTTAATAGATACAGATAGTCCTTTCAGTATTTTATCCTCTTAGA
TCTTTGACCTCTTCTTCTTTGGTAGTCTTATCTGTTGGGATAGCCATAACTGAGGCATAA
AAATCAGAAGATCAAATCTCTAAACTTGGTCATTACCAGTAACTATACACCTTCATAATC
TCAATTTCAGCAGCTTTGATTACCACCTCCAGTTGTAGTAGCTTATTTTCTTCTCAATTT
CAAACAACCCTAATTACCACCACCGGTCATACTAGCTTATTTTCTTTAGTAACCCAATTC
TAGTAATTCTTTGGCCCACCAGGAAATTTGTTCCTACCTCTTGTTCTTTCTCTCGATAAA
CTCATTTTCTTCCTTATTCACTTTAGATTCCTTGGCGCACCATTATAACACTCTTTGCAT
ACATACTTAATCCCCCTTTCTCTTTGTTCCATTAATGTAGCAAAACCTTAACCTGTATTT
CTGTTTTAACCTCTAATTTCTCAGTGTTCACACTGCATGACTGGTGGAGGAAAAAATACA
ACTACAAAAACTGGTAATTTATAAGTTTTAACTGCTAATATCAAGTGGGTGTACAATACT
GTCCAGATACCTACTACATTTCCCAACTTTTATCTTTTTCACTTTATAAATTAATATTTC
TTACCATCTTTTCTGTTAAAGTTTCTATAATTTCTCCTCTTCATTCCTTTCCTCTTTTAT
CCTTGCTTTCTATTCACTGAAAATATAAAAGCAATCAGGAGAGAATTTCCAAAACTATAT
GACCACATCTGTCACTTTCTCTGCCTATCTGCTATCTTTTTCTGCTTTTGTTTATGCATC
TTGCCGCAGCAAGATCTTCCCTGCGGCAAGGCTGAGAGGACAAACCTAATGTTTTCCTGC
ACCCTGAGCACAGACCCCAGAGTTAGCCCTGAGAGCAGCCAGACAGACCCCCTCCCCAGA
CCAAAATACAGATTATAAGATGGAGATACAACATTCCATGAATGAAGCAAGATATCAAAT
TAACTGAAACAATAAAAATTGTTCTAAGTCAACTAGCAAGTTTCCAAGCATAGCCTCTTC
CTGCTGCTATTTAAGGTGCCCTTTTCCCTTCCTTTTTTGGGGAGCCTTTGCCGGCAGTGC
TAAGGGGACCCGGGGGTATTTCCAGCAAATTTTAGCCTTCAGGGTCCTGAAATTCACTGT
GAGGCTCTGAGGAAGCGACACTCCTTGGGCCCCAGGGGTGTGGGGTGTCTAGGTGCCCTG
GGGTGCTGGGGGGATTTCACATCCAGTCACACCCAGTGACCATTGGTGCTGGGTATAAAG
TTGGGTCAACCGCCCGCACCTAACCCCTATTATCCCTCTGTATTCCTAGAGAGCTTAGCT
TCAATCAAAAACAGAGAAATGACTGCTTTATTGGGAAAGGGGTCACCACAGACCAGGCCC
TGGCACGACCCAGATGCAGTTTTCCACCTTGCTCTTGGTATACGTGGCACCCAGCTCCCA
CCCAGCCTGTCATAGTTCACAGGCTTCATCCCTCCATGCCCACTTCCAGTGTCAGGTCTT
TCTCTCAGGACAGACCCCAAGTAGACTTTCTTTTTGAAAAAATGTGTGTTAAAAATTTCA
GGACTGGACCGATAGCACAGTGGGTAGGGCGTTNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNTATTCAATATGCCAAGAATAGTAATAAGTCTCACAATGGAGA
AGTTACTGGTGCCCGCTCAAGCAAATTGAGGAGCAGCAAGACAACAGTGCTACAGTTTAT
GCATCTAATTCCAATACCTCTTCTTTTTTCTTGGAATCCTTTTTTATTTATCTAGGACAT
TAGCCAGGAATTTCCTCTCTGCCCTGCATCCAAAAAATTTTGTGGATTAATCCTACAAAG
ACTACATACTGTTTCATCAATTCTCCCAAAACAAAGCACTCTTGATTCACTGGTCAGCAC
CCTATTTGAGGTAGTAGAAATAAATGAAAAAAATTAAGAAAAATAATTCAGAAGAATAGC
ATATGTAATGCTATCCCTATTTCTGCTGTTTTCTCCCTTGAACTCATTCTTTTTTTTTAA
TTTATTTATTTTATTGAATCACCATGTGGAAAGTTACAAAGCTTTCAGACAATGCTCGAA
CACCCGTCCCTTTACCAGTGCATATATTCCACCACCAAAAACCCCAGTATACCTCCCACC
CCCCATCCACCCACCCCCGCCTGCTTAGCTGATAAATTTCACTTCACTTTCTCTTTACCT
TGATTACATTCCATATTTCAACACCAAACTCACTATTGTTGTTGGGAGTTTCCCCCCAAA
AACAGCTCTGCTGACAAGGAAGCATTTGATAATTAGTTTTCCATTGCTGAGAATGAAGAG
ATATGAAGTCTCTTCGTATTTTGGTTTGGGAGTTCTGTATTTTGGTATTTTAATAACTAA
GTCCAGGGAGGGGCTGGAGCGATAGCACAGCGGTTGGGTATTCACCTTTCACTCGGCCGA
CCCATGATCAATTCCTCCGCCCCTCTCGGAGAGCCCGGCAAGCTACCCAGAGTATGGAGC
CCGCACGGCAGAGCCTGGCAAGCTACCCGTGTGTATTGGATGTGCCAAAAACAGTAACAA
TAAGTCTCTCAATGACAGACGTTACTGGTGCCCGCTCAAACAAATAGATGAGCAACGGGA
TGGCAGTGACAGTGAAGTCCAGGGAGATTTATGTTAGAAATTGCATCATTTCCCTTCCTG
GGGCAGCATGGGGCTATGGCTTAGTTCATGGTCTAGAGACATTGCTGCAAGCAGCTGCTG
GTACCAAAAGTAGTCTAGCTGGCCTCTGGATCGTGGCCGCTCAGCATCAGAGCAGGCGCA
CAAATGTGTGGCCAGCCAGGTCGCATCTCGTCGAAGAGCACACCAGTATCACCCCCCCCC
ATGCCCCCACCGCCCAAGATCGCCCACGTGTCCTGCTGTTGCAAGTTCATACCTCTTTTT
CTTTTTTTTCCTTCCCGAGCCACCAAGTTCGTACCTCCTTAATGGTCCTTATAACATGGC
GGACCCCACACTGTTTTTTCCCCTCCTTCGCCCGGCATGGGGCTATGGCTTAGTCACCAT
CCAGAGACATTGCTACAAGCAGCTGCTGGTACCAAAAGTAGTCTAGCTGGCCTCGGGTTC
GTGGTCATCAGCAGCAGAGCGCCGCACAAATGTGTGGCCACACGGTCGCATCTTCGTTGA
GAGCACGCTGGTATTGCCCTCCTTGAACTCATTCTGTGNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAAACTACTTTATAA
AATCACTGTATCACTGTCATTCCGTTGTTCATCAGTTTACTTGAGCGAGCACCAGTAACG
TCTCTATCACACTCAGCCCTGAGATTTTAGCAGCCTCTCCTTACTCGTCTTTCCCAATGA
TTGGAGGCTCTTTCAGGGTCAGGAGAATGAGACTTATCGTTACTGTTTCTGGCATATCGA
ATATACCACGGGTAGCTTGCCAGGTTCTGCCGTGCGGGCGGGATATTCTCGGTAGCTTGC
AAGGCTCTCTGAGATGTATGTATATATCTGTTACTATATTTGGGATATGAATATGTCACA
GGGAGTTTGCCAGGCTCTCCTGAGCGGGCAATAGACTCTTGGTAGCTTGTCAGGTTCTTC
ATGAGGGAGAACTAGGCTATTAGATGTTGCCTATAAAATAAAAATTAAATTATTTATTAA
TAAAAATAAAATAACTTTATAAAATAAAAAAATAAAGAATAGATGAGTTTGGGATAGGAG
ATGAGAGAAAGAAAAAAAATCATGATTCTAATATTTTAAACATAAATTTGCTATGGATAG
AGACAGGAAAGAACTGGAGCTACAGCACAGCAGGTAGGGCATTTGCCTTGCACGCGGCCA
ACCCAGGTTCGATTCCTCTATCCCTCTTGGAGAGCCTGGCAAACTACCAAGAGTATCCCA
CCCGCATGGCAGAGCCTGGCAAGCTACCCATGACGTATTTGATATGCCAAAAACAGTAAC
AACAAGTCTCACAATGGCAACATTACTGGTGCCCGCTTGAGCAAATCGATGAACAATTAG
ACAACAGTGCTCTACAGTGCTATAAAGTAGTTCATAATATTTGATTACATTTAATATTCA
AACACCAGTCCCACTACCCATTACACTTTCCCACCACCGTTTTTTGGATGTTTCCACCCT
GAACCCCAATCCCTGCCCCAAAGCAGAACCAAAATAATATATTTTGTATTGCTATTATGA
AAAACCGCTGAAAATGCTACAAAAAAGTATCCCTTGAGGAAAGAGTGTGAAGATTGTCGT
ATTTCAGCCAGGGCCCATTAAGCCCTTCTATAAGAGTTCACTAACATGTTGTTAAAGGTT
GAGCCTTGTGTGCTTATATACATATATATATATAAAATGATGATATATATATATATACAT
ATATATGTAAAGAAATATTTCCCTCTAAACATTGGTTGCCTTCTACTTTGAACCCCATCA
AATGTGGTGCGGTACTCTTGGATTATGGGTAGGGTGTGTGATATGAAGTGTCCAGGAATA
GGTTCACTCATGGGTGAGTCTCAGCCCAAGTGTGTGGAGAGCAGCAGTGAGCATGACAGC
GGTTGAGTTCTGGAGATTTTTGGCTGTCCAGGCTGGGTTCCTTGGGGCAGGGAGGGGTCT
CACCTGCCCCCACTCTGGGGCACCCCAAGTGAAACAGCCTGGCACAGGGTCTGGTGGCAT
GGTTATGGTGAGTGTCATGTTATGCTCCCTTCTGGGAAAGAAGGATATGCAGTCTGGATG
GTGGCCAATGATGATATTATCTGGCGCCAGCCAGAGGTGGCTTATGGGCATGACTGCTGA
TTTGCCGGAGTCTAGGGATATGGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNAAATTATGTCAGTTCCAATTCATTTGCTATGGGAATATAGCAGTCTCTCTGCAGAGAT
GACCTTAATTTCCAGAATTTTATGCTTAATGAATGAATACTCTACTATTCTATGTAAGTC
TCGATCATGACTTTTGCATTAGGTTCAAGAGAGGCCCAGCTCAGGGCTGGAGCGATAGCA
CAGTGGGCAGGGCGTTTGCCTTGCACGCGGCCACCCCGAGTTCAAATTTCAGCATCCCAT
ATGGTCCCCTGAGCACCGCCAGGGTTAATTCCTGAGTTCAGAGCCAGGAATAACCCCTGT
GCATCACCAGATGTGACCCAAAAAGAAAAAAAAAAGAGATGCACAGCTCATTTGGGAATC
TCTGGAAACCTCAGTTGTTGATCCTAAAGTACTTTCAACCGACCATAATCTGACAAAGAG
TCAGTCAAATTATCCTTAGTTTTCCACTTAAATGTCTTTTTGATGAATCCTTCCATATAA
CAATATATTCCATCAGATCTCCCTACCACCTATAAGAATTTATCCTACTTAAAAACAGAC
TGCAGACCAATGGAACAGAGTTGAATATCCTGTCACAGACCCCCAAATAATATGGCCACT
TAATCTTTGACAAAGGAGCAAGAAATGCAGAGTGGAACAAGGAAAGCCTCTTCAACAAGT
GGTGCTGAGAAAACTGGATAGCTACCTGAAAAAAAATGAACTCTGACCTCTGTCTAATGC
CAGGCACAAAAGTCAGTTCAAAGTGGATTAAAGACCTCAATATCAGACATGAATCGATAA
GGTTCATAGAAGAAAATGTAGGCAGAACTCTCCATGACATTGAAGCTAAAAGCATCTTTA
AGGATGAAACAGCACTGACCATGCAAGTGGAAGCGAACATAAACAAATGGGACTACATCA
AACTAAGAAGCTTCTGTACTTCAAAAGAAACAGTGACCAAAATACAGAAAGAGCCCACAG
AATGGGAAAGAATATTTACCCAATACCCATCTGCTAAGGGATTAATATCCAGGATATGCA
AGACACTAGTAGGATTGTATAAGAAAAAACCTCCAACCCCCTCAAAAAATGGGGAGAAGA
AATGAACAGAAATTTCCTCAAAAAAGAAATACAAATGGCCAAAAGGCACATGAAAAAACG
CTCCATATCCCTAGTTATCAGGGAGATTCAAATCAAAACAATGAGATATCATCTCACACC
ACAGAGACTGGCACACACTCAAAAGAACAAAAGCAGCCAGTGCTGGCATGGATGTGGGGA
AAAAGGTATGCTCCTTCACTATTAGTGGGAATGCCAACTGGTCCAGCCTTTCTGGAAAAC
AATATGGACAGTCCTTCAAAAACTAGAAATTGAGCTTCCATATGACCCCACAATACCACT
TCTGGGAATATATTCCGAGGATGCAAAAGAGCACAGTAGAAGTGACATCTGTACCTATAT
ATTCATTGCAGCACTGTTAATAATCGCCAAAATATGGAAACAACCCGAGTGCCCTAAAAC
AGATGACTGGTTAAAGAAACTTTGGCATATCTACACAATGGAATACTATGCAGCTGTTAG
GGGAGATGAAGTCATGAAATTTGCTCATAAACATGGAGAGTATCATGCTAAGTGAAATGA
GTTAGAAAGAGAGGGACAGACAGAGGGACTGCACTCATTTGTGGAGTGTAGGGTAGCATC
ACATGAGGCTGACATCCAAGGACAGTAGATACAAGAGCCAGGGGGATTGCCCCATAGCTG
GAAGACTGCTTCATGAGCGGAGGGGAGAAGGCAGATGGAATAGAGAAGGGATCACTAAGA
AACTGATGGCTGGAGGAACCAGTTGGGATGGGAGATACATGCCGAAAGTAGATAATGGAC
CAAACATGATGACCTCTCCATGTCTATGCTGCAAGCTATAATGCCCAAAAGTAGAGAGTA
TGGGGAATATTGTCTGCCATAGAGGCAGGGGGAGGGTGGGAATGGGGGGGTATACCTGGG
ATATTGGTGGTGGGGAATGTGCACTGGTGGAGGGATGGGTGTTTGATCATTGTGTGATTG
TAACCCAAATATGAAAACTTGTAACTATCTCACAGTGATTCAATAAAATTTAAAAAAATT
AAAAAAAAGAATTTATCCTACTGATGATCCAGAGAGATAATACCTGAGACAAGGCACTTA
CCCTTGCATGCAGCAAGTCTCTATTCAATCCCTGGCATTGCTAGGGAATACTCATTGCCT
GAGCATCCTAGGGATCACTCTTGAGCACAGTGCCAGGAGTATCCCCCTGAACACTGCTAT
GTATGGCCCAAAAACAAACAAAACAAAAGTAGCCCACTGAGAATCATGAGAGATAGCTAA
GTTAGCTGGAGCACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTTAAAAAGGATTAATAATG
CTGATCAGCTTCCCTCATAAGACAATTGGAAGGCCTACCAAGATCTGATATGAGATTTTT
TTTTTTATGAACTGTAGAACTGTTTCTACTTATGTGTGCTTCCAGCAGATATCTAGAATA
CAAACTACATGATGAACTTGGAGTCCTATCAGCTCCAGGGAAGATAATGAGGGGAAAATG
TCTTTGAATTTAAGACCATTGCCTAAAAGACACAGTTCCAGAAGCCAGGCAGGGACAGAG
AGCAGGGTATCTCTCTTACTCTGACATTTTCCTTGTTTCCAGAACTGTTGCAGAGAGGCA
CTACAACCATCACAAACCTGGAAGGCTGGGTGGGCCACCCGCTGGATCCCATTGGCTGCC
TGTTTCTCACTTTGACTGAGGCCTGCCGCCTGAACGATGATGGCTATCTGGAAGTGTCAG
GTACAGGGCTTAGCTTGAGTCAAACCAAAACTTCCCATATCAACTCACTTCTCCTTACTT
GACACTGTTCCATGCATCAGGGAGCCTTTTTTCCCCTTTTATCCAAACTGGACCTCCCCT
GAGGCTTCCTTGGCTTTCTTTTTCCTACCTAATTTTTTTTTTCTTTTTGGGTCACATCCG
GCAATGCACAGGGGTTACTACCGGTTTTGCACTCAGGAATTACTCCTGGTGGTGCTCAGG
GAACCATATGGGATGCTGGGAATCAAATCCAGGTCGGCCACGTGCAAGGCAAATACCCTA
CCCACTGTGCTATTGCTCCAACCTCTCCTACCTACTCTTTACCCGGTGGATTGGCCCTGC
CCTGTCCTACTGCCCATTTTACCTTTATAGCTGTGCTTTGCTTCTCTCATTTCCCTACCA
TGAATGCCTGAAGAGTAGTGTGCCAGAGGAATAAGAACTAGAGGAACATAAGGAATTAGA
GGCAAAGACTTCACAGCCAGGTAGGAACAAGAATGCTCATCAAGAATATGTATACCAGGG
CTGGAGAAATACTACAGCGAGGGAGTAGGTTGCTTGCCTTTGCACATGGCCAACCCAGGA
TCTATCGCCCGCATCCCACATGATCCCCCAGGAGTGATTGGCACTCCTGTTACCACCAGG
AGTGATCCCTGAGCACAGAACCAGGAGTAAGTCCTGAGCTTTTGGTGTGACCCAAAAACA
AAACAAATAAAAATAAACCAAAAGAGTATGTATATTTCTTTCATCTAAATAATACTCTTA
TTTCCTACTCTCTTATTTCTCTTGGCAATTTTGTACCAATTTTACAAATGATAGAGGAAA
ATAATTTAGCATATATCAAAGTAGCAAAGACTAGAAACAGAACTGATCCTTTTCTTTAAA
CCACTACTGTATTGTATAAATACATTTGTTACAGTATTTAATACACTGCATTGCAATTTA
TTTGCAAGAGAGTCTTACTAAGCTGTCACCTTCTTGAAAATTGAAATTATGACACATTTA
TTGTGGTCCCAGCACATGATGCAATACTTTCCATTTAATAATTCCGTAAGTAGTTTATTA
CCAGATGTGGAGCTGGAGAGATAGTACAAAGATAGTATGGCAGGTAGGGTGTTTGCCTTG
CACACAGTCAACCCAGGTTTGATCTCCAGCATCCGATATCATCTTCCAACACCACCAGGA
CTAATCCTAAGTGCAGAGCCAGGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNTAGATACAAAGATTGACCCTAATCCAAGCTAGGGATGCCCTTTCCCT
TTACCGTGGTTTCCTGCAAAGGAAATCATTTTTGGTCTGTTTCATTTTGGTCTGCCACGT
GACATACATCTTAAAAACCTAAAGTTTTACTTGGAAACAATATCACTGATACCCACATAG
CTCCTTCTATATATCAGATCTTGGGATATATATCTTTGTATATGTCTCTTTGGATATATA
TCTTTGGGATATATGTATTTTTTCTATGTATCTTTGGGAGCTGGAATTATACTGTACTGT
TAGACTCGGGTTTGATGTCTGGAACCACGTGGCCTCCCAAGCATTACTGGGTATTGTCCT
GGAGACACGCAGGCACCACCATCATGGCTCTGGTTGTCCCTGGCTCTGCAGGACCCCAAG
AAGCATCACATCTTCAGGCTCGCATATTGAACCGCTGGCCCAGTTGGCCAGGCCCTTGAC
TACCACTTGGGATTGCTCCTCGATTACCCCAAAAAGTGGACAGGTCACACATTCCAGCGA
AAGAGACAGACATTAGTATAATATTTTCCACTTCCCCAATTGGCCTAGCGATCTTATATA
TTGGAAAGGAGTTACAAGTCTTTGTAATAACTTTTCAGTGTGTTTTCCTTACTATACTGG
GATACTGACTCACCTTCCTCCTGCAAGCTGTTGACCAAACTATAACCTAAACTGGGAGGG
AGAAGAGCAGAATAATCCACAATTCTTCATCTAAGGAATCTGGTGCCCTATTGTCTTCAG
ATATGAATGAAAGCAGAGCTCCTGTGTATCAGCATGTACCTGTGACTCCAGACTGCCCAA
GCAGCAGTGAATCCTACCTGTCTTTGGCCCTAGAAGTTGCTCTGATGGGGATGGGTCAGC
AGAGAGTGATGCCTGAGGGCCTCTATACACAGGACAAAGTTTGCCGTAATGAGGAGCAAC
TCTTAAGTAAACTCCAAGAACTGCAGCTGGACAATGAGCTAGTGCAAACACTGAAGAAAC
AGTGCATCTTACTACTGGAAGGTAAGTGGAGAAGGGACTGTTGTCACACCTACTTGTGAC
TCTGATTTCCCCTCTACTAGAGCAGAGATGTAAAAATATTTTGACAGAGTGTGGTGAAAG
TTCCCATAGCTAATAAACATGTGGACTCCTCGGGTTCACGTCCAGGCTAGTAAATAGAAG
CATAAAGATTAATAACATGCTCGCTTATTTTCTTCCTGTAGGAGGACCTTTCAGTGGTCT
GGGAGAAGTCATTCATCGAGAGAGTGTTCCCATGCATACCTTTGCAAAGTATTTGTTCTC
AGCTCTGCTGCCTCACGATCCTGACCTGTCCTATAAATTAGCCTTACGTGCCATGAGGTG
GGTAATCCTTTCCCAGTCCAGTGGTTTCCCTAAATCAGAACTCACCAGTGCTCTTTTACT
TTGTTTCACTCATTTTCTCTTCTATCTTTCTTTATTTATGCTATTGTACCTACCACGAAC
ATGCCCTGAAATGGCGCAGACATTTGGTAGTTAGGATTCCTGTCTGGGATGACGTGCTGC
TCTCCCACTTTATCCCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNATTCCCCCCCTCCCCAGACCCAATTCCTGAGTTTTCAGTTAATAGTGAGGACC
CAAGACCTAAATCTGCTGAGAAGTGCTTTGAACCTTCCTGCAGTTCAGCTAAGTCATGTC
TGCCAGGCATTAGTCACCACAGGTAGCTGGGAGAAATCGAAGTATGTTTTTACCAAGATT
TTGGGAACAGTGAGCTATGGCCACTTGTTTCCAAGTAAAATAGGATCCAGGATTCAGGCA
GGTTGATCTCTTTCTACCTAGAATTTTAGGTCGCAGGAGAGAGAATTCCTTAGATCAGTT
ATAAAAAGGCTGCTGAAGATTCCTTGGCTTGCATATCTTCTAACTAGAAAACAATTAATT
ATATGGCTCTTAAACTGTCTTTCTGATCCATGATATGTCCATCTAATAGGGGAAGGACTA
TTCACCTTGAGTTCCACAAGTACCCAGTCCCTCACTTCATATAGAGTGCTTTATCCTAGG
CTTTAAAACCTGAAAATGTAATTAGACCTTTCATTCTCAGCTCCACACTGGCAAAGAACA
AGATTCTTCGAGTGTTTCTCAGCCTGTTTCTCACCTTGACCCTCTTCTGACTTTCTTTCC
ATCTGTGACTCCCCCCTTTTACGTGTTGACTCCCTCTTCTCTTGCTATGCTCACGCCCCC
ACCCCCATTTGCACAATTTTGACCTGTGGCCCTTGGAATGCCCTGGCCCCCAGCTGAGAA
ACAGTACTCTAAAGAACAAGTGGGTCAGAGCATCAAGGGCCTGGGTGATGGCTGATAACT
CTCCCTGGGTCTTCTAGGTTACCTGTTCTAGAAAACTCAGCTTCTGCAGGGGACACTTCC
CATCCTCACCACATGGTGTCTGTGGTGCCCAGTCGTTATCCTCGCTGGTTCACGCTTGGA
CACTTGGAATCACAGCAGTGTGAACTGGCCTCTACCATGCTGACTGCTGCCAAAGGTGAG
CATAGACCAACCTTAGACCCAGGCACCCTCACTCTGCTGCGTTGTCATGACCGATGGGAA
GTCAGGTCTGCAGGCTCCTGAAGGAAAGAAACCATCTTCCCTTGGGCAGTAGACTGATCG
AGAGCCTCACTTGGATTGTTACCATTAGGTTGAGCACAAGGGTTCAAGCCAAAGTTTTGC
CATAGTTAGTAAGTATAGGATGCTGAGTATATAGAACAAAATCATTTTAAAGTTAATTTA
TGAATGGGTCTAAGCCACCATTTCCAAAATCTCCAAAATGAGGATGACCTTTCAACCATG
GCAAAGACCTTTGGAGGAGTCAATGAAATGACTTACAAGATGGAGANNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNTAGTGCAGGGGTTAAGGCACTTGCCACGTATGTG
GCTGACTGAGGTTTACTCCCTGGGTACCCCCAGGCCCCAGCAAGAGTGATCCTGAACACA
AAGCCAGGAATAAGCCCTAAGTACCACCAGGCATGGCTCCAAAACCAAAAAATAAAAGAT
GGGGAGAAGTGAACTCTTGTGTGTACCCGGGGAAAGTAAGAAACTCCAGGGACTCAGGGG
AGGCTGTTGAAGGGTGTCTCGGAATAGGGGTGGCAGTCAGAGCCCGAGAGTCCACACCTG
GTGTTCTTAAGCTATCCAGTCCAAGAGATTAAAAGAAGACCCTGTTCCAGTTCATCCCCC
CGCCCTTACTTTGCTCTTACAGGGGACACCCTGAGGCTCCGAACAATCCTGGAAGCAATA
CAGAAGCACATCCATTCTTCCTCCCTCATCTTCAAACTGGCCCAAGATGCTTTCAAGATC
GCCACTCCCACGGACAGCAGTACTGACAGCACCCTGCTCAATGTCGCCCTGGAGCTGGGC
TTACAGGTATGAGGAGGACTAGGCCAGCCCTACTTGAGGCGTTAGCCCGGTAACAATTGA
TAGATGTCACATGGATTGGGCATGGGTCAAGTCTGTTTTTTTCCTGTGTCCCGTAACAAC
CACTTCTAGGCTAGGCATCAGGTAAGGACTCTATATATTGGACTGAAGGCCAGAAAAACA
TAGTTTTAAGCTCCGTGGTATCCATATTCCACCAAGGCAGTCTCCCCATTTCTCCAAGTC
AAGCATGGTGTGCGATAAGGACCATGTTCCAAGTAAGTCATCAAGGAAACCTTCTGATTG
ATGATGGGGTGGAGCAGAAATGAAGCAAACCCTTCTGTACTCGGGACGGGGAGAAATGAC
TGTGTAAAACACCATAACAATTTTTTGAATAAATGAAAGACAAAGAAGATAGGGAAGGGG
TAATCACCACAGTCACACTTAGCACCCTGGAACTGTGTCTGTTGTACCTAGGTGATGAGG
ATGACCTTGTCAACGCTTAACTGGAGGCGCCGGGAGATGGTGCGGTGGCTGGTAACATGT
GCTACAGAAGTAGGTGAGTCTCCCACCTTCCTCTGCCCCCTCCTTCCCAAAGGGGTTTCT
AGGTCTCACTCCTGGGACAGCACAGTGAATCCTTAGAGCTTTCAGTTTCCTATTACTGAT
GGCCTAGCAAAGGATGGGGCTGCTGGTGGAAGATGCCTCTCGCCAGCCAGCCCCGGCTCT
GCCCTCTCTTCTTGAACCCTGTCCTGATGTCTGCAGCACTTCGACCCTCTTACCACAGAG
ATGTCTGAAAGAACAAGTTTTCCATGTCCAGTACTGCAGCGTGTCCGGGGAGGTACTCGA
ACACCCAGTGGTTTGTTCCAGTCTGTGTCTGCCCTCGGCTCTAAGAAAAACCCCGTTCCA
GTGAAAACTCTGCCCTATGAGCCTCACCAGAGACTTTCAACCCTCTGANNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCAAAATGGTG
TTAGCATGAGGCTGATAAGGTAGCAATGATGAGATGTAACAAAAATGGGTGAAAGAGAAA
TTCTTTGTACCATATGGCGAAAATGTATGAGCAGTTAACTGGTCTAAATAATGCATTTAT
CCATGGTCAAAGAGACCGTGGCTACTTACACAATTGAAGAATCTGCTTATGTAGAAATCC
ATATTAATGACACACATTACCCTAGAACTACACCTTTAAAAAGGACATCTGTTATAGTGT
TATTTTGTCTTTAAAGAACCCCATTCCTGGCCATTAAATATCCAGTTCTAATTGTTGATG
ACAAGAACAGTAATGCTGAAGAAGCCTTTTGTCCAGGAACCTCAAGTGACCAGGTGTAAC
AAATATTTATTGCATGCGTATGTACAAATACTTAATATGATCTAAGGCTTTACAGATCAT
TTTTTTTAGAAATAGAATACCAAGTATTTAATCACACTGTGACTTTTTACTACTGTATTG
TTAAACTATATTACTAATTTTGATGTTTTACCACCTACTGTGAGTATTCATACATTCACT
ACACAAGTAGTAATGTGTTTGAGCTGGGAATGCTACCTGCAGGCCCACTGTGACTATCAC
ATATAACATATGCATAAAGTAACTTTCTCTAATTATTTTAAAGATATTGTTTAAAATATA
TATCTTTAAAGATATATTTTAAGTCTAGATAAAGTTAACACAAAAACTTGATCAAGTATA
TCCAAGGGTCATCTCACTAAAGATTTAAAACCCAAGAGTTTAAGATAAGGACTTGTGAAT
ATGTTTATCTATATTGGAACTCTACAGCCATTGATCATGGAACTCTGTATATCCATAAAG
AAACTTTGCAGTAAACCCTTTTTGGACTAATTGCCAAGATACTTTGATATATGGAGGGGA
GAGATTACATGCAAAGCTGTGTGCGTCTGCTACCACTGTGGCCTTTATNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCCATA
AGCATAAATGTAAAAATATTGGGAGTAAAATATTAATCAAATTTAATCAAAAGTATAAAA
AGGATTATACATGACAACCAAAGGTATTTATTTCAGGTATCCAAAGCTAGTCCAGCACTT
TAAAATAGTATAATCCAGTTTGAGCATTGTATAACTGAGACTTAAACCTGAAAGCTTTGT
AACTTTCCACATGGTGAATCAATAAAAGAATTAAAAAAAAATAAAATAGTATAATCCACC
ATATCTGCAGACTAAAGAAAAAAAGATCATTTCATACATCAGTAGATGAAAGAAAAAAAA
CTTTGACAAACTCATGCCTTTTCATTATTAAAATATATATATATATTTTATATATAACTA
TATATATATAACTATATATATATAAATGTATATATATATATATATATATAACTAGGGATA
GGAGAGGAATACCTCAACTTTCTAAAGAACATCTTCAATGAAGATACAGCTACCATTATA
CTTAATGGAGAGAAAATATATGGTTTCCTCTGAAGATTAGGAATAAGACAAGAATATCCT
CTCTCACTACTACTTTCAACAACATCTTACTATAAGTCCTCTCTAATGCAATAGAACAAG
AAATAAATTGAAAAGTATACAAATTTTAAGGAAGAAATAAAACTTTACAAATTTCTACAT
AATTTACAAATTATGTAGAAATTCCAAAAGAATCAACAAAAACAGGAACCAATAAGTGAT
TTATCAAGATTGCAGGACACAGAAGTCAAATTGCATTTCTTTATATCAGCCAGCCGTGAA
CAATTGAAATAACACAATACCATTTATATTAGCGTGCACTCACAAACCTTATTTATAAAT
CTACCAAATATTTGGTAGAGTTACTGTCTGTCACTGTCATCCTGTTGTTCATCAATTTGC
TCAAGCGGGCACCAGTAATGTCTCCATTGTGAGACTTGTTGGTACTGGTTTTGGTATATA
GAATACACCACTGATAGTTTGCCAGGCTCTGCTGTGCGAGTGGGATACTCTCGGTAGCTT
GCCAGGCTTTCCTGGGTCCACTCAGATCCAGAAGCCCAAAGGCCATTGTACCTGGGGCTG
AGCACAGAACAGATCTGGTGCTCTCGGCGAGCCTTACTCCAGCACTACGTTTCCTTTTCT
CCTTCCTAGTATCACTGTTGAGGCTGAAGAATTATTTTTGGGGGAGAAAAAATATGTATA
GCAATCAAAATTGCAAGCCGGGGTCAAACATTCAACCACGAGCAAGGCAAACTTCCTACT
TGCTGTGTTTCCCGAGGCCTGAGGGAGGGAGGGGGGTGTTAGCCACACACATGAGTGCTA
GGTCTCTAACCTGTTTGAAGGTCATTCCTAGTAGTTTTGGGGGTACCACGCAGTACCAGG
GATTAAACCAATGCCCTTCACTTGCATAGCATGTCCTTAGCCTGTTTTTATTTTAATTAA
AAACATCCATGATTTACAAAGTTGTTCATTATACATTTGTTTCGAGCATTTAGTGTTCCA
ACACCACCTGTGTTACCTTCCCTCTACCAATATCCTCAGTTTCCCTCCCAATCCCAACCT
GCCCCCTCAGGCACATAGCAAATTTACTTTAGTTTGCTTATTCCAACAAAACTTTAGATA
TAGCTAAGAGGGGCCGGAGCAGTAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCAGCCATGCACGGGTGTTCAGA
GAAATTTTGGGGTTTTATTGATCTCTTTTGAGATTTATTTATGAGTCTCTGGAGCAAGGC
AGGTATGAGTTTGCATGGTGGCACCAGAGATGGTTCCATCCTTAGCCTGTTGAGCTCTCT
CCAGCCTAAACTGTGAACAGTAGCGTCTCAACATTTCTTCATCAAAAGTACCTCATTAGT
TTAAGATCTTAATAATGGGGGAAACTCGAATGGGGAGAGGAGGGAGTATGGTCGAATTGT
CTGTACTCTTAGGTTTCTGTAAACCAAAAGCTGCTTGAAAAACATAAAAGGGGCATTGAA
GTGATAGTACAGCAGGTAGGGCACTTGCCTGGAATGCAGCCAATCCAGATTCAATCTCAG
GTACCCATTGTGGCCCCCCGAGCCCAAATAGGAGTGATCTCTGAGCACAGAGCCAGGTGT
AAGCCCTGACACCTCCATAGATAGATGGGCTGGGGGCATAGCTCAAAGGTGTCAGACATA
CCTTTATATATGAATCCCAGAGTTTGATTCCCAGCACCCCATGCACTGGTAGGTTGTTGC
TCTGGTGTGTAGGAGTGGTAGCTGAGTACTGCTATTAAAAACAGATAAACACATCACTGT
CTCTGTCATCCCATTGCTCATCGATTTGTTCGAGCAGGCACCAGTAACGTCTCCATCGTG
AAACTTGTTACTGTTTTTGGCATATCGAATACACCACAGGTAGCTTGCCAGGCTCTGCCA
TGCGGGCAAGATACTCTCCGTAGCTTGCCGGGCTCTCTGAGAGGGGTGGAGGAATTGAAC
CCGGGTTGGCTGCATGCAAGGTGAATGCCCTACCCGCTGCGCTATTGCTCCAGTCCAGAT
AAACACATAGCAAGTACTAATTTTTTTTCAGTGTTTTTTAACATTATAGAAGAAAAAACA
TTCTCTCCCATAAACTGGTCACTGAAAGGTAACTACTAGTACTAAGGCATTGGTATAAAT
ATTCCTAGATATTTTCTGTTTTTTATATACTATTTACACATACATTATCTACATAATGTT
ATTTAATCATGTTTTATAAAAGTAAAATTCTGAGAGTATTAACTGTACACAAACTGTTCA
TAGTTTCACAAAATGTTACCATTTCCATTTTACTAATGAAATAATTGCACTGGAAAGTGG
ATGAACTAGGTTCAATCCTCAGTGTATTTTCCTCCAGTTTACTTCTATTATTGTATCTCT
TTGTAAAGCATAAGACACACTTCATTTTCTCTGTATCTTTTACTTTTTACCTTCATAATA
TGTACCAATCTTTTATACACCATTCTACCTTTTCTACTATTCTACACTGATCCTTCACTT
CATATGGTATAATGCCCTACTGGGGTATTCTTAACTCTATATGCTGGTACTTTGTATAAA
ATTATCCTTTCTTACTGTAAATATTTAGTGGTCTCCTAGCTTCTTTTTGCTCTGGGGAGC
TATCGTGAGTGGGGAAAATGACACCAACATGCTTTTTATTTTGAAAGCAACAATGTGTTT
TTTCTGCCTACTTGTACAGGTAGCTCTCAAAATTCAGTCATTCAAGAAAATTATTTCTGT
GAACAAAGGAGTCTGAGGGAAAAGAGAGTAAGGGGCAAATTAAAAGATGAAAGAGGGGCC
AGAGAGATAGGACAGTGCTGGAGAGATAGTGCAGGGGTTAAGGCACTTGCCACGTATGTG
GCTGACTGAGGTATACTCACTGGGTACCACCAGGCCCCAGCAAGAGTGATCCTGATCACA
AAGCCAGGAATAAGCCCTAAGTACCACCAGGCATGGCTCCAAACCAAAAATACAAGATGG
GGAGAGTGCACTCTCGTGTGTACCCGGGGAAAGTAAGAAACTNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNCGCCAGCCAGCCCCGGCTCTGCCCTCTCTTCTTGAACCCTGTCCTGATGTCTGCAG
CACTTCGACCCTCTTACCACAGAGATGTCTGAAAGAACAAGTTTTCCATGTCCAGTACTG
CAGCGTGCCCCGGGGAGGTAGCTGACCCAGTGGTTTGGTCCCAGTCTGTGTCTGCCCCTG
CCTCTGAGAAACCCCCGTTCCAGCACAAGACTCTGCCCTATGAGCCTCAGCAGAGACCTT
CGACCCTCTGATCTGGGGGAGGTCGGGAAGGGGGAGAACCCAAACAGGGTCTGCCACCTG
GGGTGCTCCCCTTGCCCCTGGTTTGCCTCAGATCATCTCAAGGCGGCTGAGGAGGGAGAA
CTCGTCTCCGCAGGCCCAGTTCTGAGCCCCGGTGGTAACATGGGCAGACCCGGATCAGAT
GGCCGCAGCTGAGCTCGGGCTCTCCCTGACAGGTGTTCGGGCCCTGGTGAGCATCCTGCA
AAGCTGGTACACACTCTTCACCCCCACCGAGGCCACGAGCATTGTGGCGGCCACCGCCGT
GTCCCACACCACCATCCTGCGCCTCAGCCTTGACTACCCGCAGCGGGAGGAGCTGGCCAG
CTGTGCCCGCACCCTGGCCTTGCAGTGCGCTATGAAGGATCCCCAGAGCTGTGCGCTGTC
GGCCCTCACTCTCTGTGAGAAAGACCACATCGCCTTCGAGGCAGCCTACCAGATAGCCAT
TGACGCTGCTGCCGGCGGCATGACGCATTCGCAGCTCTTCACCATCGCCCGCTATATGGA
GCTCCGTGGCTACCCGCTACGTGCCTTCAAGCTGGCCTCGCTGGCCATGAGCCACCTCAA
CCTGGCCTACAACCAGGACACCCACCCGGCCATCAACGACGTGCTCTGGGCCTGTGCCCT
GAGCCACTCTCTGGGCAAGAACGAGCTGGCGGCTCTCATCCCCCTGGTGGTGAAGAGCGT
GCACTGCGCCACCGTGCTCTCAGACATCCTTCGGCGCTGCACCGTGACCGCGCCCGGCCT
GGCGGGCATCCCCGGCCGCCGCAGCTCCGGGAAGCTCATGTCCACCGACAAAGCCCCGCT
GCGCCAGCTGCTGGACGCCACCATCAACGCCTACATCAACACCACACACTCACGCCTGAC
CCACATCAGCCCTCGCCACTACGGAGAGTTCATTGAGTTTCTGAGCAAGGCTCGGGAGAC
CTTCCTGCTCCCCCAGGACGGCCACCTGCAGTTCGCCCAGTTCATCGACAACCTCAAGCA
AATCTACAAGGGCAAGAAGAAGTTGATGCTGCTGGTGCGGGAGCGCTTTGGCTGAGCACG
CCGACGGCCACTGCCGGGCCCGCCTGGGCGCCCAGATCCCACCCAGTCAGGCCAAGGACA
CAGAAACATCTGTCCCCCTGAGAGGATTCTGAGCACTTGTGGCTGAAGCCAGAGGGCCCC
AGGTCTAGGCACAGGAGAGTCCAGTATGCCAATCCGCCTGCCTTGGCAAGGCCCCGACGG
CCGCCGGCTGTTCCCAGAGGAGCTGGGCCCTGCAGAGAGACAGAAACCCCACAACATGCC
ACCTCGCGCCCCTCTAGCTTGCGTGCCCTGGGCAGCGGCCCTTCTCCCCTGGCAAACACA
GAACACTGTTCCTCCTCAGGGATTGCTTAACCAGAGAAACAGGACATTTACAGTCTTGTA
ATATACTAGAGTATATGTGTTGCCAATTACATTGCAAAGTTGTAACTATTTATAATTCCG
GTTTTAATTTGATGGGTACTTGAAGTAGCTGTGGGTGGAAAGATAGGCTTGTTTTCTGAG
GAGACTCAATCATTTCTCAGGTTTCCCTTGCAGAGTATAATGCAGTTGGCAGTGGAAGAA
TGGGGTTGCAGGGAGAAAAAAAAAATGGCTGGTTAGAATAAACCGCCAAGTCTAGTCTGT
GCCAAAACCCCGCCTGCATGACCAGGAATCGCTAGCCCAGTGGCAGGTGGAGGCCCTTGG
GCTGAACCCAGCACTGGACTTAGACTTTTGCCTCACGAAGCCATGAGGACCCTGAAGTTC
TTGCCTCTGCCTCACATAGCCTCACCGGGAGCCTGCAGGGCTTCCAAGAAACTAGTGCAG
GAAAAGGGTAAAGGTGAGGGAGGCCACAGAGCTCATAATATTCATATACTCTGGTCACCT
TTGTGTTGAGTATCTGGTTTTCTGTTTCAGTGTGTGTGTGGTGTGTGTGTGTGTCTGTGT
GTAAGAACATCTGTGTGCATAAATATCTCTGCGTGGCTGTATGCACATGTGTGCATATTT
GTCAGGTCAGTGTCTCTGTGACTCTGGCTCTGCCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1012, 1014..1070, 1073..1080, 1082..1134, 17422..17778, 22418..22566, 24146..24296, 34237..34416, 45415..45591, 45692..45838, 46242..46379, 49560..49820, 50021..50156, 52337..52494, 53302..53465, 53931..54012, 65732..66594
1001..1012, 1014..1070, 1073..1080, 1082..1134, 17422..17778, 22418..22566, 24146..24296, 34237..34416, 45415..45591, 45692..45838, 46242..46379, 49560..49820, 50021..50156, 52337..52494, 53302..53465, 53931..54012, 65732..66591
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved