Sorex_araneus Locus ENSSARG00000009424
snOPY snoRNA Orthological Gene Database
Sorex_araneus ENSSARG00000009424
Sorex_araneus
ENSSARG00000009424
GeneScaffold_329
SNORA66
15538..15665
18902
GAGTAAGGAGAGGCCGCTAAAATCTCAGGGCTGAGTTTAATAGAGAAGTTACTGGTGCC
CGCTGGAGCAAATCCACTAACAGGATGACAGTGATACGGTGATACCGTGAAGCTTCGAAA
TTCGGACAGTAAACTAACATACACCTCACTAAGCAAACACGTCAACATATCTACTCAAAA
CGGAATGATGCCATTCCAAACCGTGGGACAGTTAAGGCACTTCTGTAAACGGAGTTGAAA
CCATCCAAGCTCTTCCCACGAGTGCTTGCCCGCACGTAAGGCAATGACGTCCTGCAGGGC
CCTGCTGACCGCTAAACAGAGACACTCTGCACTGTGCCCAATGCATCAAAAGACCTCGGT
GATTTCGGAAATTAAGTCTGGGAAACAGGACTCGGTCTGACGGCGTCCTTTTCTACTTTC
TACGTTAAGTCTGCAGTCTTCTGCATCCTTTCCGGGCCAGCACTTTCCAAGTTTCACGCT
CCAGAGAAGGCACAAAGACGAAGCCCAAAAGCAGAGCTAAGTTCTTAAGAGGGAGGACGC
GGCGGGACTGGGCACCGAGGGCTGGCTGGTCGGTACCTGCATGCAAATAAGGTAGGCGAC
TGTTCCGCAAAGAGCGGGGACCTGGGCGCGCGGGGGCTGCGCGGTGCAGGCCGTACCTCA
AGTCTGCAGAGACGTCCCCGAGCCTCGAGCACCTGTCACCGCGAACGTCGGGCGTGCAGC
CCGTGAGCTCGCTGGGCCGCTTCCGGAGCGGCGCAGCAAGCTACTTCCGGCGGTCCGCCA
GTCAAATGTTGCCTGCCAGTAACTTCCGCTCCTGAAATTGAACCCGGCGAAAGGGGGCCC
GGAACCAATGCATTCAGCTCCTCTTGCACCCGGCCCGTGAAGAGGCCTCCCTTTCCTGCC
GGCCGCGGCGTGCGAGTTGCTGGCGGGTCTTCTGCGACCCGTCAAGTCTCGAGCTTCTTG
ACGTCGGGGCGGCTGCGTCACGCAGCCCTGACACCGCCACCATGGTGAGGAGTTTGTCTT
GGGCACCGGTCCCTGGAGCGTGTAGCGTTTGGAGGGGTCTGGGGGTGCTGGAGAAGGAGT
AGGCGGAAGTTGGAGGGAATGAGGCTGGTGGCTCCCTCCCCCCCCATCAGGTTCTGTTGT
GGAGTGAGTGGAACTTGGCTTTGCAGCACAGTGAGGGCTTCCCAAAGCACAGGGGTTTAC
AAGGCAGATTTTTAAGCCCAGGCGGTCATTATTCCCGTTACTACCTCTTTAATGATGGAG
AAACCAAAGGCACGCTTTGGCACCTGTCCGAAGGCTCCTGAATTGCAGAGCCGGCTGGTA
CCCTGCATCCGGTAGATGCTTGTGCTCATCGTCATCGACCGGCTGGGGGATAAACGGTGT
ATCTGTGGTAGGTTATCACAGTAAAACGATGGTGGATTATCCAGTAGAACTTATTCAGGG
AGGAAGATCTAAGTACTGATCCACGCAACAGCAGAATCGCAAGAGCCTTCTGCTCAGCGT
AGCCTTAGGCGGCACACTCTACATTGCGTTTACCTTTCATTCCGAGAAAAGGGGAAACTG
CAGAGAGTGTCAAATTAGAGATGAGGCAAGAGTTGACTTCAGATTGACAAAGGAGAGCTT
TCTGGGGTAACGAAAATAATCCCTCATAATTTCAGTAGTTATAGAACTGAAACATTTGCC
AAAACTTAGATCTGCCTATCTACATAACACTATTGATAATAACACGTGACTTAATGATAA
GAATACACCCTAAGATATGTTTTATTACTCGTTCGTGCCTTGCAGATAGAGAATGGAGCT
ATCTGCACATGACAGAGAATGATATAGACAAAATCTTGGTGGTGTAGACCTACATCTGGC
ATTCTGGAATCATGTGTCACCAGGATATTCCAGGCAAGGGCACAGGTGGAAATTGAATAA
ATGATGGCCAACATGAGACTAGGAGGCCAACTGGTAGGACAGGAGGACCACAGGAAGGAA
ACAAGGTTGGAAGGACACCCACAGTTGGGAAAAGGTTGAGACATGGGTATAGACTATCCC
ATGCCTACAATGTATGATGTAACCCAGCATTTTCAACCTTTCGCCCCTGCAGGCCAGNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACC
TACTCAGATGGTTCTGATATTCAGGAAAAAAGATTATTTGGTAATCATATCGTACCTTTG
TGGTCAAATGGATTGGATTACAGTTCCTTTGAATGAACAATTTTCATTGAGGTTACTACA
AATATAAACCCTAGTTCCCTATATGGTCCATAATTAAAATTTAATGTAGACCATGTGACT
AGATTTTTTTCATAGTGCAAACAGTATTTAAGCAAGGGAACATTTGGATGATGCAGGGTT
TTCTGTAAGTACTACTCGAAAAATATTTTAGAATAACTTACTAATTTCTTTTAACAATCA
TAAAATTTCTCGTATCATTATAGCCACAAAATGAATATATTGAGTTACACCGTAAGCGCT
ATGGGTATCGTTTGGATTACCATGAGAAGAAGAGAAAGAAAGAAGGTCGAGAGGCCCATG
AACGTTCCAGGAAAGCAAAAAAGATGATTGGTTTGAAGGCTAAGCTCTACCATAAACAGC
GCCATGCTGAGAAAATACAAATGAAAAAGACGTAAGTGATCCTGTCTATTTCTTATAATG
AATTAACATTTTAAAATAGTTGTTACTAAGTCATCTTGATATTTTCTCCCTTTTTGGTAG
TATTAAGATGCATGAAAAGAGAAACACCAAGCAAAAGAATGATGAAAAGACTCCACAAGG
AGCAATGCCTGAGTATTTGCTGGACAGAGAGAGACAATCCCGAGCTAAAGTACTTTCCAA
TATGATTAAACAGAAACGAAAAGAGAAAGCAGTAAGTAATAAAACTGAAGTCATTATTCC
CCTTTTAGAAAAATTACATTTAGATTTTGATGTCTTTATATTTTCTTTTGTTGAAGCCAA
CTGTTACTGTTATATCCATTACTTAGATGTCTTTGTAAGTTTCATTTAACATAAGATAAA
TTAAAAATTTGCTGTTTCATCACCAGCATATTTTATCAGAATATTTTAAGAAAACCAAAA
ATAACAAATGAATCTCAAATTCAATTATTTTAACAGCTCCCAATATTTGATAACTTCCAG
GGCTGTGCTTCATAGTATAGATTATGTAACGAAGATACAACAGGTTTTTTGCTGCCCTGC
AGTGCCAAAACGTGGCTAAAAATTGAATATTGAAAAACATTCTAAGTGTCTTAACTTAAA
CGAACATAACCCTCAGCACTTGGTGTCAAACTAGGCTATATTCGAATGTAGATCTATTCT
CTCAAAACAGAAATACATGGGCACTGCTAAAAAAAAAAACCCACAAAACCCACACACTGA
CAAATCTAAATAGCATAATGTGTGGTCATATTTAAAGAACTTGTAGTTTCCAGATGTTTT
TTAAAACCATATAGTTTCCCCTGTTTCCTAGGAGTATGGAGTGATAACTACTCAATCAGA
ATGGTAAGACTATAGCACTGAAATAAATTTTAGGGATTGCTTGCTTAGCCACTCATTGTA
CTGATGAAGAGTTGAATCCATGAGATGTCAAGTCATAGTTCATGGTTAGTTACATACCTG
TGAAATTCTGGAGTTGTTTCTAGAACCTGAGTCTTAGGGATAACTCCAGAAATCTTTCTG
CCGCCTTGCACTGCTAGTATTTTTTACATTATAGAAAGATACTGAATGTCTTTTTTATAT
ATATATAATTGTTATTATTTGAAAATCTATTCAGAATGGCAGAACAAATCTTTATTAAGG
AACCAGAGAGATAGTACAGAGGTTAAGACATTAGCCTCATACATTGCTAACCTCTGTTCC
ATTGCTGGCACCATATACCATCCACCCTCAGCATTGCCAGGGGGGAGCCTGAGCACTGCT
GCATGTGGTTGCCCCACCCCCTCCTCCCAGTCCCAGCCGCCCCCCCCAAAAAAAAAAACC
CACACACAGAACAACAAACTATGGAGAGACACTTCGAGTTTTAACTATTAATTCTTTAGT
AGTGGAGAGGTAATACAGCAGATAACGGGTTTGCCTTGTACGCAGCCGGCCCGGGTTCAG
TCATTGGCATCCCATCGTCCCCTGAGCACTGCCAAGAATAATTCCCTGAGTGTTGAGCCA
GGAATAACCCCTGAGCATCGCTGGGTGTGACCCAAAAAGCAAAAAATAAATAAAAAAATT
CTTTAGTAGTAAGCACATACATAGCTTAGGGGAAAAGGTGCTACCTTATTATAATAGTCT
TTGCCCATAACAAGATAATATGACTTTCAGCTTATATAAAGTTTCTCCAGGTACAATGTG
AACTTAATTAGTTGCAAGTACTTTTGGGCTTATGAGGAGTTGGGTTCTAGAAAACAGCTG
GGCAAAAAACTTGAGTAGTTAAGTGAGTCTACTACTTTATACAAATTAAATGTATTGACA
TTATTCTCAGATCATTCACTTACAATATCCATTTTAACTGCCGTCTTTTTTAGGGAAAAT
GGGAAGTTCCTCTGCCCAAAGTTCGTGCCCAGGGAGAAACAGAAGTATTAAAAGTTATTC
GAACAGGAAAGAGAAAGAAGAAAGCATGGAAGAGGATGGTTACTAAAGTCTGCTTTGTTG
GAGATGGCTTTACACGAAAACCACCTAAATATGAAAGATTCATTAGACCAATGGTAAATC
TCTTGTGTAGTAGCACAAGTGTCAGCTCCAAGTTGTGAGACTTAGTAGTTATAATTTCCT
AGTTGCAAAGATACCACAAAAACAGGTTGAAGACATTTTTTAGGTTATTTTTGTTACTTT
AAATTAAGCGTAAGGATTGCTTACCAGTTTTCTACTACCATCAAGTATCTTTCGACTTAA
AAGAGTCTGAAGTGGCAAAGAATTTGCTGACATACATTGTTAATCTTGACTTGTAAACAT
GACACTGGACTTAATTTTCCAATTATTTTAATTATTCAGCAAGTAATCCATTACATGTCT
GACATCTGTTACCTTTAAGAACCATCAGAAAATTTGGGCAGGAGCAATTTTATTAGTCAG
TTCCAACAAGGCCAGAGAAATAGCTGAGTGCATGCTGGAGGCACAGGGTTTGAGTCCCTG
GCACCGTGGTTTCCTGAGCATGACCAGGAGCAACCCCCATCACATAGCTGGGAGTACCCC
AGGTATGGCTGAAAAAAGCTAAAAAAAAACCCTAATTTCTAGCTCAGTGAAGTTAGTAGT
ATCATAATTCCTTACAAATACTATATGCAGTCATCAAAGATAAAATACGGNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCAAAAATTTTGGTAATTTAGCTTTCATG
TGGTTTAAAATATTTATAAATTTCCCTGAAACTTCCTTTTGGCCGGTGCATGCTCCTTAG
GAAGGATGTTGCTTACTTGCCTAGTATTTTGTCATTTATAGAAAGTTTTCTTTCTTTTTT
ATTCTTTTTTATTCTTTTTTTGCTTTTTGGGTCACACCCAACGATGCACAGGGGTCACTC
CTGGCTCTGCACTCAGGAATCATCCCTGGCGGTGTTCAGGGAACCATATGGGATGCTGCA
AATCAAACCCGGGTCGGCCACGTGCAAGGCAAACATCCTCCCCGCTGTGCTATCGCTCCA
GCCCCTAGAAAGTTTTCTGATGCTGATTTCTGTATTACTGTATACCTTTTAAGTGTATAG
AGGTTTGGTTCCATTTTGATGGATTGCCAGCATGCACTTGCAGAGAATGTATATTCTGCT
GTCGAGGGGTTCATTCTACAGATGTTCATTAGGTCAAAATTGTTAATGGCGTTGTTTAAG
TCTTGGATACCTCTTGATTTTTCTATTAACTTGTTCCCTCAATTACGGAGAGAGAAGTGT
GGTAGTTCCTGCTATATTCAGAGTGGTCGAGGTCTCCCTTTAGTTCTGTCAAGATTTGCT
TAGGTGCTTTGAAAATCCCTTATCAGATTACTTCCATATTTAAAGTTCTACTGTCTTCTT
TGGTCTGGAGCGATAGCACAGCGGGTATGGCGTTTGCCTTGCACGCAGCCCACCCGGGTT
TGATTCCTCCGCCCCTCTCAGAGAGCCCAGCACGCTACTGAGAGTATCTCGCCTGCATGG
CAGAGCCTGGCAAGCCCCCTGTGGCATATTTGATATGCCAAAAACAGTAACAACTAGTCT
CACAATGGAGACGTTACTGGTGCTCGCTCAAGCAAATTGATGAGCAATGGGGTGACAGTG
ACAGTGCCTGTCTTCTTTATTAATGAATCACTTTATCGTGGTAATATTTATTGGTAATTA
TTTATCATGGTAATACCTCTTTATCACTGGTAATATTTCTTGATCGGAAATCTGTTAAAG
GGGCCACCCTGCCATTCTTGTGATTAGTGTCTGCTCTGTTTATCTTTCCCAGGCTCTTAG
TCTATTTATACACCTGCATTTAAACTGCATTTCTTATGTATATCCTACAATTTCACTTTG
CTTCCCGCCCCTCCCCCAGTTTTCACTGCCTGTCATATGACTGTGGTATTTTAGACTCTT
TACATCAGTATTCTTATCAGAAGTTGGATTTAAGTCTATCCTGTTATTACACACACTGTT
GACTTTTTCCACCCAATATTGTATCGAGTTCCCCATACAATGGTACCGCTCAATGACTCT
GAGGTGGAAACTGTACTATTATTTAGAACTATTGGAAGTAACAAGCACATTATCTTCATG
GAAAATTTATAGGAGGGGAAAAGAGATTTAAAAAAAATGTCCTTGGGGGCTGGAGCAATA
GCACAGCGGGTAGGGCGTTTGCCTTGCACGCGGCTGACCTAGGTTCAAATCCCAGCATCC
CATATGGTTCCCTGAGCACCGCCAGGGGTATATCCTGAGTGCAAAGCCAGGAGTAACCCC
TGTGCATCGCAAGGCATGACCCAAAAAGCAAAAAAAAAAAAAAAGTCCTTGCTCAATCAC
TTTTGGAAATAAACATTCCATCCTCTTTTCCAAATGGAGAACATTTACTACACACTCCTT
GATTCCACGCTGCCTCCCCCCCAGATACTACCCAAAACCCCAAATGAGAAAATAAACGCA
TGAACAGGACATCCCGGTTCCTGGGCCTGTTTTTAATCTTGCTGTATACACGCTTACGCT
CCTCTCTGCTTTTGTCTCGCGGCTGCTCCCTCGGTGCACATAGTGTTCTGTTTTCCTTTC
CGGCAACCGCCGCCGACGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNACATCCGGTGTCACCCTCCCTCTTCAAAATTTCTCGCAGTTGGTCGCGGGAATT
CTCCACCGGCTCTCCAGAAGGGTGACTGGTTTCTCAGTTTCGCCTTCTCTGTGTACAGAT
ATGGCGACACTCGGGACAGCATCTAGCACTCGGGACCAGCAACTAGAAACCCCATGAATG
CATTTTTCTGTTTGTTTGTGTTTGGGGACTAGACTGGTGGTGCTCGATGCTTACTTCTGA
CTCTGTGCTCAGGGTCACTCCTGGTGGGACTAGGGAACCCGTGCAGTACCTGTGATCAAA
CTGGGCTTATCTACACAGAAGGCAAATGCTTCTTCCCTGTTCCATCTCTCCAGGCCCTGT
TGAATTTTAAGATGTAGGTTGATCGTTCCATCTCTGCTCTGTTGGTGTGGTAGAGCAAAT
ACCGTAGCGATAGTCTTCAAGCTGAAAGTATTGTGTGGGGGCTGGAGCAATAGCACAGCG
GGTAGGGTATTTGCCTTGCACGCGGCCGACCCGGGTTGGATTCCCAGCATCCCATATGGT
CCCCCGAGCACTGCCAGGAGTTATTCCTGAGTGCATGAGCCAGGAGTAACCCCTGTGCAT
CACCGGGTGTGACCCAAAAAGCAAAAAAAAAAAAAAGTATTGTGAGAGTTAAGAGGCACT
ACTAGCATTTACCCTCAGAGCCTCAGTGAGGGCTGCATAGACACCCTGGGGATGTGTGGG
CACAATGGAGGAGAAAACTGGGAACACGGTGGGCTGTCATAGATCTTGGAGACATGCGGG
GGGGTCTCTGCTCCTCATTTCTTCCTGCATGCAGTGTAATGTTTGGCTTGTTGGCCATGC
AGGTCTGCGAACCATCGGAGTCATCACCAAGTTGGATCTGATGGATGAAGGGACCGACGC
CAGGGATGTCCTGGAGAATAAGCTGCTGCCTCTGCGCAGGGGTAACGTGCCAGAACCCCA
CGTGGACCGCACTCTGGGGACAGACTGGGGGGCAATGACGAGGAGATGGCAACTTGGTGG
GGTGGCTTCTGAGGGGCCCAGGAGGCGTTCAGACTGGGCGTTCTGTGGAGCGTCCCTTTT
CATGGAAGGGAGGGGTAACTGTTCTTCTGAGTGGGCCTGCTAGGACACACAATTGCTGAG
GGACAGCCACCTGAAAATGACAACGCAAGTGGCATTTGTCTGCTGATGTCAAAGCCGCCT
CGGCCTGCGGTCTTGGTTGCACACCAGGACCTCAGAGTGCTGCTCCTCAGGCCCTCAGCG
GGAGCTTCTCTCGGCCAGCCTGCCTTGAGGTGTTTCCCGCTCCCGCCTCGTCAGCCACAC
AGCTTGTCGCCCCCCACTTCACTGGCTTGTGTCCTGTTGCAGGCTACATTGGCGTGGTGA
ACAGGAGCCAGAAGGACATAGACGGGAAGAAGGACATCAAGGCAGCCATGATGGCTGAGA
GGAAGTTCTTTCTCTCGCACCCGGCCTACAGGCACATCGCTGACCGCATGGGCACCCCAC
ACCTGCAGAAGGTCCTCAATCAGGTGAGAAGGTGCCTCTCCGGGGACAGGGGCAGTGCCA
AAGTGGGTGGTTCCAGAGGTCGGGATGTACAGATCTCAAGGGCAGAGAGCCAGGAGGCTC
CGGAGAAGCAGCTGAGGGGAGGAGTGTGCCACCATCAGGGTTAAACGCTCAGGACGGGCT
TCTGTCAGGCCTGTGAGCCCTTCGGTGTCTCCTATGGTGCGACCGTGATTCTTTCATTGG
CAGCAACTCACTAACCATATCCGAGATACTCTGCCAAACTTCCGGAACAAGCTGCAGGGG
CAGCTGCTGTCCATCGAGCACGAGGTGGAGGCCTTCAGGAACTTCAAGCCGGAGGACCCC
ACCCGGAAGACCAAAGCATTGCTGCAGTGAGTTCTCTCTCCAGCAGGGTCCACCGAGATT
GTCCCCTCCCCCCCCCCCGCCCCTATGTGGCCTGTCTCTCAGCTCTGCTGCCACAGGCAG
CCAGTGAAGTGACTGAGGGTCTGGAGGGGACCCGGGAACCCATGTTTTCTCACAGAATAG
CTCTTGCTCTTTCCCTCCTACTGGAAGTTGAGCTGGTGGCCCATATCTTGCTTTTTTAAG
TCTGGGAGTAGACCAGTAATGGTCACTCAGTTGTGGGTTTTGTTTTTTGTGTTTTTTTTT
TTTTTTTGCTTTTTTGGTCACACCCAGCGATACTCAGAGGTTACTTCAGGATCCTATGGG
ATCCTGGGGATCGAACCCAGGTCAGCTGTGTGTAAGACAAATGCCCTCTTTGCTGTACTA
TTGCTCCAGCCCCTCAAGTGTGGGTTTTATTATTGGTCCTAGGGTCTGCACACAAAGACA
CAGCTCTGGGGAATGTCCTCAGTATTGTACAAAAGATGATACCTAGAAGCTTCTCTCCAT
GTTATTGTACTTAGGATCTTGTAATTTCAAGCTGTGATGTGGGTGCCACTCCTCAGCCTT
GGGGGCCACCAGGCTCTGACCCAGAACTCAGGTAGCTGGGTGGCACTGGGCTGTGAACTC
AGTCCTGGCATTGGCACCTCTGACCCTTGATCTTCCTTTTTGCTCATGCTGTTAATGTGG
GACTTTCTTTTCTTTTTTTAACTTTTAATAGATTTTGTTTGTTTGTTTTTTGGGTCACAC
ACAGCGATGCTCAGGAGTTCTTCACTTCTTCACTCAGGAATTACTCCTGGCGGTGCTTGG
GAGATCATATGGGATGCCAGGGATCGAACCTGGGTTGGCCGCATGCAAGGCAAATGCCCT
AATGTGTGGGACTTTCAGTGGTACCCTTCTCCACCCACCACCCCCACATTGCTAACAGAA
AGATTCTTTATTTATGTTATTTATTTATTTATTTATTTATCTTTTTGGGTCACACCCGGT
GATGCACAGGGGTTACTCCTGGCTCTGCACTCAGGAATTACTCGTGGCGGTGCTCAGGGG
ACTATCTGGGATGCAGGGAATTGAACCTGGGTCAGCCGCGTGCAAGGCAAACGCCCTCCC
TAATGTGCTATTGCTCCAGCCCCTATTTACATGTCNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNGATAGAGCCCCGTGTCAGGATTGCATTCAGAGTGATCTATACTGACGACTCTG
ATTTTATTTATGGACTGTGTCATTTAAATGACTCTAAAGCACTCACTGAGTCCCAGATGT
GCTTTGGTGTCTAATGAGAAATATTTCCCCATCACATCTTCGGGCTCAGGGCAGATGAGG
AGGAGAGGCCAAGCGTGCAGCTCAAGGCAGTGTCCTTCCGTGTTTCTGGGGACAGCGGGG
ATACATCTGACCATGGGAACCAGGCCTAGCTAAGGCTTTAGGAGTGGTTGAACTGAGTTG
GCTGACAATCTTAGTAGAATCTTCTGGAGCTGGACTGCCAAAAGGGGAGTGAGGCAGTAG
GACCAGAGCTAGGGCAGATCCAGATGCACTATTGATGGGGTCTGAGGCTTGCAAAATGGA
GAGAATGGGAAAGAGGAAAGAACTGAGGCCAAGGAGAAGTCCTTACAAATAAACCTAACT
TTGTATCTGGTGAAGAGGAGAGGAATAGTCCCATGGGTGACTCTGGAAGGAGGGGCAGCA
GGACCTGTGGGATACGGGGGGCACAAGAAAGATTCCAGTCCTCTTCCAAGGTTGTGGTTT
GCCTCGAGTGAGCAGGTGTGAGCAGCTCTCTCATCAGGGAAACTGAGGAAGAGCCAGGCG
TGCATGCATGCACCAGTTACGAGAGGAGTGCCCAGGATGGAAACTTCCGGTGTGACGCGT
CCTGTGGGTGACTTCTAGAATGGGTGCCTGGGCCAGGCAGAGGAGGCGGATGGGTAAATA
GAGAGCTTCATTAGCATGTGCTAAGGAAAGTGATAAACTCTGGCTCTTGGCGCTATGGAA
ACACAGCTCACAGCCGTGAGTCCCAGCCTGGCACAAAGCTAACTTAGGGATGATGAGCGA
GAACTCTGGAAGCGAGAGGAGCTTGGAGATGGAGCAGGAGGCCTGGTGAAGGCTGAGCCA
TGATGCCACAGGGCACGGGGATCACAGCCATCATTGTTCTGTGGCACCAATGCTCTGAGG
AACAAATGGGCAGTTAGAGAGGCTGGAGACCCTCAAGGCCTGGATTTGGGGCCTGAACCC
CATGTCCCAGGTTTAAGATCTGAGACACTTTTCCCACTTCCAAAGACACAGAAGGGGCCT
TGGACATCCAGGAAATCTGTCTTCTGGTATTCTCTCTTCTGTGCTGGCGCTATAAACTAG
TATTAACTTCTCTCTAGAGAAAGCCCTGAGCTTGATGGTTGAAGGTGCAAGGGGAGAAAG
CCCCGTCTGTCTTAGTCTCAGGAAGGACAGTTGTCACCTCCCCTCGGGCCACACTCTTAT
TTACCCATCACCCTGTGGCGTTCTATGCTCAGGGAGCAGAGTGAGGTTCGATGCCTTTCA
GCTAAGTGAGCTGCAGGCTTCACTCGTGCCTGGCTCTCCTCCCTCTGGCAGAGTTCACAG
CCCCCGACTCAGAGTCCCAGAACCCTCTGCAGGTGCTGTGTTTGCACTCAGCTCGGGACA
AGCCGATGTTGTGAGCTTCTGGGTGTAGGTTAGGAAAGGCAGCTCTCAGCAATCAGGCAA
CAAGCAGGCCTGCAGTCTTCAGCCCTGTCCGTTGTCCAGAGGATCCAAGCATCCTAACGA
CAGCTCCCTTGAACCTGCAGATGGAGTTCAACGAGAAGGAACTTCGCAGAGAAATCAGTT
ACGCAATCAAAAACATCCACGGCATAAGGCGAGTGCTTCCCCTCCCCTGCCAGCTGCCCG
CTGACAAAGACCCCGTGGAAGTAGCCCGAGCAAAATTGTGCCCTTGGCGTGGGTTCCTGG
GGTTCAGCCTTGCCTGCTTCTGTAAGTTCTTGTCCACAGAGTGTGGCTGGAACTCCAGGG
AGGCGAACAGCAACCAGCTCTGAAGGAAGATTCTTGTTTTTTGTGTTTTGGGGGGGGCTC
ATACCCAGCAGTGCTCAGGGCTACCCCCGAGTGTCCACTCAGGGATCTTTCATTTTCAGA
TCTGCCTTAGAGGCTCAAATAGTTGGTGCGAATGAGTATTTGCAGAGACAAAAGGAGCAA
ACATCCATTACCTAGCAGCATTTAGAATCAGCAGACTCTCCCCAACTAACAAGATTTCTG
AGTTCCTGATTAATTCCATTCCCTGTCCAATCCGCAAGATGTTGGGTTTACAATTCACAT
CCTGCTCCTTAACTGGGATGTGAACACAATTCTCTTTTTTTTAATGATTCTCTGATAAAT
GAAGGGGAACTGCATTTATTTTATGTTCAAATTACATTACATTCTTGTGCACAAAACATT
TTTGCTTAACCAAAGCCAGCACCGTTGTTTGGTTTTAAAATTCCTCACCAGCTCCATTTT
GTCAAATGTGATGACTAACGCTCAGCAGTGCATTTCAGTCAATTTCTGGTTTTTACCTAC
CTCCTATTTTCCTGAGCTCCTGCATGTCAGGAGAAAAAGTGTTGCTAGGATACAAATTTG
AATTCATCAAGACCATGTCAGAAGGTCCTTGCTCTTTGGATGATTGTTATTGCTGTAGAT
TCACAGTGTGATCAGGCATCCTGGGCCCCCAGCTGTAATTCCTTCCCTCCTGGAAAAGTG
AACTAGGCCATTTCAGCGTTCAAGAAATACAGATCAGGGAGCTGGAGTGATAGTTCAGCG
GGTAGGGCGTTTGTCTTGCACGCGCCCGACCCGGGTTCGATCCCCGGCATCCCATATGGT
CCCTCAAGCACTGCCAGGAATAATTCCTGAGTGCAGAGCCAGGAGTAACTCCTGAGCATT
TCTGGGTGTGGCCCCAAAACAAAACAGCAAAATACTCTTCAAGTGAGTATTAGTCTGCCG
AGAAAAATAATCTAGAGGAAACTTTTCAGTGTTATTCCAGTTCTCCAAGAATTTTCTTCT
GAAAATGTGAAGTAGCTTGTTTCTATGAAGTGCTACTGAAATACAGCCATGCCCCTTCAT
TCACATAGCATATTTTTTCCTGCAGAATTTAGTTTCAGTGGAGACCACATGACCTGCAAA
ACCATTTATTCTCTGGTGTTTACACATTATTTTGTTTTCACATAATAATGGGCCCTGTTT
TTTAACTAAAATTTGTTCTGACTACATTTAGTAGCCTTACAGTTCTACAGAGAGAGAATG
TTCTAGTCCGGTCGTTCATTATGAGCTAATTAGATTCTGAAAGGTTACAAGCCTGATTAG
TGATCCTGTTACTAGGAACCTGGTGTATCATTTGACCCTCACTCCCAGTAAGAATTAAGA
AACACCAAAGACTCTGGGTGACTGGGTGACTCTGGTTTCTATCACAGAGACCTCTCTTGG
TTCTAATTTGTGATCAGTGTTAGTCTTTTTATAATATAGAATTTCTTTTGTATCTTGTGA
AATTACAAAGCAATCTTTTGTAATTAAAGTACTATTAAAAAAGAGCCTATCTGTCCCCAT
CATGGAAGTATAGACTTAGAATCAGGAATATTCACTTTGATTCCATTCATACCATTTAAT
TTGGAAACAACTCAAGCCTGCTGAACCCTGTTTTATAATTTTAACAAATACAGGATATGT
ACAAACTTGATCACTAACTCTACATGATGTTGCAGAAGTGAGAGAATCCAAGTTTTTTAA
AGTAACTGAAGTGATAGAACTGGATTAACTTCAGATTGAGGTTGTCTCTTCTACTGCAGG
GTGAAAAACAAACAGGGTTTTGAAAGATTATCATGTTTAAAGAGATGTTTTGAGCCCCTG
TAAGTTGCATGCCGTGTCATAGCAGAGTAGCGACTGGACAAATCAAAGTATGAAACTGGC
TAGCACAAACTTTCCAGAAAGACATGCTTGGCTTTATTTCCCCTGGTATAATAGCTGAGG
TTTTGAGGCTAACAGAATCCACTGTATTTTATTTGACGTTTTAGATTAACATTTATCCCT
TGTTTTTTGGAAATACCTGGAAATGATAAGCAAAATGTATTACTACTCACCATTTTATAT
TTTGGACTCTAAACATTGTTCTACTTACTAGGGTTTACGTTTCAAAAAAGCCCATGTAAC
ACATCCTGACCTGAAAGCCACTTTTTGCTTGTCAATACTTGGCGTAAAGAAGAATCCCTC
ATCTCCACTCTATACTACTCTGGGTGTTATCACCAAAGGTACTGTCATCGAGGTGAACGT
CAGCGAGTTGGGCCTTGTCACACAGGGAGGCAAAGTTATTTGGGGTAAGTAAATTTGTTC
TAGAAGGCTGCTACTAATTTACAGTCCTAACAGGAAAATGCCTTTCAAGTTGATAGAAAA
TACACAATAAATTTATTTACGAATTGAAGTTGGATATGATTTAAATCTGATTGAAATCTG
TAGGATTTTTTTGGTAGAAAAACTAATGCTCTTTAATTTTAGCATGTTTCAGTTGTAGCT
AGGGTTTTTTTCCTTTTTAGGTCACACTGGGTGGGTGATGCTCATGACTTTGGCTGAATG
GCTCTGCATTCAGGGATCACTCCTGGCAGTGCTCGGGGGACCATATGTGATGCCAGGGCT
TGCACCCGGGTCGGCCATGTGCAAGGCTAACGCCCTTCCCACTGTACTATCACTCCAGCC
CTATAGCTAGATTTTAATGCTTTTATTAAAGCATATTATGAGGGGAAAAGATAAGAGTTG
AAGTTAACTTGAAATTATAGTTGGAAGATGAAAATATGAACTATGAATGGGGTGTGAACT
AGGCATATATAAAACATTAGCATGTTATTTTAGTGACTAAAGCCAAAATTATGTCACAAT
TTTATGTTCTGTTCTTTTTGTTCTCTGCTGTTAGTGCATTGTTATTATTAGTTTAATAAA
GAGAACCTCTGTATTTCAATGTTCTTTTAAACGGAAAAATGAGCTGGAGCAATAGTACCT
CAGGCAGGGTGTTTGTCTTGCATCTGGCTGACCCGGCTTTGATCCCCAGCATCCCACATG
GTCCCCCAGTACTGCCAGGAGTGATTCCTGAGTGCAGAGCCAGGAGTAACCCCTGAGTAT
TGCTGTGTGTGACCCAAAAAGCCAAAAAAAATAAAAGGGAGAACATACCTTCTATCATTT
TAATGGACATCCTCCTACTACTTCACATTGACTAATCTTAACACTGTTTACTGACTTGAA
GCTCATTTAAAATGCTGGATTTGGGGGCCAAGGGAGATGGCTCAAAGGGCTAGGGCATGT
GCATTGCTCATGGGAGCCTGGGTTTGATGCCCAGTACCACAGGATCCCCTCTTGTGCACC
TCCCAAAGTGTATCCCTTAGCCCCCAGAAAAAACCTGATGCATTTTCTAGTTAGGATTTA
TGGGGAGGGGCTGGAGTGATAGCACAGTGGGTAGGGCGTTGGCCTTGCACGCGGCTGACC
TGCGTTTTGATTTCCAGCATCCCATATGGTCCCCTGTGCATCGCCAGGTGTGACCCAAAA
GGCAGGGGGAAAAAATATTTATGAGGAAAATCAGCAATACAGGTATAGCCACAAATGTAC
TTTTTGTATAGTTCTCTAAAGAAGATAATTGGTAAAAATATACAAAAATAAAATTTGAGG
GATCAGGGTCAGAGAAAGTGCAACAGGCTGAGCACATACATTATATATGGGAGTGGGGGG
GCTGGGTTTGATCAACAATGCAGTTTCTGGAGCACCAAGATGCAAAGCCAAGTCCACTGC
TAGTTTGGCCCAGAAAACAAAAACTGAAGGAAAAATAAAAATGATCAGAGCTCAAGTGGT
TTTGTAAAATCATTATTTTCTCCTATCCCTCCCTCATTTTTTCCTATGCTGATACTTTAG
TCAAAGATGATACACTTTGAAGCTATTTTTTGTTAGCTAATATCTCTCCCCATTTTTTTC
CCATTTTGTTCTCAGGAAAATATGCTCAGGTTACCAACAATCCTGAAAATGATGGATGCA
TCAATGCCGTCTTACTGGTTTGACAGCAGCTTATGCAAGTAACTCCTTATACTCACGGAA
GACTACATCTCAGTCAGGGAATCCACCAGTGACTACGGCCAAGGTGATATCTGCAGTCAT
CAAGAAAAAAAGCATATGATACTGCACAAAACATTAAAGTGGCCTAGGCCTAGTTTTCTT
AAAAAGTTATCTTTGTTTTGAGTTTGCTTAGCATAAGTTCCTAAGACTGAACGATTCTAA
ATGCAATTACAGAAACTGTCTGCTTCATCAGTCTATATTCATGAGTGGGTACTTGGCAAT
GCAGATTTGTCATTACTGGAAAAGCCAGTGTACTTAAACTTTAATAATTACAGCATCACA
CAGTATCATTTTGTTTATAAAGTTCTTACCGTAAAAGTATACGAGTTCAGGAGAACTTAA
ATCATTTAACCTCTTTCATTTCTCGATAGAATCGATAGAATGTCAGTATATTCATACTGT
TTCCCCCCCCCATTTGTGACATATATAGTACCTAGTTGGAATAATATTTTCTACTTGGAA
CTTCAAAAAAGAACCCAAATAGGGGCTAGAAAGTGGCTCACTATGAAATGTATGACCTAA
TCAGAATTTGATTCATGACACTGCAACAACAACAAATGTATAGCTCTGTCCCAAAATGGT
TATACTTTTCTTCATTTTAAACTTAAAGAGTGATATATACTTATAATTTTTGATTAGTAA
AAATTGGTTTAAGGGGCCAGAGAGGTAATACAGGAGGTAAGGCACTTGCCTTCTGTGTGA
CTGCGGTGACTGCAACTGTGGCTCCAATCCACCATTGTTACCACATAAACACAATACCAC
AGACCACACAAGTACCACCAGAGGTCATGACTCCAGGGCACAGAGGGACGAATAGGTTGA
GCTTCTCCTGGTGAGGCCAAACTCCCTGCCCCAACAAAAATGGTTTAAATCCAAGTTCCA
TTTTTAATGAAAAACACTGTGGAAGTCTTTAAAATGAAATTTACTTGCAACAATTTGTAT
AAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1003, 2663..2850, 2940..3090, 4733..4912, 15991..16183, 17835..17902
1001..1003, 2663..2850, 2940..3090, 4733..4912, 15991..16183, 17835..17899
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved