Sorex_araneus Locus TSR1
snOPY snoRNA Orthological Gene Database
Sorex_araneus TSR1
Sorex_araneus
TSR1
GeneScaffold_5382
SNORD91
46247..46341
55497
ACAGCGGGGGGCGGGGGGGAACCAGCGACGGGGGGGGCTGTCGGGGCGCGGGTAGGGTG
CGCGCGCCTGGGAGCGGCGGGCCCGGGCGCGCTCCACCGGGGTCGCTGTCATGACAACGC
GCCCGCGCCCGCCCCGAGGGCGCGAACCCGCATTGTGAGCGCTGGGTCCCTCAGGCGGAG
GCGAACATCATTCGCGCTGGACCTTCCTCGATCCGGCCAGACGCCTCCTGATTGCTACAC
GCTCCTCTTTGCGACGGGAGAGCCGGGGTGCCCTGCCTTGGGAGCGCGGCCACCGGGAGG
CCATCGTTAGTCTTCAGGCTGAGGGAAAGGCCGTTGCTCCAGCGCTTCTCTAAGCCCTGG
ACCAGCCGGTCGCCCGAGGATTGGGAGCCTCGGTTGGCCCGGAGGAGGGGTCGTCTAGTC
CTGTCTGACTCTAGGAACTCCGTGGGAAGTGGCGCGGGGAAGGCGTAAATGGGACCGGCG
AGAACTTATTCGGAAACTGCGAAGGTGAAAACTAGCGCCTTCCGTGCGATTAGCCTCGTA
AATTGCCTTACGAGGGAATCAGAGGGAGTGAAACGGACGCTCAAAGTGACAAACACCTGC
TGCTGCATCTGAGGAGTGTAGCACTTAAATCACGGCGAAGAGGAGGGGCTCAGCCCTCCC
GCACGAATGGAGAATCTCCTCAGATGTTTCCCTAAGTAATACATCTGACTGCGCGCGCGC
GCGCACACACACACACACACACACACAAAATAAACAAACAGGGAGCAAACATTAAGAGCC
TGAATCTCAAATCCACATCCGGCTTCTAAAGAGCCCCTAGCCGCAGAACCGCGTGGGAAA
AGTTTGCGCCGCGGTTTCACCAAAACGCTGACGCTGCGCTCACAGAAGCGGTGAGCGGGA
CCCTCGCGAGAGTACCGGGAGAGCCCCGCCCTCCGTGGAGGAGACCGGAAGTGGAGCGCC
AGCCCGGAAATAGTGTTGAGTTGCTGCACGTGAACGAAAGCATGGCGGCCCATCGCTCCG
GGCCGCTGAAGCAGCAGAATAAACCTCATAAAAGCGGGCGGCATCGGAGCCGCGCATCTG
CGCAGCAGGACAGCAAGGGTGAGGAGAGGAGGCTAACGGAAGGAGAGCTAGTCTCTGTTA
GACGCTTTTCCTCCTGCCCAGAGTGCGCGCCTCCGGCGTGAGCTGCTCATTTGGGAAGGG
AGAGGCCGTCTTTCTGGGCCTTCTGTGATGCCCGGCGCGATAATCTCTTCTGATTTGGTC
TCCAGGACGTCTAGCACCGAAAACCCTGAGCAAGAAGGTGAGAAAAGAGCTGAGCAGAGT
GGACCAGAGGCATCGTGCCAGCCAGCTCCGAAAGCAGAAGAAGGAAGCGGTGAGAAGAGC
GGGAGTTGGGGGCATGTTGTGATTTCTTTGTAGGTGGGGAGTAACTCGACGTAGAAAATG
TGGCCATGGGAAGGAAGAGTGACCCCCAAAGCCCATGCCAGGCAGTTCTAGGCTCACGTT
AAATCATTCCTTTGGCTCGTGCCGTTGCTGATCCCCGCCATCCCCAACTTTTATAAGACA
TGCTGATTGTCGGGGACATCTGTATTGTTGAAAATGCCCATATAGAGGGGCTGGAGCAAT
AGCACAGCGGGTAGAGCGTTTGCCTTGCACGCGGCCGACCCGGGTTCGATTCCCAGCATC
CCATATGGTCCCCTGAGCACCGCCAGGGGTAATTCCTGAGTGCAGAGCCAGGAGCAACCC
CTGTGCATCGCCGGGTGTGACCCAAAAAACAAACAAACAAAAAAATGCCCATATAGAACT
AAGTACTGTAACTTTGGTCTTTTCTATCATCAGGTTCTGGCAGAGAAGAGACAGCTAGGC
AGCAAGGATGGTCCCCCACATCAGGTGTTGGTGATACCCCTGCACAACAGGATTTCTTTG
CCGGAGGCCTTTAGGCTGCTTCAGGATAGCGACACTGGAACTGTACACTTGAACGCTTGG
GGAAGCACCAACTTTATGCTGTTATGCCCTCGCTTTAAACATCGGTGGTTTTTCACATCT
GCAAAACCAGGTTGGGGCTTACAGTGCTTTTGTTGTTACGTTTTAAATAGTGGCATGTTT
TTCAATATGATATGCTGGTATCAGTCGCCTCTCCCTATTAACTTTGTCTTTTATCTCTAG
GGGATCTGCACACTGTGCTAGACTTGGCTAAAGTGGCTGATACCATCCTGTTTCTCCTTG
ATCCATTAGAAGGCTGGGACAGCACAGGGGATTATTGCCTCTCCTGCCTCTTTGCTCAGG
GCCTTCCCACCTATAGTAAGTGAGTTGGAAGTATTGAATTAATTGTTACTGTGATTGTGC
CCCTCTGTAATTTGCCAAACCCCATGCCTGACACTTGTTACAGGAATACAACTGTATCTT
GTATGAACTATTTGTATTAGCTGATGGTGGATTTTACATGTATGGCCTAACTTGGCCTAT
TTTTTTTTTTAATAGCACTGTGATGCTTCCTTTTTATTTTGGGATCCCCTTGCCCAGAAG
AATAGAAAGTTTAATTTTGCTGTGAAAGTCCGGTAGGATAGCTGAGTTTTGAGTTTCATC
CCCTTGCCCAGAAGAATAGAAAGTTTAATTTTGCTGTGAAAGTCCGGTAGGATAGCTGAG
TTTTGAGTTTCATCCCCTTGCCCAGAAGAATAGAAAGTTTAATTTTGCTGTGAAAGTTCG
CTAGGATAGCTGAGTTTTGAGTTTCCCAGTTCTCTTCTTGACTCACAAATGAACTGTTGA
CTTGTCTGTGAACTGCACAACTTTGGCTATTGTGAATAGATAATGGAACCCTTTTTCTTT
TACTCACAGCACTAGCTATTCAGGGAGTTTCCGGCCTCCCACTGAAGAAACAAATAGATG
CCAAGAAGAAGCTAAGTAAAGCAGTGGAGAAGCGCTTTCCTGATGACAAACTTCTCATGT
TAGACACTCAGCAGGAGGCAGGGATATTGCTGAGGCACTTGGCTAACCAAAAGCAGCGGC
ATCTTGCCTTTCGAGATCGGCGGGCCTACTTGTTTGCCCATGCTGTTGACTTTGTGCCGG
GTGAAGAGAATAACTTGATGGGGACCTTGAAAATCTCAGGTTATGTTCGTGGGCGTAGTT
TGGATGTAAATAGCTTGCTGCATATCATTGGACATGGTGATTTCCAGATGAAACAGATAG
ATGCCCCTGTGGATCCTTTCCCTCTAAATCCTAGAATGATCAGATCCCAGAAGGACTCAG
CTATGGTGATGGAGGTAAGATGAGTGAATGTTCTTTAGATTTGTACACTGGATTTACGGA
TAAACCGGTGCAGGGTGAGAACTAACTTTAGGGAAAGTCATCTGTTGACCCAGGTAAGTA
GTGTAATCCCTAGAGATGAGTAGTAGTTCGAGGGAGACCACCTAAGGTGTTTGCACATAT
GACAGTAGTGCAAATCACCTACAGATGTGTTGGTATGTCACATTTATCCCATATTTTGTA
GGATGCTTCATGTAGACTTGACTGAGTTTGTAGAAGACAGACAAAATATTTTTCCTTGAG
TCAGTTTAAATAGGTTAAAAAAAAAAGTCAAGCACAGGGCTAGAGCAATAGCACAGCAGG
TAAGGCATTTGCCTTGCACGTGGCCAACCAGGATTCAATTCCCAGCATCTCAGATGGTCC
CCCAAGTACCACCAGGAATGATTCCTGAGTGCATGAACTAGGAGTAACCCCTGTGCATCG
CCAGCCAAAAAAGCAAAAAAAAAATTTTTTTTATAAATAAAAAGTCAAGTACAAATGGCA
GAGTGGAAAATGAAGTATTGTTGAAGTACCAACCTCCTGTGGAAGCTGAGAGTAAATTGG
CAAATTTCACAGGAAAGATCAGATGTAAAGGTTTTTGAGACGTATGAATGAGTTGAAATC
AGATGAAAGAGTATTTAAAAAACAGACTGCATAAATCTTAGCAACAGTTACAGATCGAAG
GGTTTCTTTGAAGAAACTAGCTTGGAGGGAGTAAGGTAACTGATAAATGCAGTAGTAATG
GGAGATGGTTCTGAGAGCCTGTCACTGACACTGTCATCCCATTGCTCATCAATTTGTTCA
AGTGGGCACCAGTAACGTCTCTCATTGAGAGACTTATAATTAACTGTTATTGGCATATCC
AATACGCACGGGTAGCTTGCCGGGCTCTCCGAGAGGGGCAGAGGAACTGAACTCGGGTCG
GCCGAGTGAAAGGCAAACGCCCCACCGCTGTGCTATCGCTCCAGCCCAGAGCCTGTCAGC
TTAGGAAATATTAACTTTTTTTTTTTCTTTTTTGGGGTCACGCCTGGCAATGCACAGGAG
TTACTCCTGGCTCTGCACTCCGGAATCATCCCTGGCGGTGCTCAGGGGACCATATGGGAT
GCTGGGAATCAAACCCAGGTTGGCCTTGTGCAAGGCAAAATGCCCTACCCACTGTGCTAT
TGCTCCAGCCACAGGAAATATTAACTTTTTTTTGCTTTTTGCTTTTTGGGTCACACCCAG
CGATGCTCAGGGATTACTCCTGGCTTTGCACTCAGGAATTACTCCTAGCGGTGCTTGGGG
GACCATATGGGATGCCAGGGGTCGAACCCGGGTCAGCCGCATGCAAGGCAAACACCCTAC
CCGCTGTACTATCGCTCTGGCCCCGGAAATATTAACTCTTGATAAGCCTTGTTTCATCCT
ATTCATACACTTGGGGGCTAAATTATTTATCTGTTAATTGACTATGCTAGACTTAGTAGG
TTTTGTTTAATCAGATACTTTTGATTTTCAGATCTCTGCTACAGAAACAGTGACTGATAT
GGAGGAAGATATAAAGATTCTAATGAAGGCAGATCCTAATAGACAAGAATCTTTGCAAAC
AGAGGTTATCCCAGATCCAATGGAGGGGGAGCAGACTTGGCCCACCGAAGAGGAATTGAG
TGAGGCAAATGGTTGGTACTAATACGCTTGTTTGTAATTCATCTTGCCTGGTAGAGATTT
TGTGTAGTTCCTCATAATTAGAACCCTATGTGGTTAAGTAAAATGAAGGGTTGTTTGGAA
GTCTGTCTTATGTCTCACACCCCTCACACCTCCAAAGCTGTATATATTTATGCTGAGAAC
CACCAGAAACTGTTTTTGCTCTATTTGGGGTGGGGGAGGGTTGGGGCCACACCTAGTGGT
TTTCAGGGGGCTTAATCCTGGCTCTGCTGAGGTGGTATTGAGGGTTGAACTGGAATTGGC
TGCATGCAAGGCAAGAGCCTTACAGGTTTTGTGGTTTTTTTTTTTTTTTTCTCTTTTGGG
TCACACCCGGCAATGCACAGAGGTTACTCCTAGCTCTGCACTCAGGAATCACCCCTGGTG
GTGCTCAGGGGACCATATGGGATGCTGGAAATCGAACCCGGGTCAGCCGCGTGCAAGGCA
AATGCCCTACCCGCTGTGCTATTGCTCCAACCCCCGAGCCTTATAGTTCTTGTACTTGTC
CTTCATCCCCAGTTTTGCTTCACTTCTCAGAATTCCTAGCTAATGAACTAGGAAAATGGC
TCAGTGAAGTGCATTCTCTGTATCATGGAGCCCCAATTTCAGTGCTCTGCACGTCATGGT
ACCCAGAGCCCCTCGAGGTGTGGCCCTAAAGCTAGAAAAAAGTACTTACTATTGTTGGTT
TTTGTTTTGTTTTGGCCGCACCTTGTGATGCTCAGGGGTTCCTTCTGCACTCAGAAATTA
CTCATGGCTGTGCTTGAGGTGAATAGGATGCCAGGATTGAACCCTGGTCAGCCACGTGTA
AGACAAGTGCCCTATCCTCTGTACTATTGCTCTAGGCCCTATTATTTTCTAACAAACAAA
TAAACAACTTTGTATTCCTTGCAGGCTTTTGGAAGGGCTGAGGGAGGGACACCATTAGTA
TGCTTGGGCAAATCTTACCTTAACACCCTAGGGACCACTTGGTCCCAAGAATTAAACTGA
GGCAAGCTGCATGCAAAGAATACTCTACAACCCTTTGAGCGAAGCCAACTTCTCAGGCCT
GTTTGCCATCTTATTTAGTTGTATATTTGTGTTGCCAGTTTTGAGATGACTAAGCTTCAA
CATAGTTTTGTCATAGTGTTTGTTACTTTCCAGTGTTGGCAGCAGTGCTTAGTATCTTTC
CTAATTAAAATTGTTTGTGCTTTTAATAGACCGTTTGAAGGAAAGATCCAAGGTGGTTAA
GAAGGTTCCCAAAGGAACATCCAGTTACCAGGCTGAATGGATTTTGGATGAAGACGGTGA
AAGTAGTGGGGAAGGAGATGAAGATGATGATATCGAACATGAGCATTTTATGGAAGAGGA
ATCTCAGGTTAGGAAATTGGGCCTTTTGGCTACACAGTCCCAAATACAAGGCAAAGTACA
ATCCTGACCTTGAAGGTGAAGAGGTAGGAGGTGCAGGATGTGTGGTTCCCAGGAACAAGT
CTTGTTTTATGATTTCTATTAGAATGAAATTGGTGTGGTCTGGACATCTGGTAAATTCTC
TTTTCTTACCTTAATGGCCTTGTTTTTTGTGTCCCGCCTGATGCTTGCAAAGCATGCACT
CAGCCCACAGAGTAAGCTATCTTTTAGTTTGATTTGGTGTGGGGGTTACACCCTGCAGTG
CTCAGGGCTTACACCTGGCTTTGCACTAAGGGATCATACCTGGTGGGCTTGGGGAACCAG
ATGAGTGCCAGGGATCAAACTCAGGTTGGCTGCATGCAAGGCAAGCACCCTACCCACTGT
ACTATCTCTCTGGTCTCAGTAAACTATCTTTATGCAAATCATCTTAATGACCTTCAGGAT
AGAAACGTCTATGGAGTTCATTCAAACTGTAGTTCTTTATTTTACAGGATGAGAGTAGTG
AAGAGGGAGAAGAGGAGGAATGTGAAACAATGACCATAGGGGAGTCTGTGCGTGATGATT
TGTATGATGAGAAAGTGGATGAGGAGGCCGAGGAAAAAATGTTGGAAAAATATAAACAAG
AAAGACTGGAGGAGATGTTTCCAGATGAAGTAGATCCCCCCCGTGATGTGCCTGCCAGAA
TTTCGGTTAGTCAACAAGTATAAAATTAGTCTTGTTTGTTTGGTTATAGCTTTTTTGGAC
CACATCCAGTGGTTCTCAAAGGGTTACTCCTAGGTCTGTTCAGGAATTACTCCTGCCAGT
GCTCAGGGGACCGTATGGCATGCTGGATATCAAAGCCTGATCAGATGCTTGCAATGCAAA
CACACCCTACCCCCTGTAGTATTTCTCCAATCCCAGTAAATCGATTTTTACTTAAAGTTA
TGCGGCTATGAACTGTGTTGGGGTAATGCAAAAAACAAAAGACACATTACCCTTGGTCCT
GAAATATTCTATTTGAGAAGGTAAGCTATACATAATTAAAACAGTAACATGTAAATGAAT
TCTAGATTGTGTAGTGTAACGTTAAATACATTAATGAAGAAAAAAAAATTCCAAGGTTAA
TTAGCAAGTTTCCTATAAGAGCTAATCCTAGGGCCAGAGCAATAGTATAGCATATAGGGT
GCTTGCCTTGCATTGAACCCGGGTTCAATTGTTGGCATCTTGCATGGTCCCTCACAATTC
CTGGCGTCCATCCTGTATCATCTCTCGAGCACTGCCAGCAATAAATTCCTGAGTACAGAA
CCAGGAGTAACCCCAGAGGCATTGCCAGATGTAGCCCAAAAACAAAAAAAATGCATGTTT
TTGAAGATGGAAAGGAGGAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCAGGAAGTGCAGCTGAAGGTTTTCTTTTT
TTATCAGCTGCAGCTTTCGGGGTGTGCTCAGGGCTCTGGAAGTATAGGGAGGTGGAGGAT
GGTAACCTGTCCAGATCCAAGAAAGCCTGGAGATTTCAGTCACAAAATCCACATACCTGA
GTTTCAGCAAATCAATATTTAGGTGAGGTCCGTACCAAGATAGTGGAGTCTGGTTAGAAG
TATTTGGCGATTTTGGATTGTGGGAGCAAGTGGCTGCTGGGGGCTCTGGGCAGGCACCAG
GTTAACCAGCCCCCCTTCCAGTCTGTTCAGCTTTGAGTGGGTTTGAGATTAACTGGATTT
TGATCTCTTTTTGAGATTTATTTATCAGTCTCTGCAACAGGATTGATAAATGAGCTTGTA
TGATTGAGCCAGAGGTGGTTTGTGGACATGGCAGAGTCTGGCCAAAGGCATTGTGGTGAA
TTTGGGGTGTCAGGAAGGCAGAGGGCACCATCAGAGTGCTGATGCCCTTGTTCGCCCTCC
CCTCCTCTCCCCCTACCCCCACAACACATACCTGCTGTGTCCAGGTTGATCTGTGTCACT
GGGCCCCCGTGGCAATGACTACAGCGGCCTCAAGAGGGACCAGGACCGGGGCCAGGGCTG
CTACCATTCACAGCTCGGGTGCTCTGGTTGGTCTGTAGCCACCAGTCTGGCTGAACCTGA
GCAGGGGACACATGCCCCGTCCTCATAGTTGGCGCTTAGGGAGATTTTCCTCCATAATAA
GCTGCGGGCAGCACTGGTGGCATGGGCTGGTCCAGGGAAGAAATGGTGCTGGGAACACCC
TGTCAGCAGCCAGTTGCCTGAGCCAGTGTCCCATGGTGAAACTGACACCCCCTCAACTCC
ACAACCTGCATTCTTTGGTAGTCTCAAGGTGGACCACGCAAGAGTCCTCTCATTCACACT
AAACTGCTGCCATGGTGGCTGGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAGAGAGAGAGAGCAGCAGGGGA
GGAGACTTGGGAGGATTTCTCCATATTTGACAAGAACAGAAATTATTGAACAATCCTTGA
ACTACAATTTTTTTTTTTTTTTAGCCTTTTCGGTCACACCCGGCGATGCACAGGGGTTAC
TCCTGACTCTGCACTCAGGAATTACCCCTGGCGGTGCTCAGGGGACCATATGGGATGCTG
GGAATGGAACCTGAGTCGGCCGCTGTACTATTGCTCCAGCTCCATCCAGCAACATTTAAA
GATGGAAGTAAATTCTCTAAGAACCCACAGTGACACAAAAATTCCCAGATCGATTTAGTA
TGCTTCCAGATTCACTTCCCACAACTCCTTCCCTTAGCAAAACCCATTTAGACTAGAGTA
AAAAGAAAAAAAAAAAAAGGAAAGAAGCCCGAGGATGCAGTTTGCCATCAGGGACTTGGA
TACTCGGGTACGTATCAACTCTGTCACTCGAGGCAACTGGACGAAGGTTTTCAGCACCCC
TTTACTCAGCGGGAAAAAGGGGGAACCTGAAACTAAAACTGACGAGCTCTTCCAGCCCTC
GCAGTGCAAGCCTCGGGCACGAGTCCGGCCGGTGGCGGATGACCCCGGCCTAAAACACCG
GAGGCCGGGCCGTGGGGTGTCTCCGTAAACCGAGCCTCAGACCTGCACTAGCGTCCTCCG
TGGCCACCACAGCGGCCACAATGGCCACCGCCGCGATCGCCCGCCTGCCCCGGCCTGGCC
TCACCTCACCTCACCTCTCGGCCGCCGAGCCTCCACTCCAGCCTCAGCTCACCTTTCCCG
ACCACGCTCTGCGCACGCGCGGCGCCCGCCTCCGCCCCGGCCTCGCGCACCGGCGCTCCG
CGTCGCCGGCGGCCGAACGTGCGTTCAGCGCGCGCTTTTCCTCCCAGCGCGGCCACCGTC
GTTTGAGGCGGAAAGGCGGGAGGGGGCGGGGAAAAGGGTGGGAGGTGGAGGCGAGCGCGC
ACCGCCCGGCCGTCGTGGTTTCCTGGCTGCGCGCGGTGGTGGCGGAGCAGCTGCAGCTGG
AGCAGCAGCCGCGAACATGGCGGAGGGGTTGGAGCGTGTCCGGATCTCGGCGTCGGAACT
ACGAGGGATCCTGGCCACGCTGACTCCGCAGGCCGGGAGCAGAGGTGAGTCGCGCCGCCC
CGCTCCTGGGCCGGGCCTGCCCGCCCCGCCTCCCTGTCCCTCTCCACCTCCTCTTCCTCC
CCCCGGCGGTGCCCACGGTACTCGGGTGTCCCCGCCCCTTCTCCCCACAGTGGGGGCGGG
GGGGCGAGGGCGGGCTGCCTCCGCGATCCTGCCCGAGGGCTGGCGTGGAGTCCTCGGGCT
TTCCCAGCGTGGGTCCCCTCCGTGAGGACCCAGCCCGAGTTCCTGCCTCCGCCCCTTCCC
CCCCACCCCGCCCGCCCGCGAAGGTGACTGTTCCCCTTTGCTCCAGTGCTCTCAGAGTAG
CCGTGGATTCCCAGCCTTCAGCAGACACGGAAAGGCATGGGGTGCTGGGGTCTGGTGGAG
GTCTCCGCCGTGTCCTGATCCCACAGGAATCCCCGCCTAGGCCTATCCCGCCATTCTCCA
GCGTTGGCGAGAAGAAACCGGGAGAAGTTCAGATGCTGGAACGGTTGACACACCTCCCCC
CCTCCCCACCGCCCACCCCACTCCCACTGGCTTCTGAAGGTTGTGCTCCCAGGAGACTTC
CGGGATCTCCTTGAACGCACCCGACACGCGTCGGCTTCAGCGTGTGTGGGAGCGGTTTAT
CTCAGGATGCCCAACCTGCGACTCGAGGTCTCCAGCTCCACCGGGAAAGCCCCACGGAAG
ATTCTAGTGCCACGCTGCTCCTAGGCAGTGGCGTGGTGTAGGACGGTCGCTGTGNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAG
ACTGGAGGAGATGTTTCCAGATGAAGTAGATACCCCCCGTGATGTTGCTGCCAGAATTCG
GTTAGTCAACAAGTATAAAATTAGTCTTGTTTGTTTGTTTATAGCTTTTTTGGACCACAT
CCAGTGGTTCTCAAGGGTTACTCCTAGGTCTGTTCAGGAATTACTCCTGCCAGTGCTCAG
GGGACCGTATGGCATGCTGGATATCAAAGCCTGATCAGATGCTTGCAATGCAAACACACC
CTACCCCCTGTAGTATTTCTCCAATCCCAGTAAATCGATTTTTACTTAAAGTTATGCGGC
TATGAACTGTGTTGGGGTAATGCAAAAAACAAAAGACACATTACCCTTGGTCCTGAAATA
TTCTATTTGAGAAGGTAAGCTATACATAATTAAAACAGTAACATGTAAATGAATTCTAGA
TTGTGTAGTGTAACGTTAAATACATTAATGAAGGAAAAAAATTCCAAGGTTAATTAGCAA
GTTTCCTATAAGAGCTAATCCTAGGGCCAGAGCAATAGTATAGCATATAGGGTGCTTGCC
TTGCATTGAACCCGGGTTCAATTGTTGGCATCTTGCATGGTCCCTCACAATTCCTGGCGT
CCATCCTGTATCATCTCTCGAGCACTGCCAGCAATAAATTCCTGAGTACAGAACCAGGAG
TAACCCCAGAGGCATTGCCAGATGTAGCCCAAAAACAAAAAAATACATGTTTTTGAAGAT
GGAAAGGAGGAATAAAAGATGTAGAGCATGAGGTCTTCTCTGGAGGTGAGTTGAATTAAA
ATTAGAGCTTATATGGGGGCGGGAGAGATAGCACAGCAGGTAGGCTGCTTGCCTTGCATA
TTGGCTACTGTCTTTGATCCCCAGGACTCATATGGGTTTGAGTCCCTCCAGGAATGATCC
CATAGCACAGAGCCAGGAATAATCTCCGAATACTGCTGAGTATGACCTCCAAAAAAGCAA
AACAAAAAACCCTAAATTTTATACTAAGTATTATAAAGAGTTAGACTTTTTGTTAAAATT
AAATTATCATGAGTAGGCTATTACAATGCTGTTCATGATTGGATTTCAATCATACACCAG
CGTACATTAATTTCTACAATCAGTGTCCCCAGTTTCCCTCCCATCACCCTTCTCCCCTNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNAAGTGCTCAGAGCTACTAACAGATCTGTGCTCTGGATTCACTTTAGGCATTGC
TTGGGGAGCCAGTGGGTGCCAGGACCTTAGCCCAGACCTGCTGCATGCGCAGCATGTGTC
TAGCCCATTGAGGTATCTCAAGGGTATAGTCAGATATTTTGAATATATTTGGAGGAATAC
ATCATGGGCCGGAGAGGTTAAGGTGCTTACCTTTAATGCAGCCCACCCTGACTGAGCACA
GAATCAGAAATACCACCAGATGGAGTCTATTTCCCAGAACCCAAAAAAGAGAAGTGCTGT
ATTAAAACCTTCCAGGTAACTGCTTGGTTATTTTCTCTTGGCAGGTCGGCTGGTATGTCA
CACTACATGTCTCTGAAGTCCCTGTCTCAGTGCTTGAGTACTTTAAGCAGGGAAATCCCT
TGATTGCGTTCTCCTTACTACCTCATGAACAGAAGGTAAGTTAAGAATCTTGTGGATGCT
GTGAAACTTCTAGCCAGCTTTGAGTTTCTAAAAAATTTTATATCTGACTGACACTTCACT
CAAACTGGATATGAAAACTCTGTATTTAGGATTAGAAATCAGGGAATAAGAGAAGTCAAT
GATGGTTTCATCTAACATTGTCTGAACCTGTCTGACGCATCTCAATGATGCAGTGTTTGT
GGTTTCTGAGACTTCTCTGTATTAAGGATGAACTTGTCAGGTGAGCATTTAACCAGATTG
AGAGCCTTAAGTTCAAGATAGCATTTGCCTTGCATCCTGCCATCCCTGGTTCTAATTCCT
GACACCAGAGTCCCTCAAGCACCACCAGAGATGACTTCTAGTTACAGAGCCAGGTATAGA
CCTGATCACCAACAGGTGCCCAAGAGATACCCTCTTCCCCCACAAATAGGGGTCAAAGCC
AACTTCTGTCTTGGTGCCCAGCAGCTATAGTTGTTGGGTAGCATGCCAGAGCTCTGGGCC
TGGCTCACTCACTGTGAGTGAAGATTAGTGAAGAAAGACTTAGTGGCTATAAATGGGAGA
CGTGTGAATCAGTGACTTGATGCTGATAGTGTGGCGGGTGTTGAGCTCTTGCTTGTTTTA
CGTGAAACATTGAGTTGCCCAGAGGGTACATCAGAACTATGAAGATCAGCCTGTGTTACA
GTTTGAATGCAGGTGTTGATGGGAGAGGAAAGGTGAATGTTTCTTATCTATACTCAGTCA
TACATTAGCATTGACAGAGTGCCAGTTCTCTCCCCTCCTCATGCTAGGGAGCAAACCCAA
GCCCTCCTTACACTTGTTATGTGCTCTACCACTNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTATCACTGATATGAGATATCTTACT
GATGTCTCAATTTGCATTTCCCTTATGATTCATGATACAGCGGTTTTTCTGTTTCGATTG
ATTGCTTTTTGGTTTTTGGCCAATACCTTGTGGTGCTCAGGATTGATGCTTGGCTCTATG
CTCAGGGATAGAGCTCAGGCTCAGAGAATTATATGGTTCCAGGGGTTGAACTGGAATTGA
GTCAGCTGCGTGCAAGGCAAGCAACCTACCTGCTGTGCTATTGCTCTAGCCCCAGTGTAG
ATTATTTTTTCATATACCTTTTGGCCACCTGTATGTTTTTTGGGGGGGAAGTTTTTGTTA
ATCTCTTCTCTTTACTACCATTCTCCTCTCTTTTTTTCTTGTAAAGTACTATAAGAAAAA
GGTGCTTTATTTATCTTTATTTATGTCCAGATGAATGATGGGCAAGTATTTTCCTAATAT
GTGGGAGTGTCCTTTTTTTTCTTAAAACAAATTTAATTAAAACACCCTCCAAGCCTGTCT
GTGGGGTTTATTTTTAATTATGTTCATCTTGTCTTTAATTGTGCAGAACTATCTCTAGCT
TCAGTATCATTTTCCCATACGTTTTTGTTCCTGAATAGTTTTTTTTGTTGTTGGTTTTTT
TGTTTGTTTTTGTTTTTTTGCTTTGTGGGTCACACCCAGCGATGCTCAGGGGTCACTCCT
GGCTCTGCACTCAGGAATTACCCCTGGCTGTGCTCAGGGAACCATATGGGATGCTGGGAA
TCAAACCCAGGTCGGCCGCATGCAAGGCAAACACCCTACCCACTGTGCTATCACTCCAGC
CCCTGTTCCTGATAGTTTTAAATGGGCATTATCTGCTTTACAAATTTGTGTATAGCTTGG
GGTTGGAGAGATAGTACAGCAGATGGCAGGCACACTTGCCGTGCAAGTGGCTGACCCGGG
TTTGATCAGCATCGCAGATGGTCCTCTATAGACTGCCAGGAGTGATTCCTGATGCAGAGC
CAGGAATAACCCCTGTGGCCAAAAAAAAGAAAATATGTATACCGCTGGAAAGATGGGATA
GGGGGTAAGGCGACTTGCCTTGCATGATCCTCTGAGCACTGCCAAGAACAGCAGCATCCA
GTCACAGAGCTAGGAGTATCCCCTGAGCTCCACCGTGTGTGGCCCCCAAAACAGAAACAA
AAAACTTTTCTGATAGGAATGAGTTATGCATTTTTATTGTAGAGGGGCAGAAAAAAAAAT
GGATATAATTTTTTCCTTTTTTCTCCCCACTTAATTTAAACACTGTGGTTTACAAAGTTG
TTTGTGATGATGTTACAGGCTTCAGTATTCCAACACCAATCCTATCACCACTGTCACCTT
TCCTCTACCAGGGTCCCCATTTTCCTAACCACCCCTCAAGCCTGTCCTCGTAGCAGACCC
ACAATAATTTATATTGCTTCGTACCACTGACAACTAACAGAATGATCAAAAAATTAGTCC
CATAGAGAAAAATTTGTGAAAATTGTTTTATCTCACCATGGGGACATTAATTCCTTTTGT
GAGGTTTACTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGTTTGGGAAGGCA
TTGCCCTCTGCCCCTTCGTGGCAGGAAAATATTTTGAGAACTAGGTGGCGGTAAACACTG
GCTAGCTTAGTTTTAAGAATTGTAGTGATACAGCTTTTCATAGTCTTAGATCACCTGTAA
TTTCTCAATGTTTTTGATTTTTATTTTGTAACCATTATTATGACAGCGGATAAACATAAA
TTTCAGAGGTTCCTGACTGCTGACACGGCCCTGGTTGTAACAGTGTATGCCCCAATCACT
TTTCCTCCTGCATCTGTACTGCTTTTCAAACAGAATAATGATGGTAAGTTGGATTTACAG
AGGTAAGGTAAATCCTACATGTTAATAGGTATAATCCTATTTTCTGTTTGTAGACCTAAG
AAATTGATGAAATGAAGAAAGTAGTTATAGCTTTCAATATATTTCCTGTAGTCACTCATT
TGACAGGAATGACAAACAAGTTTTATCTTGCTTGCAGACCATAACTAATCTGCACAAGCT
GTTCAGAGTGCTATATTTAGGATAAGTTCTCAGGATATGGGCTGGAGAGATAATATAGGG
TTAAGGCACTTTTCTTGCATGCAACTCTTCTTGATTCCTATCTCTAGCACAGGGGCCAGA
GCAATAGTACAAAGAGTAATGCATTTGCCTTGCACGCAGCTGACCCAGGTTCAATCCCTG
GCTTTCCGTATGATCCCCATGCACCACCAGGAGTAATTTTCTGAGCTCGGAGCCAGGAGT
AACTCTGAGCACACCTGAGCACTGTCAGGTGTGGGGACCCAAAACAAAACAAGAACCAGA
AACTGGTCACTGGAGAGGTAGTACAGTGGGTAGGGTACTTGCCTTGCATGCAGCCAACCC
GGGTTCAATCCCCAGCATCCCATATGGTCTCCTAAGCACCTCCAGAAGTGATTTCTGAGT
GCAGGGCCAGCCAGGAGTAACCCCTGAACATTGCTGAATGTGGCTACCTCCCCCCCAAAA
AAAACTGGTCTGAGGGTAGGCTCAGAAATATTACCACTTGNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNCCTTATTTTAAAATTTCTGTATGTAAAGCCGTTAACAGA
TCTTTGAATTACTCAGTTTTTATTGGAGGTTTTGAAGGGAAGGAGGGAGAGAGAGTGGAG
AGTAACTCGCTGAAGAGAGAACTCAGGCTTCTCCAAGGGCGGAGAGAGCCCCTCACATCC
TAGAGGGATATACACACATCCTAGCATTAGACATGAAAGCATGACAGTACACATCTCAAG
AGGGGGGATGCGGGTGACACATGTGCTCAAGCACGTGGGCGCAAAAAGCACATGGGCTCA
GGCAGCATATGCACCTAAAGTCTTTAAGATCTTACATAGGTCTTTCAATAACTACAGCAA
TAAGTAAAGGCTTCACTCTGCTTTTCCCCTTAGGAATGCACAGTCTCATTGCCACAGGCC
ATCTATTATCAGTAGATCCAGACAGAATGGTCATCAAGAGAGTTGTCTTAAGTGGTCATC
CTTTCAAAATTTTTACAAAGATGGCAGTAGTACGCTACATGTTCTTCAGTAGAGGTAAGT
ATGAAGCTAGGACATGATTGCCTTTGTGGTTTGAAGGCTAGGTGTAGTTTTGTTTTATTT
TGGGCCATAGCGGGCTGTACTCAGGGCTTCAGGAATCACTCTGCTGGGAACTATGTGTAG
TGCCAGGGATTGAACTTGGGTTAGCTGCATGCAAATCAAGATTAATACGGACTGTACTAT
CGCTTTGGCCCTGAAGGTTGGGTTTATATTTGTGTATTAAAGTTTCATCTTGGGGCTGGA
GAGATATATAAGGCACTTGCCTTGCATGTAGGCAGCCTGGGTTTGATCCCTTGCATCACA
TGTGGTCCCCTGAGTACCACTGGTTGTGGTCCCAATGACAAAAAAGCATAAAAGTTTCAT
CCTAGTCTTCTGTGTATTTTATTCTAAGATGATGTGCTGTGGTTTAAACCAGTGGAACTG
AGAACAAAATGGGGCCGAAGGGGACACATCAGAGAACCTGTAGGTAAGAGAATTCCCCAG
TGCCACTAAGTGACTTGCATTAGAGGATCACCGCTTTATTCTACTGTTTCAAATTTTGAC
TGCTCTATTTTCTTTCTAGGTACTCATGGCCACATGAAGTGCAGTTTTGATGGGAAGCTA
AAGTCTCAGGACACAGTGCTAATGAATCTATATAAACGAGTTTTCCCTAAATGGACTTAT
GATGCATATGTGCCAGAACCAGTACCTTGGGTGAAAAGTGAGGTTTCTTCAACAGTGCCT
GAAGTGGACATGGAGTAATGGATTAAATGGGATTCTATCATTGTTACTAGTTAGCACTCG
GGCTTATGGGTACCTAAGTGGGTACCTACCGACTGTGTTTGGACAAAGTTTGTGTTTTCT
ACCTTATCCTATAGTTCGTCTGTCCCTTTTTGCAAAATAATACTTTATGACCTTGACAAG
GTGTTTCAGATTAGTACAGATATTTTTCTGTTGCTATCACATGAAAAAGAAAGAAAAAAG
TTTTACTGAAATATCTAGAGTTAGGATTTTGAAAGCTGTTAAGCAGAGAAGATTGGAAGT
TGATTATGACTAGGAAACAATTTGCAGGTGTCTTAACATTGAATCCTATCAATTTGCAAG
TGTCTTAACATTGAATCCCATCTCTGGTTTTACATTATCAATTAAACAGAAACAGATTGA
TAAGGAACTGGCCTTTCAGCCTGCTTCACCCAAGTGAGGGAAGTTAAGTCTACATTTCCA
CCACTGAGCACAATACAAATGTTCTTCACTTCTGGAGAAACTGTTTGAAAATGCTGAGAT
AGCACAGCAGCCATACCAACAGCAGCTGTAGGTTCAATAAGCAGCTTCATCCTCTCCCAC
ACCAGCTGGCTTGCATGCTGTTGGTACAAAGCAGTAAGAGTTAGTGAATGAGAGAAGAGG
GGAGAGTCTGGTTCTTGGTATTTTATAAGGGCCAGATGAAGTTAAAAGCCCAGTCTGTTT
GTTTTTACTGCTCGTAGTATGTGTTTGACAATGGAGCAGGGCTTTCCCCCCACCCCCCAC
TTCCGTCTCTTAATTCTACTGTTCTAAAAAGTTATAATATCCAGGGCATCCTCCCATATG
TCATGAAGGTCATCTACACAAAGCCCTAAGTCACTCAGTTCTAGGAAGTTGCCCCATTTG
CAGTTTCCTTGACTGTCAGAATCTCACCTTAATTTCATCCTCTGTGACAGTGAAGACATC
ATCCACAAGTTCCCGGATAAAAGGCCAGGTGGTTTAAGGCCAATGCTAGATTTGACAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1097, 1265..1368, 1833..2049, 2160..2294, 2829..3253, 4771..4930, 6149..6306, 6827..7019, 7021..7024, 41554..41716, 46004..46114, 50632..50764, 51046..51162, 53613..53753, 54148..54222, 54319..54497
1001..1097, 1265..1368, 1833..2049, 2160..2294, 2829..3253, 4771..4930, 6149..6306, 6827..7019, 7021..7024, 41554..41716, 46004..46114, 50632..50764, 51046..51162, 53613..53753, 54148..54222, 54319..54494
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved