Sorex_araneus Locus CCT6A
snOPY snoRNA Orthological Gene Database
Sorex_araneus CCT6A
Sorex_araneus
CCT6A
GeneScaffold_1505
SNORA22, SNORA15
6842..6971, 14012..14145
16883
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACAGTATTATTGAATACC
CAGTATGGGGGGTCAGATTGAGAATTTTTTTTAATAATGTAAGAGTACTGCTATTTATTC
AGCCATCCATTAAGCTGATTGAATTGGGCATGAACTTCACCACTCTGGGAATTTTTAATC
CTAAAAGGAGTCCCATGAGGTTCAATGAAGTGTGGGTTTTCAAGCCTGCTCTGAGGTTCC
GAGTATTCCGTCCCCGTACCCCTAGCACCCATTCTGTGGTACTTCCTGTAATGAACGAAG
ATTCTGAGAGATTCGCTTCCGTATCCCCCTACCCCGCCCCGCCACGCCCCCCAGGACGCC
GAGAAGCACGCCGCACGGTTTAGAAATCTGCCGGCGAAAGGAGCCGGAAGAGGAGAGTGC
GGAAGGGGCGCGAGCACGCGCGCGCGGCGGCCTCACGGCCACAGCCCGCGAGGAGCGGCC
GCCAGCGCTTAGGCCCCGCCCCACGCCGGCCCTCAGGCTCCGGATTGGCTCTCAAAGTTA
GCCCCGGTTCGCGCGCCACCGAATCCGGCCGCGCGCCCTTAAAGAGCGACAGGCTCCTCC
CGAGCGTGATGGCGCTGGCGACGTGCAGCCGTGAGCCAATGAGCGGCGCCGGCCACCCCG
CGGCCCAATAGCGGCGGCGAAGGGCGCGCTGGGGGGAGAAGGGGGCGTGTCGGGCGCGCC
GACTTTTCCAGAAGACCCGTGGAGCGCCTTTGCCACCACGCTGAACCGCCTGTGGGCGCT
GCGCGCGGCTGTCTCCTCCTTTTCCTCTGCAGGTCCGGGCAATGGCGGCCGTGAAGACCC
TCAACCCCAAGGCCGAGGTGGCGCGGGCGCAGGCGGCGTTGGCGGTCAATATCAGCGCGG
CGCGGGGGCTGCAGGACGTGCTGAGGACCAACTTGGGGCCTAAAGGCACCATGAAGATGT
AAGGCTGGGGAGCGCGGGGCGGCCCCCGGGGAGCCTCGCGCTTCCGCGGCCCTGAAACGG
GCCTGTCACTTTCCGGGGCCCGCGCGCGTGCGGCTGCGGGGGGCCCCCCTCGCCCCCGTA
GACCCCGTCCGGGCCTGGCGCGGACCGGGGCGCCCGCCCGCCACGGCACTTCCTCGGAGC
CCGAATAAAAGCCGCCCGCGTAACACACCCTCAGACTACGAGAACTAGTCGGAGCGCTTC
CGGGGGCCAGGGTGAGCCCACCGAACCCGGCACCGGGGGGGGGAATGGGGCATGGGACAG
ATACAGGATCGGGCGGGCCCAGCTTTTCAGACCCCCCGGCCTATTAAGATCGCGACGGAC
CGAGAAAACCACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGGGTCAGGCCCCACGCG
TGGTTCTGATCGCCCTCTGGCCGTTAAACAGGCTCGTCTCCGGCGCCGGGGACATCAAAC
TGACCAAAGATGGCAACGTGCTGCTTCACGAAATGGTGAGTGGCCGCCATCGGGGCCCGG
AGCCGGCGTCCTCGGCGTCGTACGTTTGAGTTATCGGAAAGGTTTGTTATCGCGGGAGGA
GGAAATCAGACCCGTCGCTTCTCCGACGAGACGTTTCTGGAGGGGGAGTAGGAAGGGGTG
TGGGCGGTAATCGCCGTAGAGCGAGGCGTGCGGGAGTCTTGGGCAGTTGCTGTGTTTTTG
TTTTAGTTGTTGTTGTGCTTTTCGCATTTGCGGTCCTGATGAGAGGATTGCAATTACAGG
GAAATGACAGTAGTGCGTTTAAGGCTTCCCACGGGCCAGGTGGACCGTGCTGCAGGATTG
GTCACACGTACAACTCTCAGATCTCTTCCCTTCCATCTCCCGTTGTAGATGAGACAGAGC
TGCAGTTTTTTAACTGACCTAGAGTTAGATCACTTGAGAGCAGCGGTTTTTTTACTCGTT
CTTAAATTCCCCGTTAAGTAGCATCATCAATGTAGTGTTGTTGCCCAGAAATAGAGCCAC
AAATTTAGGTATGAGATAATCTGCAAGATGACTAACCTAGAAGCTGAAAATCTTGTTTCC
AACGAGATAAAATTTTCTGTATTAAAGGACGGTTCATTCCATTATCTATTTTATCATTTT
TCTTTTTTATTTCAAATTTAGAATATTTCCTGAGTTTTGGATCACACGGCCGCACTCATC
ACTCCTGCTGGGCTCAGGGACCGTAGTGCGTGCTGGAATTGAAACCTGGCTAGCCCTGTG
CAAGGCTGTGGCAGTACTATCTCTGGTCCCCATCCCCATCCAGTCCGCAGTCTCCCCCCT
CCCCACCCCATAGGTTCCCTCAGACCCGTCCAGGAGTGATCCTTGGGTTTTTTTGTGTGG
TTCACAAAACAAGAACAGGAAATGCTCCTACAGGGTTTCTCCTGAACTAGATTCCAATAA
GACCTTTCTAGTCTACGTAGGGATTAAGCATCCCTTGGATAATCATTACTGAGGGGTGGG
GTTTTTTTGTACTGCTGTAGACTGCTGGGCCTTGGTTTTTATCCAGTGGAGTAGGGCAGC
GTGCCCCTTGGTGCTCAGGACTAACTCTTGGCACTGCGCCAGGCATTGAATCCTGGTGGT
GTCTGGGCCGTGAGCAAGAGAAGTACCATACCCACTGTATTCCAGCCCCTGGACTTGCAT
TTTAAAGGACTCCTGCTTGGTTTATGGGCCACACCCTTCGATAGACCTCTCTGTTCTCAG
TATAATGCCTGATGCACTATCACTCCAGCCTCCCCCCACCCCCAAGAGAATTCAAATTTT
TATGTGAGATGTGGAGGGCCTGGGGGGGGGGGGCGGGAATTTGCCATATGGCTTGTCAGA
ACATGGATTCCTACCTGCCCCAGTATCACTGCATGGGTTTCAAAACAAAGGTTTTGATAA
TAGAAAATTTTTGGATAAAATTAATTTTGGGTTGATTTGATTAAGATAATATTGTTGGAC
TCTTGGACAGATTTTGCAAATTGCAGTTAAGAATGCCCTTTATAATTCCTGTTTAGAATG
TATTTATAATTTCTGTTTAGAATGTATTTGTACTGCTTTATCTTTTTTTTTTCTCTTTTT
CTGTTTCTAGCAAATTCAGCATCCAACAGCCTCCTTAATAGCCAAAGTGGCAACAGCCCA
GGATGACATAACTGGTGATGGTACCACTTCTAATGTCCTAATCATCGGGGAGCTGCTGAA
ACAGGCGGATCTTCTTATTTTCTGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNCAGCGGGTAGGGCATCGCTGAATCGACACCCAGTTTGATCTATGG
AAAACATAAAATGGTCTACTACCACAATTTGGTATGTTCTGAGGATTTTGTGACATTCTT
GGTTGCACAGTGAACACCCAAGTGTTCTTTATAGTTCCCTTGGTTTTAACTCTGTGCTAG
AGCAATGTCTGTTCTTTTCCTCTGCACTGAAAGGACTATCCTTTTAAGTGTATTCAGAAA
GTCAGCACATTATAAGGAACTATGTTTTTTAAATTGGAGAATTTTAGGATTGATGGTGGT
TTTATAATTGTATGTTCATTACAGGGTCTTCATCCAAGAATAGTAACAGAAGGATTTGAA
GCGGCAAAGGAAAAGGCACTTCAGTTTTTGGAACAAGTTAAAGTAAGCAAGCCAATGGAC
AGAGAAGTACTTATAGATGTGGCCAGAACGTCTCTACGTACTAAAGTTCATGCTGAACTT
GCTGATGTCTTAACAGAGGTATGTGTTTGTATCTGTCTGGTAGAGAAAATCACCAATTTA
GAAGCATTTCTGCTTATTTACCAATTTTAATTGCAGGTTTCAATCTAAAGTTTTTGTTAA
TTGGGCTTTTTTTTTTCCCTCTTTGGGTCACACCCAGCAATGCTCAGGGGTACCTGGCTC
TGCACTCAGGAGTTACTCCTGGTGGTGCTTGGGGGACCATATGGGATGCCAGGGATTGAA
CATGGGTCAGCCACATGCAAGGCAGATGCCCTACCCGCTGTACTATGACTTTGGCCCCTC
AATCTAGTTTGTGTAGTATCATGTTGTATGAAATAGGTTCTTTGTGTGGGAATGAGAACC
TGATCTCTTTCTCTAAAAGATTAAATGAAAGCATCAAGTAACTATTTCCTACCGAGGTTA
TGAAACTATAATTGATGCTATTAAAATATGTATAATACTGGGGCTGGAGTGGTAGCACAG
CAGGTAGGGCACATGGCTGACCCGGGTTCAATTTCCAGCATCCCATATGGTTCCCCGAGC
ACCGCCAGGAGTAAGCCCTAAGCATCTCTGGGTGTGATCCAAAAAGCAAAAATAAAATAT
ATATTAATGGAGGGGCTAGAGAGTGCAGTGGGTACAGTGCTTGTCTTGCATGTGGCCAAC
TCAGGTTTGATCCCTAGCATCCATATTGTTTCCTGAGCATTGCAGCATATGTGGCCCCCA
AACCAAATGGTATATAAATGGAGATTTCTTTATCAAAGGGAAGATTTCACTTGAAGTCTT
GGGGGTGGGGGCAGACGGGGAGAAGAAGGGTTGTTAAAGCCAGTGGTGCTCAATCAAGGC
TTGATTACTCCTGATGGGTTGGGGGGGGCATCATGGTTGCTGGGTGGGTCGAACCTGGGT
GTACTGCTGCGAGGCAAATTTCCTACCTGCTGTCCTATCGCTCTGGCCCCATTATGTTTG
ATAATACGAGGGATGGCTGTGCTTGTGTTATTGTGAATTAAGATTCCAGAAATGGAAATG
AGTTTAATTCTTTATAAATAAAGTTAAGAAACTAAACTGCAGAGCAAGAAGCAGGCACCT
CAAACCCTTTTTAATTGCTTGGCCAGGGTTTGAGGTGCCTGCTCTGATTCCCCCACCACT
ACCAGGAGTAAGTCCTGCCTCTTGCTGTCAAACAGCCCCCAAAAAGAGCAAGTAACACTG
TCGATTTAATAGTTATGTTTCTATTCTAGGCTGTAGTGGACTCTATTTTGNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACTCAGGT
TTGATCCCTAGCATCCATATTGTTTCCTGAGCATTGCAGCATATGTGGCCCCCAAACCAA
ATGGTATATAAATGGAGATTTCTTTATCAAAGGGAAGATTTCACTTGAAGTCTTGGGGGT
GGGGGCAGACGGGGAGAAGAAGGGTTGTTAAAGCCAGTGGTGCTCAATCAAGGCTTGATT
ACTCCTGATGGGTTGGGGGGGGCATCATGGTTGCTGGGTGGGTCGAACCTGGGTGTACTG
CTGCGAGGCAAATTTCCTACCTGCTGTCCTATCGCTCTGGCCCCATTATGTTTGATAATA
CGAGGGATGGCTGTGCTTGTGTTATTGTGAATTAAGATTCCAGAAATGGAAATGAGTTTA
ATTCTTTATAAATAAAGTTAAGAAACTAAACTGCAGAGCAAGAAGCAGGCACCTCAAACC
CTTTTTAATTGCTTGGGCAGGGTTTGAGGTGCCTGCTCTGATTCCCCCACCACTACCAGG
AGTAAGTCCTGCCTCTTGCTGTCAAACAGCCCCCAAAAAGAGCAAGTAACACTGTCGATT
TAATAGTTATGTTTCTATTCTAGGCTGTAGTGGACTCTATTTTGGCCATTAAAAAACAAG
ATGAACCTATTGACCTCTTCATGCTTGAGATAATGGAAATGAAACATAAATCTGAAACTG
ATACAAGGTAGGTGGCACAATGCCATGAGATTGTAAACTTTGCTTCTTATTGTGCATTTG
TTCTTTATCCTCAGTAAATATGTAGTAATGTATATAAATGTGTATTCTCTCTAACATTTA
TTTCTTGAAAATAGTGGGCTTATTGTTAGCCATTTTGAGAGCCACATCGATGGTTTAGTG
GTAAAGCATGTACCCCTTGCATGCATGAGTCTGGATTCAGTTCCTAGCACAGAAAACAAA
AATTCTTCTGGGGGCCAGGGTTACAATACAGTGAACAGGGTACTATCATGCAAGCCACAA
ACCTGGATTCCATCGTGAGCACTGCTAGGTATGGCCCAGAATCATGACATTTTCAGTGGG
CCAGAGAGCTTAATAGGTCGAGGGCATGCTCTGCACACAGGAAGTCTGGATTTGAATGCC
GGCATCGCGTGGTCTCCTGGACACCAGTGCCGAGCCCCAAAACAAAAATAAATGATTTCA
GTCTAGGTCTTTAAAATAATTTAAAGATTTCTTTTTGAGTTTCCGATATGTGCTTTGCAC
CTAAATGTTTCATAAATGCCAAAAGACCAAAGTACTTTTCCAGAATATTTTCCCTTTGTG
TTATATCTTAGCTCTGCACTCAGTTATCACTCTTGGTGGGCTTGGGGGATCATATGAGTG
CCGGGGATCATTCTTTTTTGTTTGTTTTGTTTTGGAGCCACCCCTGGCGGTGCTCAGGGG
TTACTCCTGGCTCTGCACTCAGGAATCACACTTGGTACTACTCAGGACCATATGGGATGC
TGGGGATCAAACCCAGGTTAGCCATATGAAAGGCAAGTGCCATACCCACCGTACTTTCCT
CCACCCTTGCAATTTCAAGTCTATACTAGTTGAGGGGATCCTTGCTAAATTTTCTGTGGA
AGATAAGGTTGTCACTTTTGAGTAGTAAGTATATTTGCTAGTATTCAGATACCAGGTAAA
AGCTAAGAGGTCCAGAGAATACGTCAGGGAGGGCCTTTACTTGCCTGCCACCACCAGGTT
TGATCCCTGGCACCGGCACCGCATACAGTCCTTTGAGTATACCAGTAAGCCCTGAGCACT
GCTGGGTGTGGCCAAAAAAAAAAATCAACTAAATCTCATTATGACAAAAGTAAAACTAAT
TATCAATATTAACATTTTAACAAAGTTGTTTGGTTTGAATGGTTTTGAAGGAGTCATTCT
GATAAGTTAAAGCTAATTATGGGGAAATTAGCTGTCTAGTCTCAATGTAGTGTTAAGTTT
TAGCCTGTGCTAAATCCCATCAAACAGAAGGTAATATTTGTTTGTTGTTTAACAGCTTAA
TCAGAGGTCTAGTTCTGGACCATGGGGCACGGCATCCTGATATGAAAAAAAGAGTAGAAA
ATGCATTCATTCTCACCTGCAATGTGTCATTAGAATACGAAAAAACGTGAGTTTAAATCC
CTTAAAAATGGAATAGAGGGGCAGAATGGTATTAGGGGCACTTTTTGAGATTTGTTTTCC
CCACTGTAAAGAGTGATTTGTTTGGTTTTCAACTGTTAACAGTTAACTTCTGACTTTTCT
TTTGCTCAAAGAGTAAACATTTTCTCTTCTGTAACTTTTTTTTGGTAGAGAAGTGAATTC
TGGCTTTTTTTACAAGAGTGCAGAAGAGAGAGAAAAACTAGTAAAAGCTGAAAGAAAATT
TATTGAAGATAGAGTTAAAAAAATAATAGAATTGAAAAAGAAAGTCTGTGGTGATTCAGA
TAAAGGATTTGTTGTTGTGAATCAAAAGGTGAGGGTGAAATTTTTACTTACAAACTAGAT
TCTCTGTTTTTTTGTTTTTTTAAATGAGACCGGAACTAATTTTAATTTTTGTTGCAGGGA
ATTGACCCCTTTTCCTTAGATGCTCTTGCAAAAGAAGGCATAGTAGCGCTGCGCAGAGCT
AAAAGGAGAAATATGGAAAGGTATGGGTAGCAGAGAGCTATATGATACAAATTTTACTTC
GTTAACCTGATTATCCTTATTTTTTGCATTTTTCTTTATTGTGATAAAGTACAGTAAGTG
TTCCATTATGGTAAGTTCTAACATTCTGTTAAAAATTAGTCTCTCATCTGTATTTATCGT
AATCTCATTCCTAATTCTATGTTAATTTTATTTGTGCTTTTGTGGACATAAGCTGTGTAT
GTTTTGACTTGTGAATAATGCTGTTCCGAGTTTTGGTATATACTTATTTTTGCTTTGGGG
GCCATACTCGGCAGTGCTAAGCTGTTCCCAGTTCAGTGTTTGGAAGGTCACTCCTGTGGT
GTTCAGGAGACGATATTGTCCCCTGGAGTGACCCTAGACCAAAACGTGCACACTAGCCCA
TTTTAATTGCTTGGCCCCGGCTTTGGGGCTGGGGGTTGTTTGGAACACACCTGTCAGTGC
TCAAGAGCTGTTGCTGACTCCATGTGCCTGAGTCACTTCTAGCAGTGCTGGGGATCAAAC
GAGGGTGATCCGCTTGTCTTGACCCCATACTGTCTCGGACCACACTTCTTTTGTTTTAAA
CTGTGACATATATGTACGTATTTTTACATGTCAAGAAATAAGTTTCTGAGAAATACTTCT
TCCATAAGAGCTCATCCTGATAAAAGAGCTGTTGACCAGGTTTGAGTTTTTTATCAAAGG
GATGTTTACCAATTTGGGAAGAGAAGTTTAATGGAGACTTAGTGTGAAAAGAATTTCAAT
TAGTTGGCAAATGGCTTTTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCCA
GAGCACTGCTAGGGTATCCTGATGCAAGTCAGAGTACCCCTGTGCATCACTGGGTGTGAC
CCAAAAGGAAAAGAAAAGCATATATGTTTTGTCTAATCAAAATTATGTCTCCTAAAAATG
ATTATTCTCTTCCAATGTCATAATACCACTCACACATCTCAAAACTTTGATATTTCAGGC
TGACTCTGGCTTGCGGTGGGCTAGCTTTAAATTCTTTAGACGACCTAACTCCTGACTGTC
TGGGACATGCAGGACTTGTCTATGAATATACATTAGTAAGTATTTTCTTTCCATGATAAC
CTGTGGTTCGTGAATTCTTCACAAAAATGACTACCAATTATTTAAAATTACTACTGATTG
TACTATAGCTTGCCTTGTGTGTGGCCAACCTGCGTTTGATTCTTGTTACCTCATATGTTC
TCAGCACCAGGTTGTGACCCCCAAAATTCACTAAAATCAGGATCAGGTTTCTGCTTTGGT
TTATGTGTAGTGATCAACTTATGGTGGGACGATCATATTTTCTATGTGCAGTTAAAATTT
AAGTGCTGCTTAATATTTCTCTATTCATTTTTTGTACAAAATTTGATTTTGAAAATGTTT
GAATCGTTTTGCAAAGGGAGAAGAGAAGTTTACGTTTATTGAGAAATGTAATAATCCTCG
CTCTGTGACTTTATTGGTCAAAGGACCAAATAAGCACACACTCACACAAATCAAAGATGC
GATAAGAGATGGCTTGAGAGCTGTTAAAAATGCTATTGATGACGGTAAGAGTTTTTGTGT
ATTTAAACTATCTCTTTTCACTAATCTGAAAAGCATGGCTGAATACTGTGTTCTTTTTAT
CAATATTTTACACAGCCAGACACCATGCAAAAGTAAAGTTTTCCCTTGAAAAGGCTTTTG
ATATGTTGCTTTTTGTGGCATATCATTATTAAAAGTGGCTACAAATAAAGAGAGCTAATA
CTTAGTTTCCAAGTGTTAAATTGAAAAATAATTAAAATTTTGGTATATTGTTTTCAGATG
CAATTTTGTCTTGTAACTTGTGCTTTTAACTTCTAATTTAAATTTTTTACAGTTTGATTT
ATTTTGAGCCTTATCATTTCTCTCTTCCCCACTCAAACAGGATGCGTAGTTCCAGGTGGT
GGAGCTGTGGAAGTGGCCATGGCAGAAGCCCTGATTAAGCATAAGCCTAGCATAAAGGGC
AGGGCCCAACTCGGAGTTCAGGCGTTTGCTGATGCATTACTCATTATTCCCAAGGTATGA
ATACTTATAAAGCAGTTTTTGTGTTTTGGACTTTTATTTATTTCCAATACCACACCTGTC
TGCTCAGGGGTCACTCTTGGCAGAGCTCAGGGACCATGTAAGGTGCCAGGGATTGAGCCT
TAGTTGACTTTGTTGCTCCAGACCTCTTTTTCAAGCCACTCAAATGGTTAAACTCAACAA
ACCTTTTTGGTAATGGGTTCCCCCTCCCCCCATACTGTGAATTTTGTATGAAGTTTTATT
TACTTATTTTTTTCCTAACACTCGTACAGGTTATGTCTTTATCCAGATGTATTTAGTTAT
CTGGAAGGGTAACTTGAATGACATCTGAAGTTACAGGTGGCAACATGGGTAATGCACTTG
CTTTGTAGTAGGCTGACCTGGGTTCTAATAGACCCAGCACCCCATATGGTTCCCTAGGCC
CAGGCAGGAGTGATCCCTGAGCACTACCAAGTATGGCCCAAAAGCAAACAAATCAAATCC
AGGACAGGGGCTGTGGCTCTTGCTATGCATGCTCCCAACCTGAGTTTAGTCTCTAACACC
GAATGTGGTTCCCTGATTGTTACCAGGTATCATCCCAAAATAAGAAATCAAACCCAAAGC
TACAGCTGTTGAGCCATCTCCCTCACCCAAGAGAATTATTCTGAGAGAATGTTATGGATC
AAAATCAAAGGCAGTTGATTTATAGTAATCTAAAATTGATAACACATTTTGAATCACTCA
TAGTTTTACTAGTAAAAGTTAGTCTTTGGTTTTAAAGTAATTTCTGTTACAGAATTTGTG
GCCTAAGGAGTAGGCCAAGCAAGTACAAGCTTGCTTTTTGTTTTGGTTAAGTTATGTTAA
TAGTATTTTCTGTTGTGTGCCTTTGTGGGAGTTATTAAGTGTTTGGGATGGGTAGAGAGT
TCAGCAGCAATATGTCATGATTGTTTTAATGTGTGTGTTATTAAAAGTTACTTAGGGCTG
GAGTGATAGTACAGCGGGTAGGGCATTTGTCTTGCCCACAGCCGACCAGGGTTCAATCCC
TGGCATCCCATGTGGTCCCCCAAGTACCGCCAGGAGTAATTCCTGAGTGCAGAGCCAGGA
GTAACTTACCCTGAGCATCGCTGCGTGTGACTCAAAAAGAAAAAGAAAAAAAAAATTTAG
CCAGGATTGGGAATGGTAGAAAGTTAATAATGACCTGTCACGATTCTTTGAAGTGAAGAT
ACTGGATATACAATAAAATTATTGTCTGATTTTGGGGTTGGAGTATGAAGATACTTTTTA
TGTGTTGTAGACGTAACCATTCTTAGGATCCTGTGTTTAAGGATTACATTTGTCTGCTTT
AGGTTCTTGCTCAGAACTCTGGCTTTGACCTTCAGGAAACACTAGTTAAAGTTCAGGCAG
AACATTCAGAGTCTGGTCAACTTGTGGGTGTGGACTTGAACACAGGTAAGAAACGACAAC
TATTTGTTAGCGGGAGGGGAAGGGGGAACCAAGAAAGAACAAAAACAGACTGAAAATCTT
GGAATTTCTTAAAATGGAATGTCTAGTCGAGTGATTGGATGAAAGCAAACATTTGAATTC
AAACAGATTTGATGTTGCTGAATAGTAATATAGTTCAGGTTAATATCAAAGGCTTAGAAC
TGGATAAATAATACAGGAGGTAAGGTGCTTGTTTCACATTCAACTGCACTAGCCCTGACT
GACTCAAATTCCCACCTTCACATGGTGCCCTGAATACTGCTAGGGTTCCCCCCACCACCC
CCACAACTCTAAGGGTAAGGAAAACATAATGCTGTAATAGGAACCAAATCCAGTGAAATG
AGTGAAGTTCTGGTCTTAGGCCAATTTTTCAAAAAAGAAAGATGGTTGAGATCCATCCAT
GGGATATGTGAGTAGAATCAGTAAATACATTCTCTGTAGTAGAAGAGGCTTGCTCTCCAA
GCCCGTGCTCTTTTTGAACACTTGCTTGTCTCTTGCTGCCTGTGTTTTCTTTAGCACATT
TACATTTCTAACTTCTGTCCTCACATCTTTCTAAATAAATTTTAATTAAAATCATCTTGT
TCCACACAAAGTAGAGGCTTCTGGAATGAGAAACAAGTCTATTTTCTGCAAAGTCCCAAA
TAATGTATTTTAATATAGACAAGGGAGAATGTATTGAGAAAAAGGGAGATGTCCGTGCAT
TTGGTAGCCAAATAGAGCAATCTTATCAGTAGAAGTCTTCCAAGTAGACATTGTGCAAAG
CAGAGAGGGGCAAATAACTCAAGAATCAGAGGGTCTGGCTTGCATGCTAGAGCCCTGGGT
TCATTCCACAGCACCTTAGTGTTTTCCTGAGCACCTTCAGTGAGGTCCATTATAATAAAA
ATTGTTTTTGTAGGTAGGGGCTGGAGTGATACAGGACATTAGCTGTGCGAAAGCCAACCC
AGGTTCAGTGCCCTCCAGCACCAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1137, 2851..2914, 4510..4636, 4638..4645, 7044..7217, 9923..10026, 11335..11445, 11628..11787, 11877..11959, 13378..13474, 13816..13963, 14320..14453, 15782..15883
1001..1137, 2851..2914, 4510..4636, 4638..4645, 7044..7217, 9923..10026, 11335..11445, 11628..11787, 11877..11959, 13378..13474, 13816..13963, 14320..14453, 15782..15883
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved