Sorex_araneus Locus ENSSARG00000000899
snOPY snoRNA Orthological Gene Database
Sorex_araneus ENSSARG00000000899
Sorex_araneus
ENSSARG00000000899
GeneScaffold_6924
SNORD55, SNORD38, SNORD38
1243..1321, 2574..2645, 3820..3889
5084
CTAGGGACCATACAAGATGCCAGGGAGCAAACCCTGGTGGACAAGCATCCTACCTCTGC
ACTGTTGCTTGGACCAATAATTCTAAAATAAAGTTATGTTCAGGATGGTGGCCCATACAC
ATAGAGCCGCTTTTCACTCCCACCTACTTGAATGCCCAAGATCTCAATTAAAATGTCTAA
AATACTTCCTGCCCTAAGAGTACACCATTTCTGAAGGGAAAGAATATTCGAATTGGAAAC
CTCAGGGGAAGCGCTTTGTATATGAGGCCCTGGGGTTTGATGGGGGGCGCCAGCGTTGGG
GAGGTAGAAATATTCGTTCAATTGATTAGTAAGGGATTTAAGAATATCTGGCACACCTCC
CTCTCCCTTGGGGTTTAACCAAGCCCAAACCCTAACCTCTTCCAAACAAACTCTTCTAAA
TAGACCCAGGTTCACTGCCTTTCACCTTTCTTCAACGCAACAGCACTACATCTCATCTCT
TTGCTTATTTTTGAGCTACCAGGAGTGATCCTGGGGGTTTACTCGTGGCGGTACTTGATG
CCGAGTATCAAACGCGGGTAGGGCGTTTGCCTTGCTCGAGGCCGACCCGGTTCGATTCCC
AGCATCTCATATGGTGTCCCGAGCACCGCCAGGAGTAATTCCTGAGTGCAGGCGCCAGGA
GTCCCCTCTGGGCATCGCCGGGTGTGACCCAAAGAGCAAAAAAAAAAAAAAAAAATCAAA
ACGCAGACGAAGCCAGCCACCCGTCGGGGGTGCCCAGCGTCCTCCGCTTCTACCCGAAGG
CCCTAGAACTGCAGAACGCGGGGGCCGGGCGCCACGCCCCGCGGGTCCAGTCTTCCCGCC
GCCGGGCCGAGAGTCGGCGCGTAAGCAAATACGTCACGAGCGTCGCGCCGCGCTTCCAGT
CTCCGCTCGCGGCGCCCGGAAGACACGTCAGGGGGCGGGGCTACATTTTACAAACCGGCC
CGTGAGCCTTTGCGTTTTCTCTTTCCAGCCAGCGCCTAGCGATGGGTGAGCGGCGCTCTC
CTCTGGGTCCATGTCGGCGGGGAGGGTTGCGGTCAATCCGAAGCCATCCTGCCCCGCAGC
CCGATTTAGAAAGCGGGCGTCTCTCCTCCCGGCCCCCCGCAGCCGTGGGGAGGGTGGTCA
TCGGGCTCGGGCCGCCGAGATCCGCCGTGGAAGGGCGCTCCGGGGGCCCGGGGCCGCCGC
GGTGCCAACATGGCCGCCGCCGGGAGGGTGCGGGCGGGCCGCACGTGTGTGATGACACCT
TGGAAATGCTGTGACTCCCGACTGCGCAGTGGGGAATCCAACCTTGGAGAGCTGAGCGTG
CGGCCCGCGGGGCGCGGCGTCTGCGGCCCCCCCGGCTTGAGCCCCCCAGTCCCCCGACCC
TTAACTTCCGCCCCCCGCTTCCCCCCGCAGGCATTTCTCGGGACAATTGTCACAAGCGCC
GCAAAACCGGGGGCAAGAGAAAGCCCTATCACAAGAAGCGGAAGTATGAGCTGGGACCCC
CGGCTGCCAACACCAAGGTGAGTTACCTGCCTCCCTCTGGCAAGTCCTCTCCCTTCGCGC
TGTCCTCGGGCTGTTAGCTTGCGTGTCGGATAATGAGGGCGTGGTGCAGAGACTTTCTCG
CTGTATCGTGTCCCGGGGCCATGAGGGAGCGGGGTTGCACAAAGGCTTGGGCATGTATCT
TGCATCTTGCACGAAGGCTTTGTTTTTCTCTGGGAGGCAACAAGAGTGATGAGAAAGTAA
CCTTAGGCGTGGTTGTGGCCGTCTTGGTCACCTTTTTGCCACTTGCCAGTGTTAGGACTT
GTCATAGTTACACTGACTGTTGCCTTCACCCGGCCTGCTCCCCCATGCCCCTTTCCTCTT
GCTCGGCTGGCTTAATCCCGTTTGTACCGCCCTTTGTTCCGCAGATTGGCCCCCGCCGCA
TACACACAGTTCGAGTTCGGGGAGGCAACAAGAAGTACCGGGCCTTGAGGCTGGACGTGG
GGAACTTCTCCTGGGGCTCAGAGTGTGAGTGGGACCCTCGCGGAGGAAGGGGGGAGGGTC
GCGGACCACTCAGCACTAAACGGGTTATTCTAGGCTTTGGGAAGTACTTTCAACAGGAAG
TTCACGATTTCAACCAAGACCACCTTGTTGACAGACTGAAGGTTGCTGGGAATCCAGAGG
TCTCCATCCTGCCCCCAAAAGGGATTGGGCCGATTCTTGGGATGGCATGCAGTGGTGTGC
CACTCCTGAAAAATTGGTTTAAGTGAGAGATGAGCTTTAAGGCTAGGGAAAGGTATATGG
GAGGGGCAACACAGCCCATGGAGCCTGGGGGTTGATAGTGTATTTCTCCTGTGAGCAGGT
TGTACCCGCAAAACAAGGATCATTGATGTTGTCTACAATGCATCCAACAATGAGCTGGTC
CGCACCAAGACCCTGGTGAAGAACTGCATCGTGCTGATTGATAGCACACCATACCGACAG
TGGTATGAGTCCCACTATGCGCTGCCCCTTGGTCGCAAAAAGGGAGCCAAGTTGGTGAGT
ATTAGGGGAGCCAGCTTCTCTAGGGTGGAGGTAGGGTGGGAGCGGGCTGCCAGCCTTCTT
GTGATGATAACTCTGTCCAGTTCTGCTACTGAAGGGAAAGCGATGAAGCCTATAGATCTG
AGGAAGGCTGGGCTGGGCCCAGGTCAAGATGGCAGTTGACGTTCCTTCTTGGAAACAAGT
TTTTGGGTAGAGGGGACTTACCTAACCCATCTGTCCCTTTATTCAGACTCCCGAAGAGGA
AGAGATTTTAAACAAAAAGCGGTCGAAGAAAATTCAGAAGAAATATGAGGAAAGGAAAAA
GAATGCCAAAATCAGCAGTCTTCTGGAGGAGCAGTTCCAGCAGGGCAAGCTTCTTGGTGA
GATGGCTGCAGGGACTAACAATGCTGCGATCACCCTTGTTGCGGGGGAGGGGGGCATATC
TTATACTTGGCCCGACTTAAGGTTCAACACTAGGACCCAGTAACAGCAGGGATTGAGCTC
TACTGTTTTATTTTGGGTTTGTTTGTTTGTTTTTCTTTTTGGGTCACACCCGGTGATGCA
CAGGAGTCACTCCTGGCTCTGCACTCAAGAGTTACCGCTGGCGGTGCTCAGGGGACTATA
TGGGATGCTGGGAATTAAACCCGGGTCAGTTGCTGCAAGGCAAAACACCCTACCTGCTGT
GCTATCGCTCCAGCCCCTGAGCTCAACTGTTTTATTTTGATTTGGGGGCCACCCCTCAGT
GATCCATGGATCAAATTGGGCCTCTTACGGTCTTTGCATGTGCTCAGCTCTCACCAGTGT
TGGCTGCTTGGAAAGGAAGTGCTTGATGCAATCACATAGCTGTCTCTGGCTCCTTACACA
CCAACACACCTTCCCAACCACCCCTTTTTGGTGGGGGAGTTGAACTCAGATATTTGGACT
TAATCTGGCTCTGCCTGCCCAGGGGTCTAACCTAGGTACTATCTCCCATCTATTTTTTGC
TTGGGGGCCGTACCCAGACTGACTTTACATCAGAGATCGAGCCTAGGTCAGCAAATGCCA
TACCCTGTGTACCATCATTCTGGCTCCATCTATTTATGTGGGGGCACAGCCTGCAATGCT
CAACAGTCTGCTCCTAGCTAAGCACTCAGGAATTACTCCTTGCACTGCTTGTGGGGGGTG
TGTGCTATATGAAACTCTGTGAATTGAATTCAGCCATATGCAAGGCAAGCATTAGCTACC
TAAGGGCCAGCACGGGCCTGAAGAGTTAACCAATAGGATCACTTTGGCAGGCATCTGTAG
GCTTGAATTTTCATGAAGTTTCCCTAGGCTGAGGGGACTGTCTCAGTGATGAAAACTTTG
TCCAGTTCTGCTACTGACTTGAAAGTGACGATAAAGTGTATCTGAGGAGACAGCTTCTGC
TTGCCTGCAAGTTGCCTGAACTAATATGAATGCTTTAGTTTGTCCTTACGCTCAGGACCA
CCTATTCTTTTGCAGCATGCATCGCTTCAAGACCAGGCCAGTGTGGCCGAGCAGATGGCT
ATGTGCTAGAGGGCAAGGAGCTGGAGTTCTATCTGAGGAAAATCAAGGCCCGAAAAGGCA
AATAAATCCTCTGCTCATGTAATAAAGCTGTTTATTGTTCTATATTCTGTGTGGGTAGTA
TTTAAATACTTGTTTTTTTTTTCTCTGGTTCCCTCATGCTAAGTAAAATAAGGGTTAGGT
AGAAGTAGATGCTTTCTTTTCTCTGTCCTGTCTGGTTTTTCATAGTATAGAGCCCAGTTC
TCCTTTTCCTGGGCAAGATCTTGTTATGTAGACTGTGTCTATCATAGAGAGACCAGGATT
AGCCATATGCAAGGCAAGGGCCCTACACCTAAAACCTGTACTGTCTTACACTCTAGTGAA
AATAGAGACTTGGCATGTAAGCCGAGCACCTCTGAAATCAGTTTGTGGGCCATACTGGTA
GGGCTCACCGGACCACAAGAGGTTCCAGGGATAAAACCTGGGTTGGCTATGTACAGTTCA
AGCATCATACACTCCAGCTCATTATCCTGACCTTTATTATCTGGTGAAACTTAACATCTG
CCTCCGAGTCATGATTTAACTGCTAGTCACTTTTTTTAGAAGATCTTTTCAAGGAACCTG
AGAGATGATGCAGGGGTTATTTAAGGCACTTCCCTTGAATGCAATCCACCCCCAGTTTTC
TATGTGACTTTTGATTTTTGAACCACACCCACCGGTGCTCTGGTATAACACCTGACTCTG
CACTCAGGAATGACCCCTAGTGGACTCAGGACCATCTAGGATACCAGTGATCAAACCTGG
GTTGGCCACATGCAAGGCAAGCACCTTACCCACTGTATCTCTCCAGCTTCCCCCACCCCA
TATGGACTGAGCACTGCCAGGTGTGGCCAAAAAAAAAAAAATCGCCATAGAATTCTAACC
TGATCCCTCTTAGTGATGGTTCCTGTCAGCTTAGGTAGGGAACCTTGTGCTGGGAGTTAA
ATCTAGTCCTCCCTCGTGCAAAGTATAAGCTTTGTTCATTTCTGGTTTCGTGGTTCTATA
CTATGTTTTATATTTTTATTTTGGCTTTTTGGGTCACAGCTGGTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1004, 1410..1516, 1904..2003, 2338..2513, 2746..2875, 3975..4084
1001..1004, 1410..1516, 1904..2003, 2338..2513, 2746..2875, 3975..4081
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved