Sorex_araneus Locus RPS11
snOPY snoRNA Orthological Gene Database
Sorex_araneus RPS11
Sorex_araneus
RPS11
GeneScaffold_4757
SNORD35
2172..2259
3786
TCCTTGGGGATTTAAAAAGGGCCTAAGTGGAGCGCAATTTACATTTTACATTAAACTGC
AATAGAGGGGCAGGAGAGCTTTCATGGTGCCTATCGAGTTTGCTTTGCACACGGCCGTCC
CAGGGTGGATCCCCCGCACCCCTTATGGTCCCAAGTGCCTCCAAGGAATGATTCCTGAGG
ACAGAGCCAGTGGTAAGCTCTGAGCAACTCCATATGGGACCCAAAAAACAAAATACAGAA
TTGCACCAGAAGGTGGTTCTGCGGAAAGAGCACGCCTCGCATGCATGAGACCTGGGTGCG
ATGCCCCGCATGGGGAGATGTGTAATTCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
TGCTTTTTGGGTCACACCTGGCGATGCACAGGGGTTACTCTGCACTCAGGAATTACCCCT
GGCCGTGCTCAGGGGACCATATGGGATGCTGGGATTTGAACCCGGGTCGGCCGCGTGCAA
GGCAAACGCCCTACCCGCTGTGCTATCTCTCCAGCCCGAGATGTGTAATTCTTTATAAAG
CCCAGAAACAGCTCCACACTCCCCAGGAGATGGAGGATACACGAGTCTATGACTTCCGTA
TCCCGCTGTGCAAAAGATGGCGGCCACCACTTCCATGAGGGACCGCAAGACGCCCATGTG
TAAGCCTGCAAAAATATGTCGGCCTCCGTGTGAATTCTCGCGATAGCCCATAAGGTAGGC
TGACCACGCCTCCCCAACGTGAACTAGCTGGGCTAGTTCACGACTCTGGTCTGAACTCTC
GCGATGTCATGTAACAGCTTCCCGCCTCTCTCCCTTGACCATCATGGCGTTGTCGGTGCC
GTCTCCCAACTGTGGTTTGGCCCCTTCGTCAGAGTCGCGCCCAAGACTCCGCCCAAACGT
GCTGCCTCTCCCTATTGCCGTCACTTCCGCTCCGGTCCATGCGCAGTCGATAAGGAAACC
GGACGCTGCCGCGACTTTCCTTTTTCCTGGCGGCCGCGAAGATGGCGGATATTCAGGTGC
GCGCTCCGGGCAGACGCCAAAGCCGCGGGGCCCCCAGCACGCCGGACTCGCTCCGCGCCC
CGCTGTGGGGTGAATCGCGGGCCCCCCTAATTTTCGGAGGGTTAATCTACGCTCGCGGCT
CCTAAATCGGAATTCGCTGCTGGGGTTTAATGGCGGATGTAGTGTTGGAAGCCGAATTTC
TTGAAATTCAGGACTCAGGGGATAAGTTTTTGGACTACAGGAGTTCATGGGCCCTGACAT
CAATAACGGGTGCCCGTGGTCTCTGTTTTGTTCAGAGATCCCCCAGAACGAAAAAGTAAA
CTTGTAGACATTGTGAGTTTTGTGGCTTCGGGTTCTGTTTTGCTTTTTGGTTTCTGACCA
CCCGCCGGGGCTCAGGGATTATTCCTAGCAGTGCGCCCAGGGATCAGTCCTGGCGGGGCT
CGGGGGACCATATGTGGCTCCAGGGGTGAACCCGGATTAGCCACGTGCAAGCCAGACACC
TTACCCATTGTACTATCATCCCCGCCCCGTTGTCTGCGGGCTTGAAGAGGTGAATTTAAT
GGATGGTACAGGATGATGTGGAATACAGCTGCCGAGTAACTCAGGGTTTAAAGTGCTCTG
GATTAGAGGGAAGTTTGGGCAGCAGGTAACAGGTCAGGATTTTTGAGGGGGCAGGAGCCT
CCAGCTCCAGTGGCTGTGGAGTTAAATAGCTCCCTCCTTTCTGCAGACCGAGCGCGCCTA
CCAGAAGCAGCCGACCATCTTCCAAAACAAGAAGAGGGTCCTGCTTGGAGAAACCGGCAA
GGAGAAACTGCCAAGATACTACAAGAATATTGGTTTAGGCTTCAAGACTCCAAAGGAGGT
AAGGGACCCAGAGAAGCGAGAGGGACGGTGCTGTCTCCTGGGATCCAAGCTGGGCTCCTG
CCCTGGGCACTGCTGGGAGTTGTAGTTTGTGTCCCTGGTGCCACGCCCTCCAGCTCTTTT
TCCAGAAGATTAATTCCCACCTCTTGCTCATTCCAGGCTATTGAGGGCACCTACATTGAC
AAGAAATGCCCTTTCACGGGTAATGTCTCCATCCGAGGGCGGATCCTATCTGGTGAGTGA
GCCCCTGCATTGGGGGCTGTGGGGGGGGGCGCTCGGCTGGGGTGTGTCTAATTCTGGGTC
CAGGGGACCCCTGGCATATGATGTTTGTACTCACGATGGTCTTCAGATGCCCACCTGGGG
CATTGCTGAGAAAGCCATTTGGCACTGCTGATGTCAGAATTGGGGAGGACTCTCACTTTG
CACACAGCCTGTCCAGGAGTGAGTAATTGCTGAGTGCAAAGCCAGGGTTAACCCCTGATC
ATTACTGGGTGTGACCCAAAAGGACTAAAAAAAGTGGGACATCTTGGGCAGGCCCTCTCC
CTTATTCACAGCACATTAACTCTTGCGTGCTGTCCCCACAGGCGTGGTGACCAAGATGAA
GATGCAGAGGACCATTGTCATCCGACGCGACTATCTCCACTACATCCGGAAGTACAACCG
CTTCGAGAAGCGCCACAAGAATATGTCCGTGCACCTGTCCCCTTGCTTCCGGTGAGCACG
GGGGTGCCGAGTCTCTGGGAAGGGAAGGGTGGGCTTAAGCTGAGGGGTCCCCAGGTGACA
CCGCTGCCACCGTTCCTCTGCAGAGATGTGCAAATTGGAGACATCGTCACGGTGGGCGAG
TGTCGGCCTCTCAGCAAGACTGTGCGCTTCAACGTGCTCAAGGTGACCAAGGCTGCTGGC
ACCAAGAAACAGTTCCAGAAATTCTGAGCCCACGGGCCCCGCACAATAAAGATCTTTTTT
ATTCGTGCCCTTGGGAATTGAGTGGGGTTTATGTTGGGGACAGGGTTCTGGGTTGTCTCA
GGGAAGCTTCAGCCCACCCTCCTCGTGGGATCCCCATGGTTCCCTCACCTGCTGGCATTA
TAACCTTCCTGGCGCTTGACCCCGGGAAGGAGGGGGCTCAGAGGTCAGACAGAACCCGAA
CACCCCCCACCACCACCCTGGGACTGCACTAACCACTGCTGATAGGCAAGGTTCTCCCTG
GAGCCCCCACTCCACACCGAGCAACCACCCATTTCTGGAGATGGCCTTTGGGGAGAGGGC
CCCACACCTGATGAGGTGTCAGGATTGGTCCCAGGTCTACATGGTGAGGGGAACAATTCC
CCTCATCTCTCCAGCCCCTGATTTTACTTTGTTGAAAAAATTTCCTTCAACTTAAATAGG
AAATGGACTTTTAGGAAATTGTGGCCAGGAATAAAAGTTTTTCAGGGTTTCTAAACCCAG
TAAGGCTGACCACCTCCCATATGTCCCTATCTGCCGCCTAGAGATGAGGAAGTGTGGGTG
AGGGGTGCTGGGAGCTACAGACCTGAGGGATGGTCCAGATGAAGGGCCTCAGACGCCGAA
ACCGCTGGCCTTGGACATCACTTGGAGTTCCCTGTTGGTCTCCTGTTCACATGAGCACTG
CTGGGGTCCCCAGGTCCCTGCCCCCCAAACCTGTACCAGCAACTTGGCAGCGCTGGTACA
AGGGTTGGGAGACAGGGCCCTGAGGAGTGGGGATCCTGAGGCCAACAGCTGTCTCTGGGC
AGCCCAGCACCTCCTTTTCATCAGGCCCATAAGGGCGGGGGTTCTTGACAGAGGAAGTGG
GGCCGCATCAAAGGGGACAGGAAGGGGCTAACCTTATAGGAGGGGTGTGCCCCAGCTGCC
GGCAAACCTGCTCTACCCAGGTTCCAGAAAATGGAGGACAGGCCTAGGGATGGGGCAGAC
CCAGAGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1015, 1726..1857, 2016..2091, 2441..2570, 2663..2786
1001..1015, 1726..1857, 2016..2091, 2441..2570, 2663..2783
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved