Sorex_araneus Locus ENSSARG00000013349
snOPY snoRNA Orthological Gene Database
Sorex_araneus ENSSARG00000013349
Sorex_araneus
ENSSARG00000013349
GeneScaffold_5910
SNORD49
1388..1458
2599
AAGCGGCCTGGGCTGAGTTGGACTTCTCGGGTCAAATCTGAGCAGAGGTTCACGCAGGA
AAGTTGGGACAACAGCATTTATTGGGGATTACAGGAGGCACCAGAAATGCTTTCCCAGGT
TCTTGGAGTTTGCTGTTTTCTAGTGATACATGCGCCAGATGTCAGCTTTCCTTCACAGAC
TTCAATCAAAACAAACTACCATAGAGAAACACATGCAGAAGGTAGAAGAATCTCATCCCT
GAGTAAGCTCCATATTAGAGAGATTCACAAAACTCTGAACCAACATTACCCTTTTCACAT
TTTTTTTGTGAAAAAAATGTTTTTGTGGTGCTGGGGACTGAACCCAGGGCCTCACATGAG
TGAGAAATATGCTGTACTGCTGAGCCACATTCCTGGCTCAGTAAAGTTGTTTTTGTAAAT
ATTTTATATTTTTTAAAATTTATTGAATCACTCTGAGCACAGTTACAAAACTTCACAGTT
TAAGTCTCGGTCATACAATGATCAAACACCCATCCCTCCTACCGACGTGTACATTTCCAC
CACCAAGTACCCCAGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCC
CCCACCTCTCCGTCTGCAGCTGCACCGCCCCCGCGCCCTGTCCCCGCCTCTACGCAGGCG
CCTTGGATCTCGTCGCGCTCTGGGAAGCGACCACACGCTCTCTCGCAGGGGGCGTACCGG
GGCGGGCGGGACGTCTGCGGGGCTTACCGAGCTGAAAGTTCCCGTGAGCCTTTGCGCCGA
CCCTCCTCGATTCTGAGAGGAATGGAGTGGTCCGGCTCCTTAAAGGCCTGGCGCGCGACC
GGCACCTTCTTTTCTTCCTCGGTGTTCGGGCTGGTGTCTGGTGTGTGGCTCTCGGCGGGG
AGGCGGACGGGGACGCTGTCCTGATTCTAGCTCCTGGGCAAAGGGCCCCCGGGGGCAGCG
TGGCGTGCGGTGGAGAGGGCGCGCATTGGGGCCGGGCTCAGGGCTGCGCGTCTGTCCGTA
GGTCGCCGACCGCGTGGGGCCTCGATGGCGGGAGCCCGTCAGCCCGGCGCACCCCGCGAG
CACCCCGCGAGCCCCGGGTAGGTGCGTGGCCGGCTGCCCTGATGAGACTTGGGTCAGAAA
GTGTCGTCAAATGAGACCGCTGACTGCGATGCGTAACGGACGCAGTCGGCGACCCCTGCG
CGTGGCCGTCGCGGCCCGGCCTGCGCGCTCCCCGCCGGAGGTAAGGCCGCAGGCTCGGGA
AGGGGGATGGGTTGTCCTGCCCCGGACAGCCGCGCGGTGGAGCCCGGGGAGCGCTGCCAG
TGCTCGACTGCTCTGATGACACGGCTAATAGGAAGTGCCGTCAGAATCGATAACTGACGA
CGAGAAGCCTGGGCTGACTGCAGTCGAGTCGCCACTAGTTGCTGGTGCTTAGGGGCGAAT
TGGTCAGAAAATGTGAAATTAATGTTAACTGTTCGCCCAGGTCGCCAAGGATAAGTGGAT
CTCCACCATGAGACAAACTTGACAGCACCGTTGGCACCTGAAGGTAAGCATTAGTACATG
CAGAGCTGAACGCTACGAGTTATGTCTAGATGCTTGGCGAATTGCTACCTTGATGTTTCT
GCTCCTTTTGGTAATGTCCAAATAACTGACAGACTGCAGAAAGGAACTTGAAAAAGTCGA
ACTTAATCTTTGGTTTTGTAAGTGTTTTGTTGGGGATCAAGTGAAGGCTGCAAGTGAAAC
GTGCACTCAATTTATCAACTGACTTGAATTCAGCCTGTATAAGCCTGAGAATTGGTCTTA
ATCCTTAAAAGTGATGAACCATTAGAGGTTGGGGAGATGGGGTAGAGCACAGGGATAACA
GCTATTTTGTGGATTTCAGTCTTACCCTAAAACCAGAAAATGACCTAAGATGTTATACTT
TTTTAATAAAGGACCGCCCAAAATAATTGCCTGATCATAACAAAATCTTGATTTTTTTCC
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1015, 1027..1040, 1046..1115, 1118..1180, 1183..1188, 1190..1195, 1223..1300, 1304..1312, 1314..1316, 1541..1569, 1577..1583, 1588..1599
1001..1015, 1027..1040, 1046..1115, 1118..1180, 1183..1188, 1190..1195, 1223..1300, 1304..1312, 1314..1316, 1541..1569, 1577..1583, 1588..1599
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved