Sorex_araneus Locus C14orf100
snOPY snoRNA Orthological Gene Database
Sorex_araneus C14orf100
Sorex_araneus
C14orf100
GeneScaffold_7290
SNORA58
16706..16828
21402
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNTATGCAAAGCTTGTGATGGGTAGTTCGTGCCTGGGTCAGCGCCGAGA
CATGTTAGCGAGTTAGTGTGTCTGGGCTGCGTCAGTAAGCTGTGACCCTACCAGTACGGA
GGATCCCGGCCTTTACTGTAGCAGCGCAAAGGCCGCACGCTGTGGAGCGCACGGGCACAG
CTGCGGCCGCCTCACACTCCACGAAGCGGCACAGCCGCAGGGCAGTGATGTTGACGCGCG
TCTCCCGGCGCAGCGGGGCGCTGGGACAGCCCGAAGTCAGGCAAAGCGGCCTAGCGCAGC
ACGCGTGCACACATGAGCTGTAGCCCTCATTGTGCAGAAACAGGACGCCCAGTGAGCGTC
CGGCAGCTCGCTGGGCACCAGCACAGCCCCGTACATGTCCCGGTGCCCCCGAGGCTCGAA
CATGAGCCGTCGCCGTACGTGGTCAAAGTGCTGGCGCATGTAACGCCGCTTGGCCAGCAG
CGTGGGGCCAGCCACCTCGGGACACCCCGCCAGCACAATGCGCAGGGCTCGCCGCCCGTA
TGCATGTCCACCACGGACAACACCGCGTTCCGGGATGGTGCGGGTAGCGGGTGCAGCTGG
CACTTCTCCATCGTCGGCGGCCGGGATTCGATCGCTGCCCCGCGGCGCGCGATGCAGGCC
CGGCGATCGCCACCGCTCTCCGCGCTGGACACCCGGAGCGTGGGCGTCTCGGGGAGGGGG
CGGGGCTTTATAGCTCAGACCCGGAAGAGGGGAGGGGCGGGGCTTCGGGGCGGTCGCCCC
GGTTACCAGGAGGCGGAGCCCCCCAACGCGCCGTGGCCCGGATGTCCGGGCTCCGAGCCC
AGGTCCGCTGATCCCGCAGCTTCTCCAAGGAAACCTACGGGCGGCCGATGGGTGAGTGGT
CACCGTGGTCCAGGGAGCGTTTGCTTTCGTCTCTTGTTCTGTACCCCGCTGCCCGCTTTG
AGCTCTGCCCCGGAGGAGGATTGCAGCCCCTCGCGGGGTCCCGCGCGCCCTCGGGCGGCG
AGCCGCACTGCTGCCCGCGGGCTGGGTGGGCGCAGGTCCCCCCTCAAGGCTGCCGGGGGC
AGAGGGGTGGAAGGGGGGTGGTCGAGCGTGCGCCCAGGGATAGGTTAGGCCGCACGGTCG
TTGTGTTGGAAATGCCAGCCCATTCGTTTTGTTGAGTCCCCTTTGTTTAGTGTTCCTGAG
GGCTGGCTCCCAGATTTAAAGTTGCAGCGTCAGTAAGTGCAGAAAACTGGCTAAAGGAGG
CAGAAGCTAATTGGGGCATAATTGTTGTCTCCCGCCTCGATGTCAAACGGAAAGTTATAA
GGCCCTTCCCAAAGCGGCAGGATCATGGCAGGGGAAATAAAAGATCCTCCCCCGACTACC
CCCCCCCAAAATCATCATTAACTAAAGACAAAGAAATGAGAAGCAAGTGAACGAACATTG
AGAAGCCAGATCTTGTTTGATCTATAAGTTTGTTGGCTTTCAGTTTATCATACTAATTTT
CAGATTTTCTTAATTTGGGAAGAAACCTTACCGCATCCATCAGAAAACCAAAGCCCGTAT
GAAAGAAGTTTCCAGTTCTGTTTCATAATTCATTTTTATTAGCTAGATGTTTAGTAAAAT
TCATCTAGTAAATTCTTTTGTATAGTAAAACATGAATAAATTGGTATTAAAAAAATGTCG
AGCCCTAGAGATAATACAGCGTGTAGGGTGTTTACCTGCATGCCACCGACTGAGGTCCCA
GCCTCTGCGTCCCATAAGGTCCCGAGCACTGCCAGGAGTAATTCCTGAGTGTAGAACCAG
TAATCCCTGAGTAACCACTAAGTGTGACCCAAAAAGCATATATATATTTAAATGTCAAAT
CAGCTAAAAAAATCCCATGAATTTAAACAGACAGAGCGATTTGCTAAAACTGAAAGCTAA
AAAATGAGGGATTTAGTGAGTTTCAATAGCACAAAGAGAAAGAAATCAAAAATCTGCTCA
GATTTGAAAGGTGTCAAGGTCGTTTGAATCAGGTTGTCCAGATTGTGAGATTTTGAAGAT
TGTTTCAGAATACTCAGAAAATGCAAAACATTCCAAACATTCATCGTAGTTGTTTTGGAA
TCTTAAGTGGATCTTTGGTAGTTCCTAACCAGTGGAATCTGATGCTGAAAGCATATTTTA
TTGAATGAATGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNTATTTCTTTTTTTGTTTGTTTTTTTGGGTCACACCTGGTAATGCACAGGGGTTAC
TCGTGTGTGTGTGTGTGTGTGTGTTGTGCGTGTGTGTGTTGTGCGTGTGTGTGTGTGTGT
GGTGTCAAGAATGACTCATTTCTGTTCTTTTTTTTTTTTTTTTGCTTCTTGGGTCACACC
TGGCAATACACAGGGGTTATTCCTGGCTCTGCAGCTCTGCACTCAGGAATTACTCCTGGT
GGTGCTCAAGGGACCATATGGGATGCTGGGAATCGAACCCAGGTCAGCTGTGTACAAGGC
AAACACCCTACCCACTGTGCTATCACTCCAGCCCCTAACATTTCTTATATGCCAGTCATG
CCCTTTACCGTGGAGCCACGTACTCAGCCCAAGGGAAGTTTCTTTTTTAGCAAGGGGTCA
TGGAAGCAGCAGGGATCAAAGTCAGGCACCCTGCCTGCCAGGCAATGCCATGCATTGCCT
ACACATGCATATGTACCTGACTGTTGCAGACACAGCAGAGCTGCTGGGACCACTTGTGAT
GCACATGTACAATACCAGGGATCAAATTCATGGTCTCACACTTGCAGGGCAGGCCGTTTT
AGGCAATGAGTCATTCCCTCGGCCTCAGTAGAATCCTTTTGCTTTTGAAATAGCTTCACA
GAATGTCTTTTACTCATTCACTTATAAAAGAATATGAATGCACAAATTAGATCTCCATGT
GTTGTATTATCTATAATGTTGGTTTTAACTTTAACTTTCTTATACCTGTGGACTGGTAGT
TGAAAATTACTGGTCTTATACATTCATTGAGAATTACTTTATTATTTTTTTTGGGGGGAA
GGGGGTTGCGGGTGTGAGTGAGGAGTGTGGAGCACACCCAGCTATACTCAGGGTTTACTC
CAGGCTCTGTGTTCAGCCTCATTCTTGGCTATCATTCAGTGGCTATCATATCAGCCATAT
GTAATGCCGGGGATTGAATCCAGGTCAGCTGCATGTAAGGCAAACACCTTCCTCCTTTAC
TATCTGCCCAGCCCCCGCCGCAGTATTTAATAGTTCTCTTGAGGGTGGGGGCATTTCAGG
TTGGGCTCATGAGCAGGTGGGCTCCTTGTGATTTTCAGCCCACTGTGTTGAGGGTTCAGT
ACAAAGGCCTGAGGCTGTGGTGCTCCTTTGGTGCTGTGACACCAGGGATTATCCACGCCA
CCCTGGCAGTCTTGGAGAACTCCAGGGCTTGTACCCAACAACGCTGGGGTATCATGTGGT
ACCAAGTTTCAACCAGAGGTAGCCTAATGCAAGGAAGGGCATGTATCTTAACCCCTGTAC
TATCTCTAGCCCCAGAATTTTATAATCTTAGAGTAATTTCTAATGATTTTTTTGTTAGTG
ATGTGGTACAGTGGGTATCCCAAGAAAGTTAACAAATTCCATTGTTTCTTTGCAGTTGTT
TCATATGATATCAATAACTAGATTTTCCATTTGATGTTAGTTAATTTAGTAAATTTAATA
ACATACAGACAAGTGCAATGTAGGTTTCTTTTTATTTTCCTTTTTTATTTCTAAGTGGTG
CAATTGTAGACATGTTTTCTGAAATAGGATGCTTTGTAGAATGATTTTTGTGGGGTATAA
TGTTATAAAATACTGCCTGTCTATAAAATATTATTTCTATGATTTATAGGTGTGTCCAAG
AGGTCAGAGAACAAATGCACAGAAATATTGTCAGCCTTGCACAGACTCTCCAGAACTTTA
TGATTGGCTCTACCTGGGATTTATGGCTATGCTTCCTCTTGTATTGCACTGGTTTTTCAT
TGAATGGTACTCAGGGAAAAAGAGGTTAGTTTTTTTTAACATATCTGCATGGAGCAATGT
TGGAATAATATTTAGAGGACCTTGTAAAGTAATTTACTCCTGCTATTTTAAGTGTGGCAA
ACTATCTCTTTTGTGTTAATTTTGACTGTGGTGGGGCTGGAGTGATAACACAGCAGGTAG
GGTGTTTGCCTTGCATGCACCCGACCCAACTTGGATTCCTCTGTCCCTCTCGGCTAGCCT
GGCAAGCTCCCCGTGGCGTATTCGATATGCCAAAAACAGTAACAACAAGTCTCACAATGA
AGATGTTACTGGTGCCTACTTGAGCAAGTCGGTGAGCAACAGGATGACAGTGACAGTTGA
CTGTGGCAAGAGAACTTAATGAGTGTTTATTAAGTAATTATTAAGGGAAATATTGTTATG
TTTTACTGTAAATGATCTTGAGTTTTTTAAATCTCTCAATTATAATCTTTATTGTTTTCT
ATGGAGAATTGGTTCTGGATGGAGACTCTTTATTTTTTTAAATTAAAAAAATTTTTTAGG
AGCCAGAGAGATAGTGCAATAGTAGGGCAGTTGCCTTGCATGTGGCTGCCCTGGATTTAA
CCCCTGGCACACCATGGGTTCCTCAACCTCCAGGAGAGATTCCTGAGCACAGAATAGAAG
TAAGCCTTGAACACTGTCAAGTGTGGCTCAAAACCAAAAAATAAATTTTTTTAATTGAAA
TAACCTTGCGTTTTAACATAATGCTTCATGTATGTATCATTATAAATCATGTATTTATTA
TTATAAATCATTGTAAATCAACATTTATATTAGAAATACAAGAGTATCCTGCTAAGTGAA
ATGAGTCAGAAAGAGAGGGACAGATATAGAAGGACTGCACTCATTTGTGGTATTGTAGAA
TAACATCACATGAGGCTGACACCCAAGGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAT
CTATTCTAGGTGAGTATTAAAATAATTGGACATGGGAATTGAGAGAGAGTATTTGGGTTA
AGGTGCTTGCCTTTTCTGTGGCTGGCCTTATTTGGATCCTGGGCGCCACACACTGCCCTC
TGATCACCTCCAGAATTGACCCTTGAGCACAGAGCCAGAAATAAGTCCTAAGCTGAGTGT
GGGCCCACTTGAATGAACATCTTTTTTTTGGAAGACATCACAGAAAAGGGAAAAATTCAA
CCCACACTCTTGAGAAAAAAACCTTTACAACTTAATGAAGCAGAATGGAGAAAAAGTATT
GTATGGTCACTTGAAATATTATATGGCAGTGAAAATGATTGAACCTTAGCTATAAGCAGT
AACAGTGAATCTTAGAAATGTAATTTTTAATAGAAAAAATTTCTTAAGAGTTAGCATTAA
TGAGGGCTGGAGCAGTAGTATAGTGGGTAAGACACTTGCATGGCATGTGGCCCACCTGGG
TTTGATCCTTGGCACCCCAAGCTGTCCCCTGAGCCCGTCAGGACTGAGTCCTGAGCTCAG
AGTCAGGAGTAAGCTCTGAGCACTGCCGGGTGTCACTCAGAAACAAAACAGTTAATATCT
ATGTAACACCACGTTTGCAGTGTTCAAAATTAAGCAAAATTAAATTGGTTTTGAAATATA
AATAGAAAATTAATAAAAACTTGAAAAACTGATAAAAACTTACTAGTATAATAGTTGCCT
CTAGGGGAGAGACTAGTGTGGAATGGGGAAGAGCAGAAGCAGATGTAAGTTGTAAATATT
CTAGATATTGGGTTAGATGGTGAGCTTATAATGTTTATTATTATGCTCTATAACTGATAT
GTGATATAGTTTATATACCACTTACTTTTAAATCATACCTGGGTAACTATAGCGAATTTT
TTTTATAATATGGCAAGATGCTAAACTGCTGATGAGATGAGATGAATTTCTGTTCTTTTG
TCTTTTTGTGAGTGATATTGGGGCAGTTTTCTAGGATAACTGTTGTCCTGTTTTTGTAAG
GCTTAACTACTTGTTTCCATATTTATTTGATTTTTTCTATTTATTGGCTTTGGATTTTTC
AGTGAAAAGTTCTCTCAGGATCCATATCTTGAAACATACACGCACTTTATTATTTTTATA
AAGTTGTTCACAATAGACACAGATTTTATTTAAAGCAGTTTAAATCTTGAAACCATTGTA
ATGGAATTCTTTTGTCTTACTAGTTCCAGTGCACTTTTCCAACACATCACTGCTTTATTT
GAGTGCAGTATGGCAGCTGTCATCACCTTACTTGTGAGTGATCCAGTTGGTGTTCTTTAT
ATCCGTTCGTGTCGAGTATTAATGCTTTCTGACTGGTACACGATGCTCTACAACCCAAGC
CCAGATTACATCACCACAGTACATTGTACTCATGAAGCTGTCTACCCATTGTAAGTATTT
GTTTAGATTTAAGATCATTTTATTAATGATAATTGCAGATTCACTCATTTCACAGNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNTCATCCCTGGCACCGCATATGGTCCCCTGAGCACAGAG
CCAGGAGTCAACCTTGAGCACGACTGGATGTGCATCCCCCAAAGAAATTAAGGAATTATA
AAGAAAACCTTACATGCAATGAAGAAGCAATGTCTGACACATAGGAAAAGTATTTTGGAG
TTAAAATCAGGCTTGAGTCAGCTGCTGTCATAGTCACATTTTTCTTGCTTATAACAATAT
CTGTAAAGTCTGCAGTAGAGGCGTCATAAAATGCAGGTCAGAGCAGACCTGGTGATAGGT
GCTGGCACTTCTGCCCTCTTTCTGCACTATAATAGCAACTTAACATTTATTTCAACACTT
GTTCCTGCTGAGCTGGGTACAGTTGCAGAATCTTGTGACTATACTGTCAGCCAAGGAGAA
TCACAGAAACAACTTCATTGATTAAATTGTTTCCAGCTATCTAACATCCCTGAATTTAGT
AGATAATTTTTTTCTTGGAAGCTTTGATAATAGTCACTATGAAATGGCCTGCCTGCCTTA
TTCTAATCATTGTGCACAAAAATGATTTTTTAAAATTATGAGATTTCATAATCAGTATTG
GGTTTTTACGTATTATTTACTTAACCATTTTAAACTTAAATGTGAGGCTATACTGGAACT
ACACATTTCAGAAATCCATAAGCCATTGTAATATTTTCCTTTTGTGAAGCAATTAAAGAA
TAATGGTATAAAATTACCTCTGGGTCACTGTTATGTTGACCAATAAATGCAGTTTTCTCA
ATTGGTGTATAAAAATCTATTTCCATACTAAATTGGAAGAAAACAAGAATTCTTTACTGA
TAACGTTTTAAGTTGAAATTAATTAGATCCCAGGATCAGAAGGTTCACCCATGGCTTGGA
AGCCAATCTCATGTGCTGGAGGAAAAGGTAGTTGGGGTGGAGAAAGGAGTACTAAGTAAA
TGATGGTTGGAGAGATGGCTCGGGATAGTAGATGCTTGCTGAAAGTAGACTATGGACCAA
ACATGATGGCCGCTTGATACCTGTATTGTAAACCATAACACCCAAATGAACAGAGAGAGT
AAGAGGGAATGTGTCTTCCACAGAGGCAGGGAGTGGGGGTGGCAGGAGAGATTGGTATTA
TTGGTGGTGGAGAATGGGCACTGGTGGAGGGATGGGTACTTGAACATTGTTTGACTGGAA
TGCAGTCATGAAAGTTTGTAAGTCTGTAACTGCATCTCATGGTGGTTCATTAAAATAAAT
AAATAAATCTTGTCTATCCAGTAAATAAACATGGATCCAAGATCTCATTTGATCTAAACT
TTAGAGACATCCCCCAATAAATGGAAACAGCTATAAACAGAAAAAAAAATAATTAGATCA
GATTTGATTAAAAAAAAAAAAACGTGGGGCTGGAGTGATAGCACAGTGGGTAGGGCGTTT
GCCTTGCACGCGGCCGACCCGGGTTCGATTCCCAGCATCCCATATGGTCCCGTGAGCACG
GCCAGGGGTAATTCCTGAGTGCAGAGCCAGGAGTGACCCCTGACCATTGCTGGGTGTGAC
CCAAAAAGAAAAAAAAATGTGTATCATTAATAGCATTGTAAAAAAATAGCTTTATAATAT
TAAAACTTTGAGTTACTGGAAATGAAATGTATAGTTACATTTGTGAAAAGTAGCTTTAGC
TGTGAGAATAATTTTTTCTCCTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAGGGG
GGTGGCTTAATAAAGTTAACACATCTTCCAGGAGGTCGGCCATGTAGTGAATGGAATCTA
GGGCTGGGCGGAACACATCAAGAGAGCACAGTGTACAGAGGAATGGGGTTGTTCATCTGA
GAATATCCCTATACTTGTGACTCCCCTCTAGAGGTATAGTAAAATGAGTAGTAAGGATAA
TAAAAAGAATCTCAAAATCTTCATGAAAAGAAAGTTAAAACTGTGTACCCCCATTGTTCA
AAATAAAGAACTAGAAACTATATTCTGGTCATACAGAAAGAATTTTAGAACTCCTTTCTT
TTAAAAATTGCATCGCAGGAACTTGAAAAGCAATAAAAGCACACTCAAGTAAAATAATAT
TCTATTCCTTGAGGGTATCACTGCTAAAACTTGTTTCATTTCTGTATGTATGATTGTCCA
TAGTTTTTAAAGAATATTAAGGTTATAAATATTAAGGTTATACCATGCAGAAGTTTTATT
ATAATCTGCTCTTTTCATGTAATCTGTTAGGCACAGTTATCTTAGTTAACATTTCTTTTT
TAACTAGATTTTTAATGCTAGCGTAGTGTTCCAACATGAATATGCCACAAAATTTAATTT
TATACTGTTGAATATTTCTTCCTGAGTTTTTCTTATTATGTTAGTAACTATACTTGTTTA
TAGGGTTAAGGCTGGTACTTTTTTTTTACAACCTCTGTTTCCTTTAGATAAATTTCTAGA
AACAAACTTGCTGATTTAAATATTTTTAGGGCTTTTGTTGCACATTTCTAGACTGTTTCC
TGGAAAGGAGTTGGCCACATTTTCCAGCGGTAAAGGAGTTTATTTGGCCAAACCATGCAA
GTGTGACCTATCAGTGGGCAGACTTCTTAAATCTCTTTTTAGGAACTTGACTGTAAAAAT
AATGATACAAATTTATTTTAAATTGTATATTTAATGTTATGATTTCTTATGTTACAGATA
CACCATTGTGTTTATCTATTATGCATTCTGCTTGGTATTAATGATGCTACTCCGACCTCT
TCTGGTAAAGAAGATTGCCTGTGGGTTAGGAAAGTCAGATCGATTCAAAAGTATTTATGC
TGCACTTTACTTCTTCCCAATTTTAACTGTGCTTCAGGCAGTTGGTGGAGGACTCTTATG
TAAGTTTTATGGGTAAAATCAATGAAATGTTTATTATTTATATGTGATAATATTTTTTTT
ATCTTTTGCTTCAAAATACCTTTTTTTATCCTTGAAAGCAAACCATAAGTATATTTTGCT
AAAACATTGTCTTTAAAAAGTATATTTTGCTAAGACATTGTCTTTAAAAACTCATGACTT
TCAATACAAAAATTATGACTTTCTTGGAATGTAATCGAATTTGTAAGAAATCAGTGGCAA
GTGGGGCCAGGGTGATATTATAGCATGTAGGGTGTTTGCCTTCATGCAGGCAACCTGGGC
TCTATCCCTAGGACTACGTTTGGTCCCTCCCTGCCAGGAGTGATCTTTGAGCCTAGAACT
AGGAGTAAGCACTGAGCACTGCCAGGTGTCTCCAGAAAAAAAGAAAAAAAGGAAATAAGA
AATCAGTGGCAGCTAATTAAACTGATTTTTATTTGTAGAATTCCTTGAATTTAAGAAGCT
TAACCTAAATAAGAAACTTTTAAACCAGATAGTAAAAATTGAAGAACAAAAGTTGGTTTA
ATATATGATATATGCAAATTACTCTTGATGGTATATATTTTTACCATTAAGTTTATACAT
TCCTTTATGACAATCTTTTCAGTAAAGTAAAATCCTCCATCATGCATATATTCTTTTAGT
AGATTAATGTTTATTAACCCAGCAATCATTCTGAGTTGTGACTCAAAATGAGAAATTATT
ATTCAAAAGATTCACGTACTAGGAAACTATGAATAACTAAGAAAATAGATTAATACTTAT
TTGAATGTGTGACACTGACCACTACAAGGATGTTGGGTATCATCTTTAAGATGGAGCCTG
CCAGCATTCAGAGGGCCTGCCCTCTGACCTAAAGGATCTGGGTGAGAGTAAGCAATAGTT
TCAAGTTGCATAAGTTGGTGAAGGTGACAGTGAAACTGAAGGTAAAGCCCTGGGAAGAAA
AAAATGAAATACTAGGGATCTGTCTTTTCTCATTCATGTTTTGCCTGGAATTTGAAAATC
TTTAGTGTCTTGATGCTATTTTATAAACCTCTTGGTTATGAAATGGAGAAAAGGGAAAAA
GTAGTAAAGAACAAGGAAAGGTTTGGAAAGTCAACCCATGGAGACTCTCAGCATCTTTTT
CCTTTATTGTTTGTGCTGATATTGGAACATACCTTTCTACACACAAATAACTCTAAATCA
TTTTATAGACCTCCACTCAAAACATAGGATCAAAGTATTACTCATAATTCATTCATATAA
AGTATCAAGGCTTGTAATCTGCTAAAATTAATTATACAACGTTTTCATACCTAGTCATAA
TTTTGTTTGTTTGTTTGTTTTGCTTTTTGGGTCACACCCGGCGATGCTCAGGGGTTACTC
CTGGTTTTGCACTCAGGAATCATTCCTGGCGGTGCTCGGGAGACCATATGGGATGCTGGG
AATTGAACCTGGGTCAGCTGCGTGCAAGGCAAACACCCTACCCGCTGTGCTACCACTCCA
GCCCCTAGTCATAATTTTGTGGTGTTGAAAAAAATAGGTAATTGGTTTGTTACATGTCAT
AGTTCAGGCTGTTATAACAGAACAGCAGAACAAATAGCAGAAATCTTTTTCTCCACGTTG
TGGGGACAGGCCCCAGCAGATTTCTGTGTGTAGCAAGGGACTGCATTTTGATTCTTCGTT
GTCTTCTCCCTGTGTCTTCACAGAGTAAAGGATCTCCCTATGTCCTCTAAGATCTCTTGT
AAGAACACTTATTCTGTTCATGTGAATTACATCCCTGTGACCTAATTAATAATCATCCTC
CAATGGCCCCACCTCCTGATACCATTACAGTGCATGTTGGGATTTCAATTTCTGAATGTG
GGAAGGATGCATTCAGTACCAGCAAAGGAGATGGGGGTCTGAGCGAAGTAGTACAGCAAG
AGGCTTCTGGTAGAGAGACCAGAGGCTCAGGAGAGAGACCCTGGGAGTAATGAGAAAGAC
GGCAATGTCAGACTCCCAATTTTTGGAAGTGATACATACTGAAGCTGGTTTTTCAGTGAG
AGCTATATTTGAAAACCCCAGGGAAATGCAGATGCAGATTACCAGACTGTACTTCCAGAC
CTAGTTGCTCAAAAACCTCATTTTTTAAAAAAAAAACAAACCTTAGCATAAGAACCACTC
CTGATCCTACCATGAGCCCATGACTGCCTTCACTCCCCACAGTTTGGTCATTTTTAGAAA
CTGATCATCCTCCTTTCACCTTACATGAATTTTTACTTTAATATGTCATTATCAACACTT
TTTGCAAGTTAAAAGCAGTTTTGTTAAGTAGTTTTAAGGACTTAATGTCTGTTATACGAT
AAAAGATTCTAATGTCACACATTATTAAATTAACAAGTATTCAATTATTCAGTAAGTTGT
ATTAGGGTCTATATACATAATTCAGTTTCTGGCTGCTCATTCTTGAACTGACATTTGAAA
TTGTTCCAAATGGATTCCACTGTAGTGTAGAATGATTAGTAGTTTTGTGAATTAAAGTAT
TTTAAAATAATTATATGAAAAATCAATTTTTTGTCAATATGCCCATTTAAACACAAATGA
AAAGTGTTCTGTTAGAAGAAAGATCACTTAAAGTAATAATATTATGCTGTATTTGAAAGA
GATCGATTTGTCCTTTGAAGTTTTTATTGATACGTTCACTTTTCTAATAGAATAATTAAA
GCCAAATTATTCATATACAGCTTTCTTAATCAAAATTTCCTATCTGGAGCCTAATACAGA
AAATTATTTAAGTAGTTATTTTAAATTTCTCATTTTGTATATAAACTTTTCTAAATGCAT
AGGAAAGAAATTAGTGCTTCATGTTAAATGGATGCCATAAGGCAGGGATCTTTAAAGGTG
GACTAGTGGTAGTTTTATATTTTTAAATAGTTGGTGGGGTGGACCTTACTGAGACAGAAT
CTACTGAAAATTTGGGTATGTGAATTTTGTGACTGAAATCTCCAGGCTTCTCAGAGTTGG
GATGGGCCACTTCTCCCCCACTCCCCTTGTACTCCTGGTAGCACTGGCGATCACCCTTAC
CAGCCAAGTCCAGCGCCACCATGTCAGCTCTTCTACCAGCCTTGCTCTAGAGAGAGAGCC
ATAAATAAATCTCAAAAGAGTTAAAAAGCCACAGTTAATCTTGGACCTGTACAAGGCTGA
ACAGATGATGGTAAATCAGAGGGAGGCAGATCAGCTTGGGGGCCTCCCAAGCAGAGCCCC
CGTCAGCCGCTTGCTTCCACAATTTAAAAGCACCACCAAGCCCCAGGCCTGACTCCACCA
TCTCAGGACGGACCTCACCAAGATACGATTTCCTGAAAATTCGGGTATGCAGGTTTTGTG
ACTGAAATCTCCAGGCTTTCTCAGGGGTCGGGATGGGCTGCCTCCCCCTACCTCCCTGTA
TTCCCGGATGCCTCAGCAGTCACATCCATACCCAGTTAAAAAGCTGCTCCAGCCTACTCT
TCTGATAACAATAGTGAATGCCCTGAACAAGCACTGTGACCTCTTAGTACCTGTATTGCA
AACTATAATGCACAAAAGTAGAGGAAAGCTAGCGGTGAGAGGTGCGGTGTTGAGAGATGA
TGGGAGGGAAAAGGGGGACATTAGTGGTGGGAAATATACACTAATGAGGGATGGGTGTTG
GATCATTGTATAACTGAAACCCAATCATGAACAGTATTATCATGGTCTATTTTTTTTCGA
TAAAAATTTTTTTTTAAAGTAATGTGGAGTTCATGCCTGCTTCAGTCAGCGTAATCAGTG
GCTGAATAAATAGCAGGACTCTTACATTAAACAAATAATAATAAATGGTTTATTGCAGAA
ATGGAAGAAGTATTGCAATCAATACAAGTGAAAATTATGTAAAATTAAGATTCTCTTCAT
AAATTTGTTGGGATTAGGCAAACCTATTCATTTTATGTCTTTGGGGGTCACACCTGGTGG
TGCTCAGGGTTATTCCTGTCTCTATAGTCAGAAAATACTCCTGGTAGTACTTGGGGGACC
AAATGGGGTGCCGTGTGCTATGCTTTCTCCATGTTTATTTATGTTTATTTATATCTCGTT
TGTCTGCCTTCCTGCTGTAGCTGCAGCGTCCATGATTGAGACAGACCCGTATGGTCCACA
AAGCCAAACATATTTACTCGCTGACCTTTAGCTGGAAAGCTTTGCTGAGCCCTGCCTTAG
TGCATTTGGGCTTAGGCCTCTCACAGGACCTGTAGAGAAAGTTTGACTCTGGAATTTATG
GAAGTTTTTTGATGTTAGGCCCAGAAAACAAGTTTCAACATAATATTTTGTTTGCTTTTC
AGATTATGCCTTCCCATATATTATATTAGTATTGTCTTTGGTTACTCTGGCTGTGTACAT
GTCCGCTTCTGAAATAGAGGTAAGAAATCTTTTTTGTTTAAGAATTTTTAAATGCTTGTG
ACAATCGAATTCAATAGAATAAGATAGAGATAATACTACAACTAAGTAGATTCACACAGT
AGCTTCTAGCTCATTAGTTTTATAAAAGGTTATATAACTTGTATATTATATTTGCTTGAG
AAATTAGTGAGTTATTAGTGATCCAGGATGTTGGAGAAAATAATCATTTTACAAAATTTC
ACACATGGAAATATTTATTGAAATAATTGAAAACTTATTAACACTATTTTGAGAGAAACA
AAATGCCTTATTATATATAGATTATTTTAATTTTGTTTTACAATGGCAGCACTAGTAGCA
ATCTATAATCATATCTATATTCTGTATGAGTTTTTGTTTTGAGTTTCATTTTGATTATGG
ACTTTTACTTATGCTTTCTAATATATGTAATGTTTTGATGATTTAGAAGTAACATGACAA
AGTCATTTTGTTTGTATCAATGACTTGTTTATGACAGGTGATTTTGTTTTGATNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGCCGTGGCTCAGAGGACCATTGGGG
ATGCTGGGATTCGAAACCCGAGTCGGCCGCGTGCAGGGCAAACGCCCTACCCCATTATGC
TATCGGTTTCAGCCTCTGTTTTGATACTTTTTGCCCTCTAATTTTTTGCTAATTCCTGTA
AGGCCACTATTCAAAGGAACTTGAAACCAATTCCAAGGAGATGAAAATATAGTATTTTCA
GTGTTATTCTGTTTGATATCCTGTGTTTGCTAATCTAGTCTGAATTGCCTAATCCATTGA
CATTTGATTTTTCATTAAAAAATGTTTAATCCAGGGGCTGGAAATTAGGAGATAACGAGT
AGACCTCTTGCATGTAGTGGCCCTGGGTTTGATTTCTGACACTGCAAGACCCCTAAGCAC
AACTGGGAATAGCCTTCAGGCTCCCCGAGAATTGTTTAAAAGATCCAAAAATCGGGGCTG
GAGCAATAGCACAGCGGGTAGGGCGTTTGCCTTGCACGCGGCCGACCCAGGTTCGATTCC
CAGCATCCCATATGGTCCCCTGAGCACCGCCAGGAGTAATTCCTGAGTGCAGAGCCAGGA
ATAGCCCCTGTGCATCGCAAGGTGTGACCCAAAAAGCAAAAAAAAAAAAAAAAAAAAAAG
GACCCCAAAAATCAGCCAAATAAATAGAATGTCTTTTAAAATGTTCAATCCAGAGAAAGT
CAGTTATTAACTCTTTGAAGTGGTTACTGTTTTCTATTATGTCATTGAGTCAGAGGGGAA
AAATCACGATGACTTTTAGATAGAATAGTAGTAAGAAACTAAACAGAATTTTTTACAGTG
ATTATTTGAATATTTCCATTTGTATAATATCCCTGGACTGGAGCGATAGCACAACAGGTA
GGGCGTTTGCCTTGCACGTGACCGACCCGTGTTCGATTCCTCCTTCCCTCTTGGAGAGCC
TGGCAAGCTACCTAGAGTATCCCACCCGTACGGCAGAGCCTGGCAAGCTATCCGTGGCAT
ATCTGATATGCCAAAAACAGTAACAACAAGTCTCACAATGGAGACGTTACTGGTGCCCGC
TCAAGCAAATCGATGAACAACAGGACAACAGTGCTAGTGCTAGTATAATATCCCTAGTTC
TGTTTTATATTCTTTCATCAACATTTTAATACCCTTAGAAAATATAAGAAAATTTGGTAC
TTTATCACGTCTGAGAAAAAGTTGATGCGGGAAGTTGTTAGGTATTTAACCAAGATTAAG
TCTTTGAAATTTCTATTAATTATAACTACCATAAATAGATAAATTGGTTTGAATCTTGTT
CTCTGCATGGAAATCTTCTGTACAAAAGGTTCATGTATTTATGGACTGGAGAGATAGTAC
GGCGGGTAGGGTGCTTACTTTGGCATGAAGCTTACTCAGATTTGATCCCCACCATCCCAT
ATGGTCCCCCGAGCACCACAGGAGTACAGGAGTAACCCCTGAGTATCGCTGGGTATGGCC
CCCAAAACAAACAAGAAAAATGTTCATATTTTTTAATTAGCATGCTATGTAAGAAATAAA
GACTATAATCAGAAAAAGACAGCCTTAGCTCTAGGTGATTTGATAAGCCATTTAATAAGA
GAAAGTTGTAACTTAGTGGTTACAACCTACATTTTGGTATGTCTATAAACACTTTTGGGC
ATTGCTGTTTGTAATAGTGAGCTACTTTTAATTGCTGCATATTACCGAGGTGTATTAAAG
ATTAGAAGGAAATCATGTGTCATTCCTGTTTCTCTCTAATTCTTAGGCAGCAGACTACAG
GTGTGCTAGAAATGAAGGAAACCCGATGTGTTTTCCTCCTGTAGCTTCAGCTGCAGTGGG
TCAGGGCAAAAGAAAGCACATAATGTGGACTTCTCTTTCTAGTTGGGATCTTACAGAAGC
AGCTCTTGGTCCCTGATTGATGGGTAGTGTGGTATAGAACTAGGAGACAGGCTCCTGTCT
GCTGAATGTGACCAGGGAAACCTTTCTTTTCCATCTGTACAGTTGAGTGGCTGAGATGGG
GAGATGTCTTATTTTCTTTTTAGTTCAGACATTCTATAAATCTGAGGTTATGTGTGTGGG
AAATGATGTATTTTAAGTTAATAGGTAATTAGCTGATTCAGCCCAATAATATGTATTACT
CTTTTCTTTTTATAAATTATATAGAACTGCTATGATCTTCTGGTCAGAAAGAAAAGACTC
ATTGTTCTCTTCAGTCACTGGTTGCTTCATGCCTATGGAATAATCTCCATTTCCAGAGTG
GATAAACTCGAGCAAGATTTACCCCTTTTGGCATTGGTACCCACCCCAGCCCTTTTTTAC
TTGTTCACTGCAAAATTTACTGAACCTTCACGTATACTCTCAGAAGGAGCCAATGGACAC
TGAACGTAAAATGTCATAAAGCCTAATAAGTGTTCTTAAATAAAAAAGTGAAGAATCAAA
AATACATTCATTCTCTTCTGTTGCACATGGAAAAACAAAAGTATATCTTTATGTCTGTTT
ATTTTGACCTAGCAGACTTTATGATTGGACTTGAAAATGCAAATAACCCATTGTATTCTG
CATATAATGCATATAATACAGTAAAGCCAGCATTCTATTATAGTGGACACATTTGAGGAG
CACTTAACTCTTGCAACAGTTTATTTTATAGAGCAAAATAAAGTTTATGTGTATCTAGCA
GAGCATTCTTCCCATTTTTATTAAGAAAAACATTAACAAGTATGAAATCCTTAGCATTGA
CATAATTGTGCATGCCTGTTGTGTTTCTTTTTTTTCCATGTATAATTAATTGTGAAGGCA
AATATACGTGTGGGGTCTGATAGAAAACATGAAACTATGTTTCTGTTATCATTTTCACCA
ATAAAGTATTTTGGTCTATTATCAGAATGAGTATATTTTATATAATAGATTTTCTGTTTA
TAGGTAGTGCAGTTGAGACATCTTCAAATTATTTCTCTTCCTACAAAGAAAAACAGTAAT
GAAAAAGCTTAACTCCAAAAGCTGATACGTGTTCTGACATTTGATTTTTACCAAACTAAT
TGTGGAAATAATTTAAAATATCAGGTTATGTTAGTCATTTCCAAATGAGTAAGTACATGT
ATTCACATATCCCCTTTAGATATAATTTTGGGAAAACCCACATATATACACATGCCAACT
TGTCTTATTTTGTTTATATTTTTTTTTCACATGTAACATCTTTGCATTAGGGTATATCTT
AAAACTGATGGCTTTTAGAGATACCTAAATATAGATGTATCTAAAAACATAGATTATCTA
CTTAGAGATAATCCCTTTTCAAAAAAGAGACAGTTTTCTTATGGTTGGGTATTGATAATA
ATATGCTGCTACTTTTATACTCTGAAGTATTTTAAGAGACTCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1006, 1008..1036, 1038..1070, 3521..3522, 3623..3696, 6529..6683, 9443..9649, 12837..13018, 17342..17418, 20184..20402
1001..1006, 1008..1036, 1038..1070, 3521..3522, 3623..3696, 6529..6683, 9443..9649, 12837..13018, 17342..17418, 20184..20399
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved