Sorex_araneus Locus ENSSARG00000013129
snOPY snoRNA Orthological Gene Database
Sorex_araneus ENSSARG00000013129
Sorex_araneus
ENSSARG00000013129
GeneScaffold_2447
SNORD102, SNORA27
1364..1436, 1683..1804
6981
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNTATGTGTTTTTATTAGTGTTGATATCTATGGTC
TTGGTATACATTAACTAGCATCTCCCTAACTTTTATTAAAAAGCATTGCTTATATAGTTG
CATGCATTGGAAAAGCAAGATTGTAAAATACAACGCTGAGTTTGTATCTGCTGACACTAC
TGTATGTGTGGTACAGTGGGTACACGGCTTGCCTTACAAGTGGCCAGCCTGTGTTCAATT
CTTGGCACCGTATATGGTCCCAAGCCTGCCAGGAGTGATTCCTGGGCACCACCACAACTC
CAGGGTACCCCAAAAGCTATTTTACTAACTAAAAGTTGGTAAGATTACATACTTAAATTT
GAATACTGACTGTACTGATGATTCCAACTCTTCCCCCAGGAGTTGTTCCTTTGGCCACAT
ACATGCGTATATACAAGAAAGGTGATATTGTAGACATAAAGGTAAGTTACAAATTGGAAA
TAACTCGGTCAGTACTTAGTGTGTGTTCTTTTGGCTCCTTTCAGCCTTTTAAATGGGAAT
AAAACTTAATAAGCTTTGAGTGTAGACAGTTAATATACTTTAGAAGCCAGAATTATTTGT
GCTTAACTTTTTCTCATTATCTAGTTATTGCTAACATCTAGTAGCATTTGTTGAGGTGAA
ATTGAATACCTTTGTGTAAAAAATTACTGGTGGGGATGGCTATTAAAAATAGTTATAGCT
GTGTTCTTTCGTGACTAATTTTTAAATGCATTATGGCACTCTAGAGTTTAATGATGATTA
TCTTTTTGATTGCTTTTGAAGCAATATGAAAAACACATTTCACCGGCTCTGAAAGCTCTT
GAGTTGCCATTAAAAAAAAAAGTTCCTTGGATAGCCTTGATATGAAAGAGAAATAGATGG
CATTACGTTTGCCTCCTTTGTTCACAGGGAATGGGCACAGTCCAAAAAGGAATGCCCCAC
AAGTGTTATCATGGCAAAACTGGAAGAGTCTACAATGTTACCCAGCATGCTGTTGGCATT
GTCGTTAACAAACAAGTCAAGTAAGTAATGTGGTTTTTGGAGGGGCTAATTGGTATTCCC
TTATGCACCCTTCTCACTGCCAGTTGGACTTAATCTTAGTTGGTCATTCAAATAGGGCAA
AGTAAGGTCCTTTTAAAACTCAAGCAAATTGGAGTTTGTCTTTTATACTGTCAGAGGAAA
CAGCATGAAAGATAAGACTGGAGGAAAGTCATGGGATTGATTAAGGTGATTTATTGCCAG
CACAAAAGGTTTAGTAATTTAATATAGCAGCCTGGTTTGTTATTTTCACAGTCTGTTATC
ACAAGAAAAAGCTTAAAAGTGGAACTGTGCCCAAACACTGATTCTCGAAGTAAGATTAAT
CATGATTGCAAATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTTTG
GAGCCATTGACATAATCTCTCTGTACCTGTGTCCTCACCGAGGAAATGGGCTTAATCCCA
GTACTGCTGTGCCCGGGTGGGTGTGGATTAGATTAAAGAGCTCTGGTCGGGTTCTGCCGG
CTGTGCTCGATGTCAGTGCCCCCAATACTTGTCAGCTGGTGAGGATGGCTGGTCTGGGGA
GGGGAAGGTGGTGCGTGGCATAACTGATAAAGTGACCAGAGGAGATGAGTCAGTATCTAA
ATTGGAGCAGATAATACTGTTTTAGATGATTCTTTATAAAAAAAAAGAGAAATTTAGGAA
ATGATGTAAAAAAATGTTAGGGAGGGAAGTAGGTGGACTGGAGATAACACAGGAGCATGG
GTGGGGGATCTGGAGATGACACAGGGGTTTGGGTGGGGGGTCTTGAGGGCTTTGGTGTGG
AGAGGTGGGTTACCCATACACCCCAAGCCCATAACTCTCAACACCACTGTAAACATATTA
CCTTGACTCTAAGAAATTAAAAAGGGTTCTTACTGCAAGAAATTAAAATAATATCGATTC
ATATCAATTAGGAAGACAAAGTTCCTGCCCATAAATCTTTCTCCTTCCTCTACCTCCCTT
TTCCATAATGTGCCAATGTCAAGTTTGGTAGATGCTATGTTTTGCATTTATAGTTTATTC
TTTCCGGTCCAGGTGTGTGCCTTTCTGTCCATTGGGTGATAACAAAATCTATTATCCATT
TACCAAAAATGTCAGAGACTAATTAAGCAATTAGAATTAATTAGAAATGAATTCTTTCGT
CTTCAAGATGTTTTTTTTTTAATGAAGAGTAAAAAGGAAATTGTCCTTGAAGGCGTGTTT
GGACACAGTGGGAAGAGATGTGTTCTTCAAAAATTCTCTGCCACTTGTTAGTAGGGGAGC
TGTACTTATGTGAGTTAAGACATCATTTCCAGAAGTCTCTGGAAAGTTGCAAACAAGCAT
GGTTCCTGGAGCAGGGCAGGGGAGAGAGAGCCCCTCGCATACCAAGCAGCTCTGTCCACA
TTAGAATTTTGTTTTGGCTCCTCCTGCTTCAGGAATCAGAGCCCCAGCTGTGATCAGAAT
CCGTAACGCTCTGGGTTCCTTATTCTTGATTTTTGTCATGCTCTGGCCTTTCAGTCATAG
TTCTTCTCTTCAGAGTCCTTTCTGGATAAACAGTAGGAGGAGCTCTTTGCATGAGCAGAG
GTAAAAGCTGTGCTTCGATAATAAACGTTTATTTCTAAGGCACCGTGCATAGACCTAGAG
GCATTTTACGCTGGCGTGCTTTTTACAGAAATAAAATAAAATAAATAAGGGACCCATGAC
TTTCAATCAACTCATTGATCTAAAAACAAAGCCAAAATCTTGCCCCAAATTTTCTAATAA
CGTTTTATTAGAAAATAAACATCTTCTTATTATCCTAAAGCCTAGTTACTTCTTTTCTGA
TTATATGATAACAGAAACATCATTGGTTGGAATATTAGCATAACTGTTTTCGATCGGAAG
ATTTAGTTTGGGACTGGAATCCTTTTGTGTTTTTAAACATCATTTTACATTTACAAGTGC
TGCTGATTTAAGTTTTATAATACTCGTATACTTTTATTTTTTTTTATTTTATTTTTTTTC
TTTTTGGGTCACACCCAGCGATGCTCAGGGGTTACTCCTGGCTCTTTGCTCAGGAATTAC
TCCTGGCAGTGCTTAGGGGACCATATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGGCTACTACACATG
CTTTTCTTGTGGGAAGCCTGTGATTTCATCAGTGACACCCCATTTTTTCCCAGACCTGCC
AGGAGTGATCCCTGAACATCATGCTAGGCAGGAACCCACCACTGCAAGGTGTAATAGGAA
AGAAAAACAAAAATATCCGAAAAACTTTTTGAGAATGCATTGAGTGACATAGGTTGGCAA
TAATAAAATACTTGCCAGGGTCCATAAAAGGAAAAAGTGTGAAGTTGAACCAACAAGTAG
AGAGAACAGGTGACAGATAAAGAAAATGTTTTGGAGACAGAATTGATAAGACTTGGTCAA
CAGACAGGAGATGCAACTTCTCTAATGCTGGAACACTGCCCCTATCACTGTCATCCTGTT
GCTCATCGATTTGCTTGAGTGGGCACCAGTAATGCCTCCATTGTGACATTACTGTTTGTT
ACTGTTCTTGGCATATCGAATACATCATGGGTAGCTTGCCAGGCTCTGCCGTGGGGGTGA
GGTACTCTCCGTAGCTTGCCGGGCTCTCCGAGAGGGGCAGAGGAATCGAACCCGGGTTGG
CCTCTTGCAAGGCGAACCTACCCGCTGCGCTATCGCTCCAGTCCATCCTGGAACACAGGG
GGAGAAATAGATTTTGAGGATAAGGTGATGATGGACATGTTGAAGGGACAGCTTCGGTGA
AAAATTCAAGAGGTGTAGTGCAGAGAGAATGTTGGGACTGGGAACTTTGTGAGAAACTCC
AGTGAAATAATAACTTGAAGTCATTGACATAGAGTGTCACATGGAATCTTGAGTGTGGGG
AAGAGCTCTTGACATTAAAAATAAAGAATTCCTCAAATAACTTGGATAGGACAGGAAAAT
ATATGGCACGACACTTACCTCTTTTGTTCACAGAGAACGGGCACTGTTTAAAAAGGAATG
CCCACAAATGTTACCATGGCAAAACTGGACGGGTCTACAACGTTACCCAATGCTATCCAG
CTTGATCTTTGCATTGTTCTCGTACCAACAAACAAGTCAAGGGCAAGATTCTTGCCAAGA
GAATTCATGCTCCTAGGGAGAACATTAAGCACTCTGAGAATTGAGACAACCTCCTGCAGT
GAGTGAAGGAAAATGATCAGAGAAAGAAAGAAGCCAAAGAGAAAGGGACTTGGGTTCGAT
TGGAGCGCCAGCCCCACTTCCCTCAGAGAAACGCACTTTGTGAGAACCAGTGGGAAGGAG
CCTGATCAGCTGGAAGCCAGTCCCTAGGAATTCATGTCATGAGACGTCTTTTATTTATTT
ATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATGCTTTT
TGGGTCACACCCCGAGATGCACAGGGGTTACTCCTGGCTTATGCACTCAGGAATTACCCC
TGGCAGTGCCCGGGGGACCATATGGGATGCTGGGGATCTAACCAGGGTCGGCCGCGTGCA
AAGCAAATGCCCTCCCCGCTGTGCTATTGCTCCAGCCCTGAGAGATCTTTTTTAAAAAAC
AAAAAGACCTCTGGACTATAAAAACTGTTCTTTTCAGTACAAGTGTCATGTCCTTTATCC
CAAAATATACTTAAAGGAAAAAAAAATGAGCATGGAGGGCAATTCCACAGGAGACGTTGA
CATAATTTGTAAAATTATGTATACACACATATATTTGAATGACTGTGAGATTTACAGTTG
CAAGATAGTGTGACTCAAAAAAGCAAAAAAAAAAAAAGAAAAGAAAGAGAATGTTTATTT
GTTTATTTTTCTAATGTCAGTCATCATGAGCTACCTCTATTTCATCTCTACCTCTTTCTA
AAATACTGGCTTGACTCCAGGCACGTGTGAGATCCCCCAACAAATCATGTACACAGGAGC
CATAGTATAGCAGGTTGGGCACTTCCCTTGCATGCAGCTGACCTGGGTTCAATCCCCGTA
TCCCATAGGATCCCCTGAGCACCACCAGGGATGATAATTCCTGAGTGCAGATCCTGGAGT
AACCCCTGAGTGTCACTGGGTGTGACCCAAACAAATTCCAGCAAAAGTCATCTACATGTT
AATGGATAAGAGCATCCATGCTGGGAATTCTGCTCTGCAATGTCATTTAGGCTGGACTGA
TAGCACAGCGGGTAGGGCATTTGCCTTGCACGCAGCCAACCCGGGTTCGATTCCTCCGTC
CCTCTCAGAGAGCCCAGCAAGCTACCAAGACTATCCTGCCCGCACGGCAGAGCCTGGCAA
GCTCCTGTGGTGTATTCGATAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1060, 1527..1639, 5740..5800, 5804..5818, 5822..5890, 5892..5963, 5967..5981
1001..1060, 1527..1639, 5740..5800, 5804..5818, 5822..5890, 5892..5963, 5967..5978
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved