Sorex_araneus Locus C3orf1
snOPY snoRNA Orthological Gene Database
Sorex_araneus C3orf1
Sorex_araneus
C3orf1
GeneScaffold_237
SNORA5
5334..5466
25802
AATGAAAAAAAGAAAAATATTGTTAAGTGCCGAACAGCTGACCAAATTCCCTAAGTTGG
ATTCTTTTTGAGAAACCGTAGCTTTACGATCTAAAGGGTGCAACTCCATCTTATTAAGAA
CTACCTGAGGGGTTGGAGCGATTGCACAGCGAGTAGGGCGTTTGCCTTGCACGCGAACGC
CTGGCTTCGATTCCCAGCATTCCATAGGGTCCCCTGAGCACCGCCAGGAGTAATTCCTGA
GTGCAGAGGCAGGAGTAACCCCTGTGCATCGCCAGGTGTGAGCCCCCCAAAACAGGAAAA
AACAAAAAACTACCTGAGTTCTGGAAAGGTCGGTGTAAAGGGCATCATCAAGGCGCATTT
TCAAGGGTTTGGTCCTTTCCGAGAACAAACCCCTCACCACCCACCTAGCAGGTGCTTTGG
TACTTGTACAACCGTTTACATTCCTCACTTACATTGCTACTCCCTTTATTTCGGTGCGAC
TGTGTGTGTTCTAAATATACGCTAAATTGGGCTGGAGATTGAGCACAGCGGGCAGGGCGC
TTGCTTGCAAACGGCCGACCCAGGTTCGATACGGCAGCCCCGCCAGGAGTGACCCCGGAG
CACAGGGCGTGAAAACAAGCCCTGAGCACTGCCAGAAATAAACGCGAAACTACTGGAACG
CGAGACCGTTTCGGGTGGCCCAGAACCAAGCCAGCTCAGGAGGCCGGAAGCCACAGGGCA
CAGAGCGCCGAGAGCGTGGGCCCGCAACCCCACTTCCGGGGGGCGGAGATGACCTCGCCG
AGGTCCTTTGCGCGCACAACCGGAACGACTTTGGCTCCGTCCGCCCCCTGACCTTTGTCC
TGCTAGGGGCGGGACTTCCCCCCACGGCCATTGGTAGTCCTGCAGATGGACAGGGCTCCA
AGGTGACAGGCGCCCGTGTCCGCCCGGGCGTCCCCGCTCGCGTTTGCAGAGCTTACTTCC
TGATCGGCGGCGTGGGTTCGCTCCCGGGCTCAGGGAGGGCCATGGAGGCGGCCCGGAAGG
CGCCGGGTGCTTTTCCTCGTGTGTCGGCTGCGGAGCGCCCTGCCGAGGACCAGCAGCTTC
CTTCCTACGTCCCCGAGCCCGGCTTCCCCGAGAGCGGATGGGGCCGCCTCCGGCAGCTGT
TTGTCAAAGAGTAAAAGTGCCCGGGGCCGGGGAGGGCCGGGTGGACGCCCCGGGAGCGCT
GGTTCCTGTGCAGGGCGTTTGGATTCTGGGGGTTGTCTCCTGGCATTGCCATTTGGTAGT
TCTTCCTGTCTGTTGACAGGCTGGTTTCCAAATTGGAAGGGAGACAAACTCAGTGGAACT
TGAAACGCTTAGGGATCTTAAGGGTCCGTACCTTAGAAGCGTTGAGCCCAGTGTCCCATT
GACCCAGAATGAACGTTTGCAGAATTCCACTTCAGAGTTCTTTGGCGTCTTGGTGATGAC
AGTACTCCCAGCCCGCCCCCTCCAGAAATGTAGAGGTTGGAGAGATTGCAGAATTGTAAA
GTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACTTCCGGGGGGCG
GAGATGACCTCGCCGAGGTCCTTTGCGCGCACAACCGGAACGACTTTGGCTCCGTCCGCC
CCCTGACCTTTGTCCTGCTAGGGGCGGGACTTCCCCCCACGGCCATTGGTAGTCCTGCAG
ATGGACAGGGCTCCAAGGTGACAGGCGCCCGTGTCCGCCCGGGCGTCCCCGCTCGCGTTT
GCAGAGCTTACTTCCTGATCGGCGGCGTGGGTTCGCTCCCGGGCTCAGGGAGGGCCATGG
AGGCGGCCCGGAAGGCGCCGGGTGCTTTTCCTCGTGTGTCGGCTGCGGAGCGCCCTGCCG
AGGACCAGCAGCTTCCTTCCTACGTCCCCGAGCCCGGCTTCCCCGAGAGCGGATGGGGCC
GCCTCCGGCAGCTGTTTGTCAAAGAGTAAAAGTGCCCGGGGCCGGGGAGGGCCGGGTGGA
CGCCCCGGGAGCGCTGGTTCCTGTGCAGGGCGTTTGGATTCTGGGGGTTGTCTCCTGGCA
TTGCCATTTGGTAGTTCTTCCTGTCTGTTGACAGGCTGGTTTCCAAATTGGAAGGGAGAC
AAACTCAGTGGAATTTGAAACGCTTAGGGATCTTAAGGGTCCGTACCTTAGAAGCGTTGA
GCCCAGTGTCCCATTGACCCAGAATGAACGTTTGCAGAATTCCACTTCAGAGTTCTTTGG
CGTCTTGGTGATGACAGTACTCCCAGCCCGCCCCCTCCAGAAATGTAGAGGTTGGAGAGA
TTGCAGAATTGTAAAGTTTTTATCCGGTCAAATATGAAATACTGCAATTATTGGCTCGTT
TTAAGAAAATATATCACCCTTACTCACAAGGCTGTTTCTTGAATTAATGTTAAAGAAGAA
TTCTCGGTCATTTCATCTTTCATTGATTATACTAGTTAAAAGTCTACCTTTTCAGGTGTA
GTACTTTGCCATCTTGTGCTTTTATTTTGTGGCTAAATTATGTGCAAGTTTTATTATGTT
GCTGAGATGATTGGGGTAGGGGAGCTAGCAGACTTTTATTTTATTTAGAGTTTATGTCAA
AGATAATGAAGCAGCCTTTCTTGTTGATCCAGCATTTGCTTGAGGTTCCTGTGAAAGATC
CCATGAGTATATCATGGAAGAGACTTGCTTGAATTGTCTTTCCAAACTGTGAAGTGCTGG
AGCTGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGTGCTCAGGGACCGTAT
ATGGCGCCAGGGATCAAAATGGGACAGTGGGAGGAGCAAGTGCTCTACCTTTGTACTATT
TCACTAGCTCTTTGGGTTTTTGTTACTTGCAAGTGGTCTGTGCTGCCCTTCTGATGACAT
TTGCAGTACAGACCCAACTCCATTTGAATCAGGGCCAGAGAGGTGGTACAGTGGATAAGG
AGTGACCCCTGAGCACCACCACATGTGGACCAACCCTCCCACTCCGAACAAAAATGAAAA
AATGAAAAAAAAAAGGAATACTGATTTCTGCATCTGGCTCACAAAAACAATAAACATTGC
CAGGCCTGTTTAGAACAGTTATTGTTATCAGCAATATAATATATATGCAGGAAAAATTGT
GCATTAATATCAGTGAATTTTCAAATCAAGCAGCTGTGTATCCAAACCAAAAAAAAGCAT
TACCAGTATACCCAGGAGACAACTCTTGTGCTCCTCCAAGCTGTTGTCTTCCTAGGCGTA
ACCACTAGCTTACTTTCTCACAGGATAGATTCATATTGGCTGATTCTGAGCACCTGTAAT
ATAACTGCATTAATTTTGTCAGAGGATTTAATCAGTTCTGCCCATGATGAAAAACGTACT
GTTTGGGATAATTATGTTCCTTGGAGAATGTTATCTATAAACTAATTTGAAATAGCTTTT
GTCTCTTTTTGATTTTTTTAGTGAACAGCAAAGAATATCAAAGGAACTTGAGAATATTTA
TAGGGCAGCAGTTTCGGCAGGCATCATTGGCTGGGCCTACGGGGGAATACCAGCTTTCAT
TCATGCGAAACAGCGTTACATTGAGCAGAGCCAAGCAGAAGTTTATCACAACCGGTTTGA
TGCTGTGGTATGTACTATGTTTTAATAGTATTTTGAGGCATCCCCATCTAGTAATTTGTT
CACACTTTATCATTTGTGTAGGAGAGCAAAGAAACAACGTCTGTATTTAATAGTGGGTAA
GGTGCTTGCCTTGCACTCAGCCACTCTGGGTTTGAACCTGGCACTACATACCTGAGTACC
TGAGTACCATCAGGAGTGATCTCTGAGCACAGAGCCAAGTAGAAACCCAGAGCATTGCCA
GGCCATGATCTCCTAAAATAAAAATTGAAAGCCAGAAACAATAATAGTGGAAGTACTAAG
GTTCAAGTGCAGACATCTGGCATGGTGGGCTACTATTTGAAAGGTAGAGCAGGGTGCAGC
TGTGTCAAATTCAGTGCCTGCCCCACCCATGGCAGACACTGGCCCAAAAGGCTGCCACAG
TGAAATGTGACTCATGGGCCCTGATCCCCTACCTGGGCCTCAGGGATAAATTTGGTTACA
GACATTTTAAAAAAGGATCTGCAGTGGCCAGAGAGAGAGTACAAGGGTAGGTAAGACATC
TTGTACACAGCTGGTTCTGGTTTGATCTATGGCGCCACATACAGTCAGTCCCCTGAGCAT
TTGTCAGGTGTGAAGCCTGAGCACTGCTGGTTGGGACCAGAAAACAAAATAGACAACAGT
CACTCGACTTGCTGTTTTTTTGAAATGAACTTTGTTGATTGTTTGGTGTTCAGAGACCAT
GCAGTGCTGGGGATTGAATCTGAACCTCCTTCATGCGAAGCAAGCACTCTCAGTATGTTA
AATTAAAGACGCTCCAGTGTGTTAAGTCCCTCCAGCGTCCTCATTCTTCAAGGCTTAACT
GTAGCCTATTTATCCATTTACAAAACTTGTTGGAAGTAAACTAGCTCACATTAAACCAAA
TAATAACTAACACAACTTTGCAGTTTATAGTGTGCTGACTCATTTGTTATATCTTAGATC
TGCACTTCATTTTTATTGTATTAGCAGAGAAGTAACAGTGGATAGTGCTTTGTTTTGTTT
TAATTGTTAGTTAAAGAAAAGTTGTGGAGGTTGTACAAAGAATTCCTATATAAGATTCAT
CCACCTTATTCAAAGGTTGACATTCTACCCCTCTTGCTCTGTATAATGGATGCTATTATT
TGTGAACTGCTTCTAAATAAGTTATAGACAGGATGAATACTTCCACATGCATTTTCAAAA
AGCAGGTACATTAACTTTTGAAAACTATTATCCAGGTGAGGAAATTGATACACTAACATA
GTACAATGACATACTTCATGTAAATTTTCTAGCTATCCCACGATTTTATTTTTAAAGTAT
ATAAACAATAGCTTTTTTCTTTGTCTTGGTCCAAGGCTAATATTACATCAGATATTCCAA
TTTGCTTATTGAGGCTCAGTTGTCTTTAATCTGGAACAGTGTTTATATCTTTTTAGGCAT
CCATTGATTTTTTTTTTACGACTGTGGCCTGTTTGCTGTAGAAAATGTCGCTCATGTAGA
TTCGTTTGACATTTTCTGTGCTTCGATTTCAGTTCTTTGTTCTGTCAGGAAGACCCTGCA
GTGATGGAAGTTCCCTTGACACTCTCACAGGGGCACATACTCTGTTGACCCTGGACTCGT
GATGTTTATATTAGTCCTGGGTGAAGATGGTCTCTGCTATGATTATCCATTGTAAAATCA
GTTTGTTTCCCTTTTAATTAGTAAGCATTTTAGAGGTACTTCTTAAGTACTTGACGACTA
TGTAAATACCATATTCCCATCAAATCTTTGTGTTAGTTTTATCATTCATCGATGATTTTT
ATTTTATGGGGCTGGGGGGACGGTGTTTAGGCCACACCCTCCGTGCTTCAGGGCTGTTCC
CACCTCTGTGCTTGGAGATTGTTCCCATTGGTGCACAGGAGACTACGTGGTGCTAGGTAC
CCAGTTGGGGTTGGCTGCATGCAGGGTAAGCCTTAACACTGTACTATCTCACCAGCATCT
CACTGATGATTTTTGAGTTATTGTGGTGGTTGTCAGTGGCCTTTTTCTAGTTCCATCGTT
CTGTATTCATCGGTTAGTGCCCAGTGAGAAAGAGCTCTCCTTTCATCTGTATGTGAATCA
TTTATGGCAGTGTGAATTCGTGGATTCTTATCTCTTTTTTTTCATTTGTAATCCATTATT
TCTTTTGATGCACAGATTTTTCGATCTTTGGACCATTGGAGACCCCTCAGGCTGGTTCCT
CTGTCATTTTGATATGCCCCCCAATATTCTTTGAGAATGTCAAAGAGTACATAACACAAT
GTTACTTTTTGGCACACCAAGATACCCTCACTTGTCTTTTAGTTTTTCAGCACCAGTCCG
GGAATTAGCCATTTCATCAGTGAATTCTAATTTATTTCAAAGGAAAATTATATTTAAAAG
CCCTGGTATTTCAAAGATCTGGTATTAGGCTTAATTTTTACCTAGGCAGGGCAGACCTAG
TAGATGTACATACTCCTAGATATATTGCATTTATTTCTATAACTGCCTATATAAAGATAC
CTTACAGAGGGGCTGGAGTGATAGCACAGTGGGTTGGGCATTTGCCTTGCATGCGGCTGA
CCTGGGTTCGAATCCCAGCATCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNG
GTGGAGTTGTCATGGTTAGAAGCCATGTTATCTGAATTTTAAAACACTGCGCCAGAGAAA
CAGTTGTAGAGATTAAAATGAGATAATTTGTTAGCATAACTTTCAGGTAGAATGTTCCTC
ATCTGCTCTTTTCTTGAACATATGTAGAATTCTTACTCTTCACCCTTAAATTTACCATCT
ACTTAGTTCTTAGCATTTTTTATTTTTCCCCAGAATTGAATATAAAAGCCTCTCTGTATA
GATTTTATACTTGCCGGGATGTTTCTCCATGACATAGGTTTTCGGTGTTTAATTGATGGT
TACTTGGGAGACATTGACTTCTTATTTTCCTTTTCATCACCTGATAGAACGGGTGATGTC
ACTTTTGCTTAAGCTTCAGTATGGAATCAGTGCTGTTTCTAGAGATTTTCTGTTTTGTTG
TCCCTGCCTCATCCATAGCTGTCATCCTTCCAGCGGAGTCTTATAATCAAGAAAGTGTCA
AGCACTGGTTTTTGGAAGAAAGCTTGCTACACTGGGGGCTGTGGGGTATCAGATGGAGGG
ACACTGGGGCCAGGGTTGGGGGAGGGGACCTGCTGGAAGGTGCGGTGCTGGAATGTTTTA
TGTGTGAAACCCTATCATCGACAGTATTGTAAATCACAGTGCCTGTCACTGTCATCCCAT
TGCTCATCGATTTGCTCAAGCGGGCACCAGTAACATCTCCATTGTGAGACTTATTACTGT
AACGTTTTTGGCATATTGAATATGCCACGGGTAGCTTGCCAGGCTCTGCCGTGCGGGCGA
CATACTCTCGGTAGCTTGCCTGGCTCTCCGAGAGGGATAGAGGAATCAAACTCAGGTCAG
CCTCGTGCAAGGTGAAATCCCTGCCACTGTGCTATATCCCTCCAGCCCACACAGTGCCTC
AAATAAAATAAAATATTTTTAAAGTCTCAACAGACAAGTTGAGAAATAAGATTTTTTTTC
TTTTTCTTTTTGGGTTACATCCGGTGATGCTCAAGGCTGACTCCTGGCTCTGCACTCTGG
AATCACTCCTGGCAGTGCTTGGGAAACCATATGGGATGCTGGGAACTGAACCTGGGTCGG
CCGCATGCAAGGCAAACGCCCTACCCGCTGTGCTATCACTCCAGCCCTGAGAAATAAGAT
TTTTAAAAAGAATGTCAAGGTGTCTTGAGCCTCACCACCTTCCTCTTGCCCCTAGCAATC
TGCACACCGTGCTGCCACACGCGGCTTCATCCGCTACGGCTGGCGCTGGGGGTGGAGAAC
CACGGTGTTCGTGACCATATTCAAGTAAGTTCTCTGAATTGCCACACACACTTGGGTATT
CTTTTAAGATAACATCTTTCAAATAAGAACGATTATAAGAACTAAGCAGCCACCTGAAAG
AGCTTTATAGCACCCTTTCTACAAGAACCTTAGCTGGCTTTGTAAAAGGCCAGTCCAGTT
GTACTTTTGCATTTGTAGAGGTATCCTACCAACTAATATCAGAATAAACAGATTTCTAAG
TAAATGAATGGATAAAAACATAGTGTGTACATGTATATATGTGTATATATGCAGTGAAAC
ATAGGGGTTGGAGAGATGTAGTACAGCAGGTAGGGTGTTTGCTTTGCACATGCCAATCTG
GGTTGGATCCTGGCATCCCGTATGGTCCCCCAAGCCCGCCAAGGGTGATTCCCAGGTGCC
ATGCCAAGAGTAACTCCTGAGCATTGCCAGGTGTGGCCCTCAGACAACAACAACAAATCA
GTACCTGAATTTTAAAAAGATTTTTTTTTTGTGGGGGGTTTGTTTTGGGGCCACATCCAG
TTGTGCTCAGCACTTACTCCTGGCTCATGTCAGGGATCAGACCCAGATTGGCTGTGTGCA
AGACAAACACCCAATACAGATAAGCTACTGTATTATCATTCTGGCCCCAGTTAAAAAATA
ATTTTAAGAGATATTCTGGAAAACCCCTTCTGTTTCTTCTGTACTTAAGTGAATATTTAA
AAGATGTGATTTTTCTTCTCTTGCTGTCTAGAAAACTGACAGGCATATTAGCCGTCTGGA
CCGCATTGAGTGTACTGGATTGAGGGGCTGGAGTGGGGCTGCAGTGGGGAACTGCGCACC
CTACACTCACCAACCCTGGTTCGATTCCTAGCCTGCCAGGAGTGATCCCTGAGCACCACT
GAAAGTCTCTGGATTACAATCAGGAGTAGGGACCACCTTAGTTGGCTCCTCTACCCTGTC
CTGTCGCTTGAGTTAAATTTACATTCAGGAGGAGAAATGGGATTTCTTTAATGTGTGATT
TTCCCCTCTCTTCACAGCACAGTGAACACTGGCCTAACTGTATACAGAAATAAGAATGCC
CTCAGCCATTTTGTCGTGGCAGGAGGTAATTTATTTTTATTCTTGTTTATATTTCCAATC
TTTCTCAACATATAAGATGTACAGAATCCTTGGGATGGTTTCTCAGCATTCATGCAAGTT
GTATGGTTCTTGCTGTATTTAGTAAACAAACAGAAAAGGTAATCGATTTCCTGGAATTTT
TTTATTTGTGCCAGGCCTGGTGGTACTCAGGGCTCACTCCTGGCTCTGTGCTCAGGGATC
GCTCCTGGTGGTGCTCAGGGGACCAAACGGGGTGCCTGGAACCAAACCCAGATTGGCCAT
GAGCCAGGCAAGCACCCTACCTGCTTAACCTTGATTTCTTGGAATATTTTGAATTGAATA
TGGATGGGAAAAAATAGGTTGGTAGGTCAATTTTTATTGGTATTTTTATTGGCATCTCAT
TGTGATTTTTATTTTTCTCTAATAGTGATGGTGAGTATCCTTTCTGCTTTCCGGTCAGTT
TTGGATCTTCCTTGGAGAAATGCTTAAGTCCTTTCTCTTGGTTTCCTTCAGTAACAGCAG
TGGAGCAAGGGGCCTCATGGGGTGGTGGTGATCAGAGGTGTGCAGAGAAGGCCTTTCGGA
GACGAAGAATGGAAAATAGCAAACCTGCGAGGAAAAGTAATGTGGGCAGGGAATGTCAGG
GAAGGGTTCTTAGTCCAGAAAGCTCTTCAAAAGCAGAGAACTAGGGCTTGCGTGGGTGAG
GGGAAGAGCGGTGTGGAACAGGGCTGGGCAGGAAAAGTAGGAAAGGGCCAGTGTTTTCAT
AGCAAGAGTCTGAGGTTTGCTTTAAAGAGCTCTGGCTCTGGTAGATATGCCCTTTCTTAA
AAGGCAGCAGGAGAGATAGTGGTGGGGGGGGCAGGGGGGAGGTGTAGAATGTTTGCCTTG
AATGGCCAACCTAAGTTTGTTCCCTGGCATCTCATATTGTTCCCCAGAGCACCACCAGGA
GTCCTTGAGCCTTGCCCGGTGTGACCCAAAACCAAAACAATACAAAACAAAAGGTAGGGC
TGGAGTGATAGCACAATGGGCAGGGCGTTTGCCTTGCATATGGCCGACCCGGGTTTAATT
CCCAGCATCTCATATGGTCTCCCAAGCGCTGCCAGGAGTAATTCCTCAGTGCATGAGCCT
GTGTGTGACCCAAAAAGCAAAAAAAAAAAAAACCAAACAAAAAAAAAAGGTAGCATCAAA
AGGAGTATCAAAAAGTGTTACTTCCAGGGGGCTGGAGTGATAGCATAGCGGGTAGGGCGT
TTGCCTTGCATGCGGCCAACCCGGGTTCAAATCCCAGCATCCCATATGGTCCCCTGAGCA
CCACCAGGAGTAATTCCTGAGTGCAGAGCCAGGAGTAAGCCCTGTGCAGAGCCAGGTGTG
ACCCAAAAACCAAAAAAAAAAAAAAAAAGGGGTTACTTCTAGAAATATAAATGATAAATA
TCAATAACCATATAAGTGGTTAATTTCATTTATATTTAACAGCTAAGATGTTAAATATAA
ATGAAATTAACCATTTAAGTATTGAAAGTGTTATTTCTAAGAAGTATAAATGATGTTAAA
TGCACACAAACCTGCGACTCTTGTGCATTGTCTTGCATACAAACATGCACATGTACTGCT
TATGACTTTTCTCTCTCTCTTTTTTTAAATTAAATCACAGTGAGATACATGCAAGATAGA
TTTTATTGAATGAAATTTCCTTAGATGTTAGGGGAGAGAAAGAGAGGAATATGTGCTCAG
GAGAGAACACAGCCTTCTCCAGAGTGAAAAACAACCAGAAGAGAGTGATTTGGGGCCAGA
GTGATAGGACAGCAGGGAGGGCGTTTTCCTTGCATGCGGCCGACCCAGGTTCGATCCCCA
GCATTTCATATGGTCCCCCAAGCAGCACGAGGGGTAATTCCTGAGTGCAGAGCCAGGAGT
AACCCCTGAGCATTGCTGGCTGTGACCTGAAAAGCAAAAAAAAAAAAAAAAAGGAGAGAG
ATTTGTGTTCAGGGGAGAACAGGAGCTTGAAAGAGCAAGCCTTTGTTTTTTTAAAAAAAA
AAAAAAAACACTTGAAAATAGGGCTTTAAAGAGACAGTACAATGAGTAGGGCACTTGCCT
TGCATACAGCCAACCTGGGTTTGATCCCCAGCATTCCATATAGTCCCCCAAGCATGACCA
GGAGTGATTCCTGAATGTAGAGCCAGGAGTAAGCTATGAACATTGCTGGGTATGGCCACA
ACACAAAACAAAAACAAAATTTGGAGATAACTTAAAGCTGGAAGTTGGAAAAATAAGTCA
GACAAGGGGTGCCATATTTCCTTCAAATACAGAAATACAGCTGTTGCTAATAGCACAGTT
CCCTCATTTGTGCTTTTGTGAGTGTTCTCTCTCTGTATCTGTATACACATATGCATACTG
TGAATTTACATTTTACTGAAACATTAAAAGTTATAAAACTAGAAATAAACATTAATAGCG
CAGGAGCAGCTGGAACTTGCCCATTTTAATTCATAAACTTTTTTACTTTTACTAAGTATT
CCATATTCTCAAATGTTGATACGCAGACTAAACTCTTCTCTTCTCTACTCCTTTCCTTGG
TTCTGCTTTTCTGTTTTCTATCATCTGTCCCATTAAAGAAACAAACAGCTGGAGAGAACA
CAGGTGTTCGCGCACTTGTCTTGCATGTAGCTGATGTAGCTCATGTGCTACTTGTTCTAG
CTTTATGTGTCTACTTAGATTTCCCAAGCCCAGCATATTCCTTCTTTACATTTATTGGCC
TCTCTTTTTTGTTTGTTTTGGGGTCATGCCCAGTGGTTCTCAGGAGTCACTCCTAGGGGA
GAATGAGTGGTGCTGGGATTGAACCAGAGTCAGTCTTGTGCAAGGAAAGCACTTAAAGCT
CTGTACTTATCTCTCTGGCTCTGCAATACAGATTTTTGTCTCACATACCAATGATCAACA
TTGAACATAATACATAATGTTAAAACATTAAGGTAGGGGCCCAGAGCTTATGTGATTAGA
TCAATACTTTATTTAAAAAAAAAAAGAAGAAGAACATTAAGTTTCCCTGGGCTGGAGCAG
TAGTTTGGTAAGACACTTCCATTGCACATTACTTACCTAGGTTTGATCCCTGGCACCACA
CATGGTTCCTCAGCACTGCCAGGAGTGACCTCTGAGCACAAACCAGGTCTAAGCCCTGAG
CACATTCAGGTATGGCCCACACACAACAAACCCCCCCCCCAAAAGAAAAATCNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCTGCGGCATTTCATCCTGTCAC
TCGCACCTCAGCAGCATGAGGCAAAGTTTCACCTTAGCAGTGAGACTGAATCAGCAGCAG
TTTTGCTGCTCCGGGCGGCTGACTTTTTTTTTTGAGCAGAGCATGAGAATTCCATGCCTT
CCACCTCAGTTTCCACTGTCAGTGCTGGTTTTTCCACCCATCAGAGCTGGTCACTGATCC
TATAGAATATTCTTTTCCTTGCCCTGCAGGGTCCGGTCAGTCAACAGTAACAGTGGCAAC
TGTAGGAGCACTTGGCATTATCTAGTGACCCCGGTTTAGGCTATTCTAATAGTTTTGCTT
TTGTTTTCGTGGCTCCAGCGGTCAGACTCAAACCCTTACGCCTGCACCCTCCAGCCAGGC
CACGTCTCCAGTCCCTGTCCTAATAGGTTTTTTGAAAACATTTTGTTCGGGAAAGAACAC
TAGAAACGTAACACCAAATCTAGTATTGTTCTGGGCAATACATTTAAAGATGATTTTCTT
TTTGTGGTTCTTGTTAATTTAGGAAGTTAAAAATATGAGTATGTAATATATAACTATTAA
GTAAATCACAAATACTGTGTTTTAAAAAATATTGCCCCCCAAGATAGCCATTATTTGTAT
TGTACATAGTGAGAAAAAAAAATAAGAACAGATGGAAGACATGAAATTTGCTGATACATG
GATCGATCTGGAAAATATTCTGCTGAGTGAAATAAGTTAGAGGGAGAGGACAGACACAGA
ATCATGGCACTTGTTTGTGAGATATAAGGGGACTTAGCAGGATATTATTGCCTAAAGATC
GTAGAAATATGAAAGGCAGGGGAACTGTCCTTTGTAGGAAGCTTGTCTCAGTGGGGGTGG
GAGGTTAGGACAGGAAACAGATCCCTACAGCAAGGACAGGGGGAAGTGGCCCCTCTGGTG
AGAACTGGGTGGTGAAAGGTGGTGAGTGGTATGCACGGTCCGCTTGCAGTCACCATATTC
GAACGCACAGTGCCTGTCATAGAGGCCCCTGGGCTGGGAGGGAAACTGGGNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNGAAAAAACCGGGAGTGCCCAAAAACAGATGACTGGTTA
AAGAAACTTTGGTACATCTACACAATGCAATACCTCCGCAGCTGTTAGAAAAGATGAAAG
TCATGAAATTTGCCTATAAGTGGAACAACATGGGAGTGTCATGTTGAGTGAAATGAGTCA
GAATGAAAGAGACAGACATAGAAAGATCACACTCATATGTGGAATATAAAGTAGCAGAAT
GAGACACTAACACCCAAGAGTGGTAGAGATTAGAACCAGGAGGTCTGCCCCACAGCTTGG
AAACTGGCCTCACATGCTGGGGTAAAGGCAGCAGAGCCAGAGTAGGGAACACCTAGTAGA
GAGTATTGGAAGGACCCACTCGGGTTGAAAGCCGAGTACCAAAAGTGGACTATAGACTGA
ACAGGATGGCCACTCAATACCTCTATTGCAAACTACAACACCCAACAAGAGAGAGAACAA
AAGGGAATGCCCTGCCACAGAGGCAGGGTGGGGTGGTGGGGGTTGGGGTGGGGGTGGTGG
GAGGGATACAGGGAACATTGGTGGAGGAAAATGGGCACTGGTGGAGGGATGTAAACCAAA
TACAAACATGAGAGTTCATAAGTTTGTAACTGTACCCCACAGTGATTTACTAATAAAAAT
TTAAGAAAAAAAACAAAAGCACAACAACTTTAAAAAAAAAAACACCCTGGTTGTACTTTT
CTGGTGAGAAGAAATGAGGAGCCAGCTGCTGGCCAGCAGGGGGCACTGTAGGCCTGTGTC
TTCATGGAAAGGAGCCGGTCCAGCAGGGAGGCTGCAGGGGCCACTGGCTGGGTCTGTCGC
TTCCTCCTGGACAGGCAGCTCCAGGTCGGGCGGGCTGCACAGTTGGTAGTGTGTGCAGGT
GCCGGCACCCTCCCAGGGGCACCTGCAAGCACAGCATGCCAGATCCATATCTAAGGGAGT
GAGCCCGTGGCTGACAGCAGGCAGAAAGGACGGGAAGGGAGGAGGCGCTAAAGAAACGTC
TAAGAAGGCGAAATAAGAAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NCAGGAGTAATTCCTGAGTGCAGAGCCAGGAGTAAGCCCTGTGCAGAGCCAGGTGTGACC
CAAAAACCAAAAAAAAAAAAAAAAAAGTGTTACTTCCAGAAATATAAATGATAAATATAA
ATAACCATATAAGTGGTTAATTTCATTTATATTTAACATCTTAGCTGTTAAATATAAATG
AAATTAACCATTTAAGTATTGAAAGTGTTATTTCTAAGAAGTATAAATGATGTTAAATGC
ACACAAACCTGCGACTCTTGTGCATTGTCTTGCATACAAACATGCACATGTACTGCTTAT
AACTTTTCTCTCTCTCTTTTTTTAAATTAAATCACAGTGAGATACATGCAAGATAGATTT
TATTGAATGAAATTTCCTTAGATGTTAGGGGAGAGAAAGAGAGGAATATGTGCTCAGGAG
AGAACACGGCCTTCTGCAGAGTGAAAAACAACCAGAAGAGAGTGATTTGGGGCCAGAGTG
ATAGGACAGCAGGGAGGGCGTTGTCCTTGCATGCGGCCGACCCAGGTTCGATCCCCAGCA
TTTCATATGGTCCCCCAAGCACCACGAGGGGTAATTCCTGAGTGCAGAGCCAGGAGTAAC
CCCTGAGCATTGCTGGCTGTGACCTGAAAAGCAAAAAAAAAAAAAAAGGAGAGAGATTTG
TGTTCAGGGGAGAACAGGAGCTTGAAAGAGCAAGCCTTTGTTTTTTTTTTTTAAAAAAAA
AAAAACCCTTGAAAATAGGGCTTTAAAGAGACAGTACAATGGGTAGGGCACTTGCCTTGC
ATACAGCCAACCTGGGTTTGATCCCCAGCATCCCATATGGTCCCCCAAGCATGACCAGGA
GTGATTCCTGAATGTAGAGCCAGGAGTAAGCTATGAACATTGCTGGGTATGGCCACAACA
CAAAACAAAAACAAAATTTGGAGATAACTTAAAGCTGGAAGTTGGAAAAATAAGTCAGAC
AAGGGGTGCCATATTTCCTTCAAATACAGAAATACAGCTGTTGCTAATAGCACAGTTCCC
TCATTTGTGCTTTTGTGAGTGTTCTCTCTCTGTATCTGTATACACATATGCATACTGTGA
ATTTACATTTTACTGAAACATTAAAAGTTATAAAACTAGAAATAAACATTAATAGCGCAG
GAGCAGCTGGAACTTGCCCATTTTAATTCATAAACTTTTTTACTTTTACTAAGTATTCCA
TATTCTCAAATGTTGATACGCAGACTAAACTCTTCTCTTCTCTACTCCTTTCCTTGGTTC
TGCTTTTCTGTTTTCTATCATCTGTCCCATTAAAGAAACAAACAGCTGGAGAGAACACAG
GTGTTCGCGCACTTGTCTTGCATGTAGCTGATGTAGCTCATGTGCTACTTGTTCTAGCTT
TATGTGTCTACTTAGATTTCCCAAGCCCAGCATATTCCTTCTTTACATTTATTGGCCTCT
GTTTTTTGTTTGTTTTGGGGTCATGCCCAGTGGTTCTCAGGAGTCACTCCTAGGGGAGAA
TGAGTGGTGCTGGGATTGAACCAGAGTCAGTCTTGTGCAAGGAAAGCACTTAAAGCTCTG
TACTTATCTCTCTGGCTCTGCAATACAGATTTTTGTCTCACATACCAATGATCAACATTG
AACATAATACATAATGTTAAAACATTAAGGTAGGGGCCCAGAGCTTATGTGATTAGATCA
ATACTTTATTTAAAAAAAAAAAGAAGAAGAACATTAAGTTTCCCTGGGCTGGAGCAGTAG
TTTGGTAAGACACTTCCATTGCACATTACTTACCTAGGTTTGATCCCTGGCACCACACAT
GGTTCCTCAGCACTGCCAGGAGTGACCTCTGAGCACAAACCAGGTCTAAGCCCTGAGCAC
ATTCAGGTATGGCCCACACACAACAAACCCCCCCCCCAAAAGAAAAATCCCACAAACAAA
AACCAACAATGAAACAGCAGAATTATCTATAACAACCATTTGAAGGTGCTGAAAATTGAC
CAAGGGCTCTCAGCACAATTAGAAGTGAGCATTAAAGAATTGCTGCTGAATTCTGGTGAG
AACAGTAGGAGCCTGCGGCATTTCATCCTGGTCACTCGCACCTCAGCAGCATGAGGCAAA
GTTTCACCTTAGCAGTGGAGACTGGAATCAGCAGCAGTTTTGCTGCTCCGGGCGGCTGAC
TTTTTTTTTTTTGAGCAGAGCATGGGAATTCCATGCCTTCCACCTCAGTTTCCACTGTCA
GTGCTGGGTTTTCCACCCATCAGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATACAAACATGAGA
GTTCATAAGTTTGTAACTGTACCCCACAGTGATTTACTAATAAAAATTTAAGAAAAAAAA
CAAAAGCACAACAACTTTAAAAAAAAAAACACCCTGGTTGTACTTTTCTGGTGAGAAGAA
ATGAGGAGCCAGCTGCTGGCCAGCAGGGGGCACTGTAGGCCTGTGTCTTCATGGAAAGGA
GCCGGTCCAGCAGGGAGGCTGCAGGGGCCACTGGCTGGGTCTGTCGCTTCCTCCTGGACA
GGCAGCTCCAGGTCGGGCGGGCTGCACAGTTGGTAGTGTGTGCAGGTGCCGGCACCCTCC
CAGGGGCACCTGCAAGCACAGCATGCCAGATCCATATCTAAGGGAGTGAGCCCGTGGCTG
ACAGCAGGCAGAAAGGACGGGAAGGGAGGAGGCGCTAAAGAAACGTCTAAGAAGGCGAAA
TAAGAAATTATGGAAACTTTCAATAGGGGCAAATGAAACAGAATGAGAGTTTCCCTTCAC
AGTAAACACCAAAGCACTGCCTTATCAAGGAACTTATCTTCTTTTCAGACTGTAGCGTGC
GTGACGGCTGCTGGCTTTCCTTAGCTTTCAGATTCAGAACAGCCAAGTTGTGAGATATAC
ACACACACACACACACATCTGTGTATGTGTGTATATAAGTATATAGTGTGTGTGTATTGC
TTTTTGAGCCACACTGGTGTTGCTGGCGTCTTATTTCCGGCTCAGGAATCACTCTTGGTA
GTGGTGGGGATTGAACCTGGGTTGGCTGTGTATAGGCCAAACACCTTCACTCTGTCTCTG
GTCCCTGTGGCATAGTAATGTTAGGATCATAAGGCTTATTTAGAGTGACGTAGCTCAGTG
GTATGGCTCAGTGGTGTAGCTCAGGGTAGAGAACGTGCCTTATCTGAGGCCCTGAATTTG
GTCCTCAATACCAACCAAAACCACTCCCCCAAAGAGAAAGCTTACTTATCTTAATGTATG
TTCTTTCTATGGAAGGAATTATTTTTAAATGGAATTCTAGTGTTTCTTTAAAGAATTTAA
TATTCCTGGTTTTGTGTCTTTGTTTATAATAGCCGTCACAGGAAGCCTTTTTAGAATAAA
CCTAGGCCTGCGAGGCCTGGTTGCTGGCGGCATAATTGGAGGCTTGCTAGGGTAAGTGAT
GATGTGGCTTGGTTCTAAATTAACACAGCATTCATTAAGGTTGTGCCTGTCTAGGAAAAA
AATCTAATTTCTGTTTAAGAAAAAATTTAACTTTTAGCTCAAATTAAGTTCTCTAGTCTG
TCTTGGTAGTGGCTTAAACGGTCCTTTTTGAATTCTTACCCTGTTGTTGATTTTTCTTCA
TTTTTTACTGGCTAAAAACAGCATAAATATCACTAGCACCTAAAAATATTTGTAATTTGA
ATAAAGGGACTTATGAGGAGCAGGAAAAAAAGGATAAGAAACAAAAACACTCTATTTTTT
TATTATTATTGATTGAGGTCCTGTGACTTACAATGCTTTAATATGATTCCTCATGCACAT
AATTCCAACAGCACACCCCATTACCAGTGTACCCACCACCTTCCCCCAAGCAGCCCAGTT
CATTTCCCTTAAGTACTTTATGTTTTTACACATTGGATGGGTTTTGTTTAACTTAATAAG
TTAATGAAATTTTCTTATTTTGAAAAACTTACAACTGACAGAAAAGTTGATTGAATCAGT
GTGTTGAGGATCCATCTCCATCATATTCATTTGCTGTTACTCACTTGCTCATCGTATATG
TGTAGAATGTATCTAAATTTCTTTCTCTTTTTTGATAAAGTTATTTGAGACCTTATAAGG
TGTTACTCTTAAGTACATTGTCATGTCTTTCCCAGAATGAAGAATATTCTACAATGATAA
TTTAGTAGTATTGATTCACTGTAACTTTCTAAGATAAGGTGCATATTAAAAAGTTTTCGG
CTATTAAAATAGTGCCACATACATATATGTATATGAGGCTAAAGAGATACTACAGGGGTT
AAGGCCCTTTCCTTGCATGATCTCTGGTAGCACATATGATCCCTGGGGTATGTCAGGAAT
GATCCCTGTGTATAGAGTCAAGAGTGAGCCCTGAGCACTGCTGGGTGTGGGACACTCCTC
TTCCCTGCAGTTTTTTAAAATGTGGGATCCAGTTTTATATTGCATTTGATTATATCTCTT
TGTTTTGATTTCGGGGGCCACATGTGGTGACTTGGGAAGCCACTGTGTGTAGTTTAAATA
TTTCTCAATTGTTTTTTGAGTATTCTTTCATAGTTAGACTTAAATGGTTCTTGTTTTGTT
TTGTTTGGGGTTTTGTTTTTTTGGTTTTTGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAATTTAGCTGGGCTATTTTAGC
TCGAGCCCTGGGGAAGAACCTGCTACAGACATCCTGGATGTGACGTAGTCCTGTGATATT
TGGTGTGAAGTGCCCATTTCCTTTCCCTGCACTTTCCTACCTCCTTTTTAGAGAGCTGTG
TTACTGGATTTCTTTAAACAAACAAACAAACAAACTCTGCCATAATCCATTGCAGACATT
TTGAGAATAAGCCTACTTGGTTTTCAGGGAGAAATTGTTGAAATGAGCAGCTTTATTTTT
GTCATTGTGGTGACAGAGCACAGCATAAAATTGACTGTCTTCAGCATTTTCAGGTGTCCA
GTTTAGTAGTGTTCAGTGTATTTGCCTGGGGCTCACCTCGCGCTTCGCCCTATGTGCTTT
ATGTTAAATGCCGTGTGCTTTCTGCATATGACAGGCTCTTTTGGTCAGAGCTGTACTGTG
TACACCGTATCTGCCTCGTTGTTGTCTGTATACATGATGGAAATTCCTTACTTAACAAAG
TAATTTTTCAGGTGAGATTATTTCGATTGTAAGCAGAGATGGTTTAAGTTTTATGAAAGT
CAAAAAAAAGTCATTCTCTCTGAGAACCAAATCCTATTCATTAACTTTTTGGATTGTTAT
CTGTGTCAGTTTCTCAATGGGTAACTATTGACATTGTGGGTGTGGTGATTGCTCTGGACT
CTTAAGTTTCAGGTTATTTGGTAACTATCCCACACCCTCACCCCAAAGCCAATAGTGCCC
GGCTTCTAATAGGGTTCCTCAGAGTGGGCAATGCTAGCCCCTGGTGGGGGCACCACAGTG
AGGTACCCTGGGGGGAGGGATGTGTCTTCTGTTTCTGCATTTAAAGAAGGCAGAGTTCCA
GATGAGAACTGCAGGATTTTTCTTTTTTTCCTGTAAAGGGTGTGACAGAAGTCTGGGAAC
CTTTGCAGTCTGAACAAAACCTCTATGGCCTGCCACATTCATAGTATTCATTTAATTTCT
CAGAAATCTTCCGTATAAAGCTACCAGAACTTGTCCTTAATATGATTTTTCATAGTTTAT
TTCTCACTCATAGTGATTTTTTGAAAAGCCAATTATTATATTTGCTGTTTTTACAACCAG
CTAATTTTTATGAAGTTGCACCAATTATTTTTCTAAAATTTTCAGACCAGGAAAGAAATC
GCCTTAATATATTTCTTCTTCTTTTTTGTTTGTTTTTTGGGGCCACACTTAACAGTGCTC
AGTGATTGCTCCCCCCTCTGTCCTCAGGGGACTGTGAGGTACCAGGAAGAAGACCTAGAC
CTTCTGCATGCAGAGCGTGTGCTCAGCCTGTTACGCTCTCTCTTCAGCGCACCGTATGTT
CTTTTGTTCAGCAAGGCCCCTGTGGTTGTCACATACGTTCCTCTCTAGTTGTTGATGGAT
CAGTTACTTAGTAGGCATTGCTCAGTCCTTAGCAGAGGCAGGGAGTGTTGCTGGTCTGGT
TACTCAGTGACTAACGTCCCCTTTGCTTCCCCTCAGCACTCCTGTCGGAGGCCTGTTGAT
GGCCCTTCAGAGGTACTATGGTGAGACCACTCAGGAGAGGAAGCAGAAGGACCAGAGAGC
ACTGCATGAGCTGAAGCTGCAGGAATGGTGAGTAGGGTGTCCGCTATGGTCAGGGGGTCA
GAACTTGAAAAAGAGTTGACTTTTCTACTGAGTCCTTCAACTTGTACCACGTACCAACTT
TTAAATGAAGATATATAAGAAAATGGACTGGAGCGATAGCACAGCGGGTAGGGCATTTGC
CTGGCACGTGGCCGAACCGGGTTCAATTCTTCCGTGGCATATTTAATATGCCAAAAACAG
TAACAACAAATCTCTAAATGGAGACATTACTGGTGCCCGCTGGAGCAAATACATGAGCAG
CAGGTGACAATGCTGCGACAATGCTGCAGTGCTCCATATAGGAAAATAAAAGGCACTAAT
TTGATTTTTCATATGATCACATGAGACTCTTCCCTTTGGAATCTTTTTCAAAGTTAAATT
GTAGTAAATCTTGGGGTTGGAGCAATAGTAGGGCTATTTTCCTTAGAATTATATGCAGTC
AAAAAAAACAAAAAAAATATGCAGCCAAGTGAGATTTACTACAATTTATTTATTTTTATT
TATTTTACTTTAATTTTTTGCTTTTTGGTCACACCTGTGACCCAAAAAAAATTTTTTTTA
AAAGTAAAGCAAAAGAGTAGTACACGATATATTCTTTCTCATCTGATTACAGGAAAGCAA
GATTGCAATTTACAGAGCTCCTCCCTGGAGAAATTGAAAGTAACTTACAGAAAGATAAAT
CCAAGGAAGATGCTGAGAAAATTGAAGCCCTGCTAAATCTTCCTAGAAATCCTTCGTCAA
CCAATAAGCAAGACAAAGACTGAAAAGGTCCTGAGCCTTGGAAAGTTGTTGGATGTTGGA
GCGCTGTATTGCCATGCAGTACCATTGCCTGATGACATCTGTCACTGCTGGCACCTGGGC
AGGCAGTGATTTTTCCTTTTTCAGTTTTGTTTTCTGACTAAGACTTGGGCTGTTGTACAT
TCATACATTTAAATACATATTTACATGTATTGGTCTGTTTCCCATGTCTATACTGGTGGA
TAAATATGTGTTTCTATGGGCTGTTTATTTGTTATTTTCTTGGGGTCAGGGAGACACCTC
AGTGATACTCCTCCACATGATACTCTGCCACCATGCTACCAGTTCAGTGCTTAGGCCTGA
TGATACAGTGCTTCTCGGGCATTATAGTGTTGGGGACTGCCAAGGCCACATCTGGTGATG
CTGGGTGGGCCTGCAGGCCAGTATACAGTGATGGGTGGGAGGCCAAGTGTTCTCCACACT
ATTTCCCCAGCCCTGTTTCTTGGTCACTTTGTGAAAGGCTCCATGATTTCTGTGAAAGGG
TACTCTAGGGAATAAAGAACAAACTAGGTAAGACAGTCTTTGTGACCCTTGTACCCTTAG
GTCCTGGTAACAGTGGAAGGGTGAGGCGCTAAATGTGTAGGAAGGTGTAGTTTGGTTTTA
CTACAGACCAAAGATCATTCTACAGGGTCCGAGCAATTGTACGGCGGGGAGGGCGTTGCC
TTGCATGAGGCCAATCTGGCTTTGATCCCCGACATCCATATGNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1024, 1027..1032, 1034..1149, 4821..4986, 8995..9083, 10097..10164, 20792..20870, 23916..24026, 24652..24802
1001..1024, 1027..1032, 1034..1149, 4821..4986, 8995..9083, 10097..10164, 20792..20870, 23916..24026, 24652..24799
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved