Sorex_araneus Locus ENSSARG00000007896
snOPY snoRNA Orthological Gene Database
Sorex_araneus ENSSARG00000007896
Sorex_araneus
ENSSARG00000007896
GeneScaffold_2201
SNORA9
11696..11827
15618
GATTCCAGCTACACCAGTTAGCCACAAAATTGTCAATCGTTTATGAGACGTGCATAGCG
ATTCCTATTTCAGATGACAGCTGTAAGAATAAAGTGCAAACAAAATGCCTAGCTTGCTCA
AGAAACGTGAGTTGAAATTAAATGACTTGTGGCCAATACAAAAAGACCTGAGTCCTGTGT
CTGATATGATGGGTAGAAAGGCAGGTCCGCACGGAGGTCTCCCGCCCCGCACCCTAAATA
TACAGAGATGCAGCGTCCTGAGACTGAATGGTCCCTCCAAGGTGTCGGCTCTGCCAAAAC
TCGCTCTCCAAACCGAAGCGCTTCAGCCTGTTCCGGAAACCCTCCCAGTGCCCCGATACA
CGGCCATTGTGAAAAAAGACAGTTCTACCCGCCAGTCTCAGGTCACAAGGACCAGATTCG
GAGCAGAGAATCTGGGTAGCGGCCTCTCTACTCGAGACTAAGCTGTCGTCGGGACCACTG
CCAAGCCCCGGGGTCATGCATTCGGGGCCATTCCTTTCCTTGGTCCAGAACCCAACCGTG
GACGTGGGGCCCGCCCGCGCAGGCTGCAGCCTCATGAAAGTCACGTTCTCTCTGCGCGTC
CTCTCGGGTACTCTATGGTTCTCGTGGTGACTCTACTCTAGTTCTAGTTCCGGTCTCTAT
GGCGGCGGCGGAGGCAGGAACGGTTGTAGGTCGGCCGAATTAGCCGCCTGTGGACCAATG
AGGATGTGAGAGTGATAAAGCGAGAGCCAATAAGGGTCAGAGATTGAGGTCAGGTGGTGA
GATTGGCAGCACTGTTGGCCAGTGAGCGGCGCCGAGGGCGGGCCGATCGAAGGGCTTATC
CCGCCTGTCCCGCCATTCTCGCTAGTTCGATCGGTAGCGGGAGCGGAGAGCGGACCCCAG
AGAGCCCTGAGCAGCCCCACCGCCGCCGCCGGCCTAGTTACCATCACACCCCGGGAGGAG
CCGCAGCTGCCGCAGCCGGCCCAGTCACCATCACCGCAACCATGAGCAGCGAGGCTCAGA
TCCCGTAGTTGCTCCCATTCCCCTGTTTTGTTTCTTTCTCTTCCCCTTNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNATAGAATTTATTATTTCTGGGTAATTAGGATAAATTCTGGG
AGGAATTCCTTGTTTCTCCTTGGCTGAGTTTGTAAGCTAGTTAATGTGACTAGAATTAGC
CCTCTAGAAATTTTGCTTTATTATAAAAAGCAGCTTACCTGTTAACTACTGTTGAAATGG
TAGGGAGATCATCAATGAGTTCAGACAAAATTCTGAACACAAAATTTTTCAGGCTGTGAA
ATCAGCCTGAAAAATCAGCCAACTGGTTTTCATTCCCAGAACCCCATATGATCCCTGAGC
AGTACCAGAAGTGATTCCTTAATTCAGACAAAGGCATAACCCCTGCGTGTCACCAGGTGT
GTGTGGCCCAGAAACAACCAAAGAAAAAGGGTTTTTATTACACCATACCTAAGATGGTGC
ATATGGTGCTGGCTGATTAAACTCTGTCCTGTGTTTTATCATAAGTCTTGATAAGGAATG
TGCAAGAGTCTTTGACCCTGCAGAGCCTGAAATGTTTATGCCTGCTTGTAAGTTTGTAGA
CCTGTAAGATCATTCACCAAATCTAGTGAACAGTTGAAATCAGACTAATTTGGGGGGTGT
GGGAAGTTGGGCACTTCCTGGTGATGGTGGTGGACTTTGAGCTATCTCTCTGGCCCATAC
TTCCATTATTTTTTGCCTTTTTGTGTCACACTAACGTCCAGCTCTGCACTCAGGAATTAC
TCCTGGCGGTGCTTGGGGGACCATATGGGATGCAGAGGAACAAACCCAGGCCAGCCTGTG
CAAGGTAAACACCCTGCTCACTGTACTTGGCTCCAGGTCCGGGACTAATCTTTTCAGGAG
GAAGAGTGGACCTCACCAGACTGCTGAGCACAAGTTGTGCTCAGAGGGGAAGATGCAGTG
CTGGAATCAAACCCAAAGCCTCACATACGCATGGCAGGTCTCTGCTCTGAGCTACATCCC
TAGCCTCAATGTTAAATTTCATAGGAAGGACTTAGGGAGGTCTTTGAATTTGATAACATT
TATTATAGACCTGGTGGCTATTGGAGGTTATGGGGAAAAAAACAATCAATTGAAAGAATA
GGATTTCAGGAGCTGGAGTGATAGTACAGTGGGTAAGGGCGTTTGCCTTGCATGCTGCTG
ACCCGGGTTCAATTCCCAGCATCCCATATGATCAGTCCCCTGTGCATTGCTGGGTGTGAC
CCAAAAAGAAAGAAAAAAGTAGAACAGGATTTGAAAAAATGTTATGGAATGGAGGGGTGT
ACGAGGTGGGGATGGGGGGGTGTGAGGCACATAACCTTGTAACGCAACAGGTCCATTTAC
ATCCCCTGACCACATATGGTCTCAGGGAGCAGCCACTGAGAACTGTAGGGTGTGGCCCAA
TCCATACCCCTAAAAAATTTAAAGTGGTGATAATTACATTTTAATTTGAAAAGCTGGCCT
CCAGTATTAAGTGAGAAGTATGCACTCAGTAAGCGTAAAAAGATTTAATTGAGCATGTAA
ACCATGTTTCTACAGTAATGGTTTGCTGGGTGCTAAAAGAAATAGATTCTGTCCTCAATG
ACTTACCTTTAATGGGGAGGAGCTCATAAACGAGTCTTTCCTGTCTATAAATACTTGCAA
CTCCAATAAAGTATGATAATAGAGCAGGAGTGTGCCTTTGGATTCCGAAGATACTTTGCA
AAAGGGTGAGGTGTGCAGTACTACTGACGATAATTCCCCTTTTTCCCCCTCTGTGCATTG
TTAATTAATTGGAAGCTCAAGCATGTTTCTTGATGAGCCATTTTAGCTACCTTAATACTG
CTTTATTTGGGGAGCAATCTCTGGCATCAGATTGGGGCAAGGCAGATGCCTTAATCTGTC
ACTATAATGCACGATCTCTGAAGGCGGCCTGGGAGGTAGTGCAATGGTTAAAACACATCC
CTAACATGCACCTGATCCAGGTTACATTTTTGCACCTTAAGGTCACACATGCAGCATTGC
ATTCTCAGGTGCTCGTATTGAGCCTCTGGGCATCCTGAGGTCTGCTTGGAAGAAGGGTCT
TCACCCTTCAGCCAACTGGTTTTCATTCCCATTCACCCCTCAAAAAAAAACTGGCCAGGT
AGTCAATTCTTAGCAGTAAATAATCATTAATTATGGTGATCAACTAACACATGTCTTTGC
CTACAAGACATCTTCCAAACTCTTTTCAAGGAGATACTGTCTTGTGCATTTGATTTGGCT
ATGCCAAGTATATATTGGCTGCTGAAGGTGCAGTGATGCCAGGGGTTGAGCCCAGGATTC
AGGTGCAGCCGTGTGTGCTTCAGCCCTTGGACATCTCTGAACCCTAAAATCCTGTTGGTA
ATGTTTTCAGCATGGGAATATCCACAGCCACATTAGAAAACAAGAATGGGGTATAGCTTA
CAAATACAGATTGGTCAAAGAACAGGTATACTGGCTAACCAGATTAATAATGGGTGATAA
GATTTATAAATTTGGCGGGGTCACACCCATGCAATGCTGAGGGGTTACTCCTGGCTCTGC
ATTCAGGAATTATTCCTGGTAGTACATGGGACCATGTTGGATGCCAGGAATCGAACCTGG
TTTGGCCACATGCAAGGCAAGCTCCCTATATGCTATACGCGGCTGATCAGAGTTCAATTC
CCAGCATCCCATATGATCCCCTGAGCATTGATCGTTCCAAGCCTCCTAGAAGTAATTTTA
ATGCATACTAATTTACAAAGGAGACATCCTCTGTCAGGGCTAAGACCGGAGCCTCCTGCG
TGCAAATTATGTGCTCCAACCCATTGAGCTATCTCTGGTGCCCAGTCGGGTGCTGGGGGG
TGTTCTTTAGAGATGTACTCTGGTGTGTAGGACATACCGTGTGTGGTACCAGAGATTGAA
CTAGGGTCTGCCACTTGCAAGGCAGGTGCATTAGCCCTGCATTATCTCAGGCACATCCCC
CAATTATTGATGCAGAAATCTAGGGGCACTAGAAGTCCTCTGCCTCCATTAGTGCAAGGG
ACCCCTTATTTTTCACCATGTTAGCCAGTAGCGCCAAGTTGAACTGGACTACCTGCCTTT
CCTGATGAACCTCTTCTATTATATTTCTTTGAGCCTTAGGGTTTGAAAATCCATCATGTT
GGAGAACATCAATTAGTTGTGGCTATGGTACTATTTATGTGCTACTTGCAGACCTATTTG
GCAGATAGATGTAATGACCACTATTAATTCCTTATTATTTCTAATCAACTAGCTATTAAA
GGTTTATTTCCAACCATGTGCCTTGTAGTACTTCTGGGTATGGGGGCTGGAGCAATAGCA
CAGCGGGTAGGGCGTTGGCCTTTCACTCAGCCAACCCGGGTTCAATTCCCAGCATCCCAT
ATGGTCCCCTGTGCACTGCCAGGGGTATTTATTGGGTGGGGGGATCAGAAGTTTACCCTG
TTACCATAAAAGTAAACTTCATGATTTACACTGTAGAATTTTTTGGTGCATGTAGTGCTC
TGTGGATCATCAGCAAAGCTATCCCATTCATTGTAACCTTTTCCTCTTATTGAATACTAG
AGGTATTAGAAAGAAGTGGGGGGGAAAGGGTGGAGTATTTTAACAGTTTTGTTCACCTAG
CAGTACTTAGGGCTTTCTCCCGGCTCTGTGCTCAGGGATTGTGGGGATGGGGACAGACAG
TGTGGTGCTGAGAAGGAACCTGGATAAGCCGCATGCCAGGCAAGCATCCTGTCTGCTGGA
CTATCTCTCCAGATGCTCACTTTTGAATGCGTTCCCTGTGTTTTCAGACTTGCCATGTTA
ATATGTAATTATTTATAATTCCCGGGACCTACTTGAACTTTGCTACCTGCCTGATTTGGT
CCCAGTTCTTTGTGGGAAGAGGCACACCCGGCAGTGTCCAAGGGTCTATCTAGCTCCACT
TGAGCTGCTCCTAGGATGGGGATTGAACCCCGGCTTCATATATACAAAACCTCCTTTGAT
TACTCTCTAGCCTTGGTCCTGTTTCTCTCTTAAAGCCAAATTCCAGCAGCCTGCATTAAA
CTGTTTATTCTCGGAGATTTCAGTTATTGCTTTTACCGCATATCTGACCTGACTGCCTTG
ACACCATCCTCATTTAACACTTAGGGCAGGACCAGGAGATGGGTCAGTGGTTTAAAGTTT
TTGCCTTGCTCCAAGCCAGTCATAAGTGTTTTTTATCCCTGCTATACAGTATTTTTAAGG
TGCTTGGGGGGTACGGAGAGATACTACAGCATGCATGCAGCTGATACAGGTTCCATTCGC
GGGACCCTGTGTGTCTATCCCTGAGCACCAGCAGGTGTGGCCCAAAAACCAGAATGTAAG
AAATTCTCACATAGATGGGTTGAGGTGAGATAATGAGCTTAGTCCTCAAGTTCCAATCTC
ATGGCCCTAGCTTCACTGGGTTGGGTCCTTCTTTGGACACCTGAGCACTTGCTTGGAAAG
GCCTCCTTCCACACATACAGCTCAAAAAAACTGCCTACAGGAAACATAAGGCTTCATGGT
ACACCCTGGGACTAACGAGATTGATAGTCACTGGCCACAACAGTTTGAGTAGGATAATAC
TTCCCCCCCCCCCTCTTTTTTTGGGTCACACCCGGTGATACACAGGGGTTATTCCTGGCT
CTGCACTCAGGAAATATTCCTGGCGGTGCTCGGGGGACTATATGGGATGCTGGGAATTGA
ACCCGGGTCGGCCGTGTGCAAGGCAAATGCCCTATCTCCTGTGCTATCTCTCCAGCCCCA
AATAGGCTAATACTTAAAATGTACAGTGATGTCTAATATTAAGAGAGAACTGAGTGCCAG
TCATCTCACCTGCACCTCCATGCTCAGACCAAGGAGCTGGCTCAGAAGAGTAGCCCCACA
AGAAGTTCTGATTCCTCCTTGTCTTGGCATCCATATCTATACTTGATGATGGTTGCTGCT
GTTTTAGTGATGGCGTTTAGGTTTGGTCATGCACCTGGTGACTGTAGAAAAGGCATAGAC
TTCAAGGTCTAGAGTGAAAAAACCTTTATTTGAGAGATTCACTCACTCTTCCCTTATATA
ATATAAGGAAATATAATTAGGGGCATCTCTGGTGAGGGTTCCTATCCTGTTTCATGTTTT
GCAAGTAGTTTCAGGTTTATGACAAATTCTAGTGGTGTGTGAAATTCTGTATGTATTTTG
TGTACCTAAAAGGCAAGCTCCAGGTCATCCCTGCAGGCTTTAACGTTAGGAGTTGCTCCT
GGTGTCATGTGTTCTAGGGGGATTCTTGGTGTTGTAGATTATCTTAAAGAAAATGGAAAA
TTAGAAATGAAGTGTGAAAGAAGGAAGCTAGTAAATTTATGGTTTACTTTAGCAAGCATA
TTCTATAGTGGGGGGTATTGGTTCATGGTTCATACTCATAAGGTAAGAAATAGCAAATTT
TAGTACTGAGGTAACTGGTTATCCACTAGCCTTTAAAAGAGACTGGGCCAGAGCAATAGT
AGGGAGTCAGCCTGGGTTCGGGCCCCAGCACCAATAAGGCACCTCTTGCTGAATAGCTCC
CAAAACACAAACCAAAAAAAGTTACGGTAATTTACTGTGAGTTTCTATTTCCTTTTCATG
ATTTCTATACTAATAGCTATTGGCAGCCAGAAAGTCTTTATAAAAGTGAGAAAATAGGGA
CCAAACATTATTCATGTATGGAAACATGAATTAGAGTCCTTTTGATTTATAACTTATTGA
ACTTGGTTATATCTTTCAGGAATGACACCAAGGAAGATGTATTTGTACACCAGGTGAGTG
CTGTGAGTGCTTGTCTGGACACTGCTTGTGAAAGGAAAGGATGGATAACTATTAACTATT
TGCAAAAAGCTTAAGTCCAGTCATCAAGCTGTTCACTAACAGTAGCTTTTAAAAACAATG
AAACTAGCTCCTTGCACTAAATTTCAGAAAAAAAAACCTTGGGCATACAAAACGTTCTTG
AACCTAATCTTGAGCTAATGATTTCGCTATTTTTTTTAAAAATACCCCAAAACTGACAAG
CACTGTTAAGTCTTAAATTTATGGTAAGGAGTAATCCTGGGGAAAAGACAACACTGCAAA
CATTAATTTGCAGTGAATGCTTTAAAAATGAGCAAAATAACAGGTCTTCTGTTCTAAAGC
ATTGTCAGTGGATTGGGTGTTTTTGCCTTAAGAGAAGCAAAGGTTTGGTGCTTCTCTTAC
TGAACTATCTCATGTTACCTAAGGAAAATGTTTTTAACAGTACTTTGGGCATTCCATAAG
TCATCATCAGATGAACACGGATATTAATGTCTCAGGCTTTACTTAATACTATATACTACT
TGATGCTAGTGAAGATAATTTGTATGTTTTCTTAGTTGTTAATGTTTGCAGTCGAAACTT
ATATCTATGTTGAGAATTGCTCTCAGAATTTATTTATTTTTTTTTTTTGCTTTTTGGGTC
ACACCTGGCGATGCACAGGGGTTACTCCTGGCTCTGCACTCAGGAATTACCCCTGGCCGT
GCTCAGGGGACCATATGGGATGCTGGGATTTGAACCCGGGTCGGCCGCGTGCAAGGCAAA
CGCCCTACCCGCTGTGCTATCTCTCCAGCCCCTGCTCTCAGAATTTAACCACCCTTAGTC
TGTGATGCATCTTAGAAAATGTCTTCACATTCAGTATAATTCAGGACGGCTTGCTATATA
TAAATATGACTGCTTAAGGCAGTATTTTAAACCAGATTATTTCTCTCCCTTTTTTTAAAA
TCTGAAAACCAACTTTTTCATTGTTACTCAGGTATATGTAGGAATATGCAGCAGCATCAT
AGCTTTTGTCAGTCTTGTTGCAGTCAGCAATATTAAAGAGTGGGGGTGGAGGGTGCATTG
AAGAAAGATACTAAAAATTGTGGGATTTTACTTAGGTATATTTCCACTATCCCCAATGAT
CACAGTTTAACAGTTGACTATGAAAGACGGGATAACTTTGTGCAGTTTAGATGACAGATG
AGAGGTCAATTATTTGATTGCATGTCTTCTAGTCCTACTGACCCTTAAGGTGTCACCAGT
CTGCTTTCCTCTTCGAGAAGTGGCTTCAACATGTAGTTGTTTCTTGGGATGTGGATGTTC
GGGTCTTAGGGTGTTGAAGGAGCAACCGCACTTTTTTACTGGCTCTGGCTGTGTTGGCTG
TTATGCCTGCTCTGGAGTGGAGATGCATGGATAGCCCTGTAAAGGGGACTGCTGGGATCA
TAGTGGGATTCAGAACCCCGAGCACTAGAGGGAAGTCCCTCTTCACATATTTTTTAAAAA
GGAGTAATAATACCTTACACTTTCTGTTATGAGAGTGAATGGCTAATATGGGGGGAGGTG
TAAGATACACAAGTGTAAGGTGTTAGTCTTTCCTTTTACTTTGTTGTAACAATTTGGAGA
AGTAACACTTTCATTGTATGAGTTAATTTTTACTCAGGGTGATAATGACCAACTGTGCCA
TGCAGTCATAGTATAAATTGTGGCAACATTATACATGTGAATTACATTTCCATTAAGGTA
TTTGTATGAAGTACACAGCAGGACAGAGTCTGGGTTGTCATTGTAACTGCGTTTTGATTT
GTAAACGGGGGCAAAATTGGCTTGGTCAGCTTTCAAGCATGCAAAAATTAAACTCGCCTG
TCATCTAAACTGACCCCGGATGGGGCTGGATTCTATTAAGTGCAGTCTTTGGGGATAGAT
CCTTGTTTTGTTGAAAGCTAAATATAACACTTTTGCACAAAGCTTTTTTTAAGAAGTATA
TTGTTGTGTCTGGGTATTAGTTTCAATCAAATATTGGGGGCTTTGTCACATAAAAATATC
TTGGTTAAGGTTTGGGTGTAGCGCTGATCCCTATTTTTCCTAAATTTATTGGTGATTTGG
TCTTTCTTAAAGCTAATTTAAGTATATAGCTAAGTTAAAATAATGACACTGATACATTTT
AAATGAAAAAAAGCACATTATTTCCCCTGTTAATCTATTTTTGGAATGTGATATTACTAG
ACTGCCATAAAGAAGAATAACCCCAGGAAGTACCTTCGCAGTGTAGGAGATGGAGAGACT
GTGGAGTTTGATGTTGTTGAAGGAGAAAAGGTGAGGATGTTTTTCGTGTAAAGGTTTGAC
TTTAGTGTGGAAATATTTTGGAGATCTCATCCCTTAGGATGGTGGCTCTGAGGTGGCTGG
ATGGGTCAGGTGACCAATGAGCACAGGTGCATCAAACCTGTTTTGCCAGCTGCAGCTAGA
GGGCAAGCTCTTCAGAGCAGCGAGGAACTAATCTAATATTCAGTCATTTCTGTGCACCCT
GGTCACAAGAAAGTTTGCTTTTGTTGGTATAAAGTTCATTAAGTGTATTTAATGCACACT
TGTTCTGTAAATAATGGCTCTTGTAGGGTGCGGAGGCAGCCAATGTTACAGGCCCTGGTG
GAGTTCCAGTGCAAGGCAGTAAATACGCAGCAGATCGTAACCATTATAGACGCTATCCAC
GTCGCAGGGGTCCTCCACGCAATTACCAGCAGAATTACCAGAATAGTGAGAGTGGGGAAA
AGAATGAGGGATCGGAGAGTGCTCCCGAAGGCCAGGCCCAACAACGCCGGCCCTACCGCA
GGCGACGGTTCCCACCTTACTACATGCGGAGACCCTATGGGCGTCGACCACAGTATTCCA
ACCCTCCTGTGCAGGGAGAAGTGATGGAGGTGAGTTTCATTTCACAGATAAGGATTGATT
GGGCTAGAGAGATGTAAGATTCGTTGTGTGTCTTTTGCTTCCCTTTAAGATTCGCTCTGC
AAGCCTCCAGCGTGCTGGGGTCTGGAGTGACCCTGTGCATTCCTACAGTGCTTGCAAGAA
CATTATGGAACGGTTTGAGGCCTTGCCCTGCTCCATCCAGAGCAAGGTTATAGAAATTTC
AGACATGAAAAATAAAATTTTTTTTAAAAAAATTGTTTTTAGAGGAGGGAAATTTGCTTT
GCATGTGAGTGTCCCAGGTTCGATCCCCAGCATCCCAATGTCCCCGAAGCACTGCCAGAA
GTAATTCCTAAGTGCAGAGCCAGGAGTAACCCCTGAGCATGGCTGGTGTGACCCCACCCC
CACCCCCCAAAAAAGGAAACCATTAAGAATAACTTCCTAGTTAAGACCCAAAAGAATGAT
TATTGGTATGATCACAAATACTGGGTCTCCTTTACTCATTGGCCAGAGAGATAGCCTAGG
TTGGATCCCTGGTGTGGTTCCCCAAAAAACAAAATTTAAAAAGAATAAACTCCTTTACTT
AGGCTTTGGGTTTTAATTGTGATAACTAATCTAGCTGTTTGTTGTCTTTTCAGGGTGCTG
ACAACCAGGGTGCAGGAGAACAAGGTAGACCAGTGAGGCAGAATATGTATCGAGGTTATA
GACCACGATTCCGCAGGTTGGTTTGCCTTAATTTTTCTCAGGCATGTGTTAGGATCATGC
TTCTGCAGTAGTCTTCAGTCATTTGTCTGCCGACATTTCATGTTTTCTTTGATCAGATGC
GTGAGAGGTGAATCTGCCTCTGTTACCTTTGAGAATTTCTTTGCTGGCACTGACTTTAAA
AGTTTGTAGTAGGTGAGGTCTACTTTGTACAGCCATTTATTTTTTCCTTTAATGAGGCTA
AGAAATTTCAGTTTTTCTGTCCTTAACCAGGTAAGAAAATAGTTTAAATTGCATTAACAT
CTCTAAGACCTGCTTCATTGGGAGGGAGGGAGAAAGACAAAGGTAATCTTTAAAGTGTTA
GCAGTAACTGAGCTAATATAGTGGAGAATAAATAGTTCTGCTGAGTTGGCATAATTCTCC
AATCAATTTAAACTTAGAATGTGTGGTGTCCTCCCCAAAAATTAAAGGCAGATGTCTTCC
AACATAATTTTTGTGCTACACAACACGGTATGTTCACAGAAAGTTGAAGTTTTGTTTGGG
TTTTGCGCCTTCGCTCTTCCCTTCTTTAAAAAAAAAAAAAAGTACTCAGTTTCTTGCGCA
TTGACACCCTGTCCCTGCCGTCCTGAAGTTTTGGACAGCAGGCCCACATCCGGCAGTGAT
CAGAGCTTACTCCTGAATCTGCACTCAGAGGTCACTCCTAGTGGGCCTCAGGGGAACACG
TGGGTGCTGGGGATGGAACCTCAGGTCTGCTGTGTGCCAGGCAGGTGCCTACGAAGTGTG
CAGCAGCTGTGGCCCATGATGGCTTTGTGTAGATGATAGGAAACTGTTGTTTGGGACCAC
ACTTAAGAGTTGAGGAATTGCTTCTGCAGGTGTTTGGGAACCATGTCTACCGTACTGAGG
ATGGATCCTGGGGCTCTCTCATTGAGCCCATTGAGCTCGCTCTCCGGCCCGGGGAAATTA
ACTTGTTATGCTGTCAGATTGTTGGGCACTTAATTGCTTTTTGGTCTTGAAGTGAACCAT
ACAAAGAACAGGGCTTTCCAAACTACTTAGCAGGAATTTGTTTTGTTTGGAGGGGCCACA
TCTAGTGGTGGTGCTCAGGTGTTCAGGAGGACGACCATAATGGAGTGCTCTGGGGTCATT
TCAGCAAAGGGAGTGGGGTCAAGAATGAACTTTGGGGGCTGGAGCGATAGCACAGCAGGT
AGGGCGTTTGCCTTGCACGCGGCCGACCCGGGTTCAAATCCCAGCATCCCATATGGTCCC
CTGAGCATCGCCAGGTGTGACCCAAAAAGCAAAAAAAAAAAAAAAAAGAATGAACTTCCG
GAGGAGTAGTAGTTGCAGAATAAAAGTGAGTTGCACAGCAGTGTGGTTTTCTAGCTATTC
TGAGCTACAGACTCAGGTTGGGAAGAAAGGTTTACCTAGCATTTGTTTATCCAGATGAGT
ATAGTTGGGTAGGAATTTGATAACAATAACTAATGGACTTTACAGTGGTTAAGGCAGGGT
AGTAGGGGGTAGATGGAGAGAAGAGAAGCACAGAATAGAGGATAGGATTAATGATACATC
CTATGCAGAAAGTAAGAATGTGACGGGAAAACTAGAAATATGTAGGAATGACCAACTATG
CAGTGGGACGCTTGAAGTGTAGAAAACTGGTGCAGAGGTCCCTATGTGAGGCTGGCATAA
CAGGGCCGTGGGGGAAAGGCAGAGCAGTTTCGCCAAAGATTGGCAAAGTTCCCCAAAGTG
ATGAGAAGAAAACTTGGAATGGGTAGGTGAGATTGGGGAGTTTAGAAGTAACAGACAGTA
TACAGCTCTGTATAAGAATTTTTAAAACCATTTAAGGCCTGTCTTCCCAGAAAACACCTC
ACCCATTAGCACTTGAAATGTGTTGCCTTGGAGAGGGGGAGGGTGTCAGTAACTAAACAG
TGCCCAGAATCCTTCGGGCATGTAAACGGTATATTCGTCCATCAAAGGAATCTGTTAACT
TTGGACTTCACTTGACTGTTGGTTACTACTTAACTGTAGTAGCATGTATCAATACCTAAT
TGCTTTTTATGACAAATGGCATTGCTCTCTGAGCATCACTTTTTGTTTACTTATTCCTTG
GTCATTGGTTCGACATTTGAATTATTTGCAAAATGGTAGTATTATATGTGATGCATATAT
ATATATATTTGTTTTTTAAGGGAACTGCTTGTGGCACTTTTTTGACCTGTAGATTAAGAA
GTCCTAGTAGCTTTAGCTCAAGGGAATTTTTGCTTTTTTTCTTCATTTCTTTGGGTTGGG
GCTCACTCAGCAGTCTTTGTGGAGGCTGCTCTCAGTGATGCTTTGAGATTGACTCAAAGG
GCTGAAGTAATACTAGCTTTTGCATATGGGAGCCTGGGTTTGAGTGCCTAGAACATCATC
TGCCTGGCCACATTGTTTTGTATGACTAGGTAGGGCTAATCATAGCTATTTTGTTTATAT
TAAGAAGGAAGTTTTGGTTTTTATTTCTAATCCTTGCACTTCTTTACGTGCTTAATTCAA
GTCATTACACTCAAACTGAGGTTATGACGCTTGCTCTTTTGAGTTTTGCTAAATTTGCCT
GCATGCAACTTGTATGTTTGAAAGGACAAATAGAGCATTTGGTTGAGTAAAAACATGGGT
CAGTATGGGAGTGGGTTGAATAAAGGCCTTTATCCTTGAGAGTTTGCACAATTTTGTCAC
AGGGGGCCTCCTCGCCAAAGACAGCCTAGAGAGGACGGCAATGAAGAAGATAAGGAAAAT
CAAGGAGATGAGACCCAAGGTCAGCAGCCACCTCAACGTCGGTACCGCCGCAACTTCAAT
TACCGACGCAGACGCCCAGAAAACCCTAAACCACAAGATGGCAAAGAGACAAAAGCAGCC
GATCCACCAGCTGAGAATTCGTCCGCTCCCGAGGCTGAGCAGGGCGGGGCTGAGTAAATG
CCGGCTTAACATCTTTACCATCATCCGGGTAAGAAGCCGGGCGCAGTTCTGAGCAGTGGG
CAGTGAAGAGTGAGTGTCCATTGATGCAAAAGAAAAATGCAGTTTTTTATTTGGAGACAT
CCCTGGCTCTGCACACTGGGATCACACCTCGTGGTCCTCTCCGTACTAATGGAGCCTTAC
CTGTGTACTACCCCTCTGGCCCCTGGTACTACCCCTCGGACCCCTGCTAAGCCATATATT
TAAGAATGTCTTTTGGTTTGGTTTAGTTTGCATGTTGGTTGGTTGTTTGTTTTTGGCTCA
CACCCTACAATGCTTGGTGTTACTCCTGGAGAGGATTGGAGAACCATATGGGATGCCAGG
GATCAAACCCAGGTCAACT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1024, 1028..1042, 1068..1191, 2795..2858, 8659..8692, 10920..11009, 11306..11608, 12233..12315, 15002..15236
1001..1024, 1028..1042, 1068..1191, 2795..2858, 8659..8692, 10920..11009, 11306..11608, 12233..12315, 15002..15233
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved