Sorex_araneus Locus RPS6KA3
snOPY snoRNA Orthological Gene Database
Sorex_araneus RPS6KA3
Sorex_araneus
RPS6KA3
GeneScaffold_5831
SNORA30
50980..51110
96507
ACACTTAGTGATTTTTTTTAATGTGGAAACATTGGAACACTTCAAAGTCTTATGTGTCT
TTTTTTTTTAATACAGACTTAGATTGCCTTCCTGAAAGGTTGTGCTGATTTATTATACTT
TGTCCAGTAGTATTATCCTGAGTGTTCTTTTCACCATACCCACATTAGCACTGGGTGTTA
TTTTTTCCTATACTATTACCTGTTTGAAAGGCAAAAGGTATCTCTCAGTTAAATGCATTT
CTTTGATTAGTATTAAGGCCGAATTCTTTTTTTTCTCTTATTGTTCATTTCTGTTGAGGT
TCATCACTTTTTTTTTCTCGCAGGTTTGTAAAACAAAGTGCTTCATGTATTGAGGATGCA
ACCCTTTGTCATGTTGTTTTTATTTTTTGTAATTAATTTGTCTTTTATCTTTTTTGTGTA
GAAAGCAAAGTTTTAAACTTTTTTAGATTTCAGTGTCATTTTTTCTTTATTTCAACCATC
CTTATCCCTTATGTATTATTCACCTATATTTCCTCTAATACTTGCATAATTTTATTTTTG
ACATTTAAATGTTAAATCCATCTGGAATTAATTTTCATGTAGAGATTTAACTTAGTTTCT
CCCTAATTAATCAGTTTCCCTGATTAATTATTAATGGAGTCAGAATTTAGAATGCATTTT
GTCATAAAAGTACTAGAAATGATCTTTGATGAGGTTTAAATAAGACCATTTGTAATGCAT
TTAACTATTAAAATCAGCTCAAGGGCTCACCTGGAAAAGTAATATTATTTTCTATTACTT
TCAGGGAATAGTTTTTTTTTCTAGTTTCTAATCATTGATTCACCTATTATTTTGAAGCAC
AACCTGTTGCACCTTAGCAACTGCATACTTCTACCATGGTTCTCAGCTTCATTAGAAGTG
TTTAGGGGTACAAATATTCCTTTTGCTCATTTTGTCTGCTTTCGTTTCCTTTGATCGGGA
GGTTCGTTTTGGTAACTTTCTACTTGCTATGCTTTTCACAGAATGGACAGCAAATTATGG
ATGAACCTATGGGAGAGGAGGAGATTAATCCACAAACTGTAAGTAAAATAGCTTGTCATA
AGGGGTACAGATAAATCATATTCCAGGAAATTAAAGTGTTTTTATTTTTAAACCGAGCAA
AGAAATGATTTGATAATGTTTAGAAACTTGTTGGTGCTTTCACATTAATTTTACCAAAAT
ACATTCTTAAATATGTCAGTGACATTAAAAAAATGGTAAGACTGATTTTAAGAGGGCAAC
AGAAAAATCACTTTATATTCTTAAAAGTTTTTCATTGGTATTGTAAGCTTTATTAAAAAT
TTAACTACCCCTACCCACACACAGACACAAAGCAGGGGAGGGGGGCAGAGTGATATTTCA
GGGATTTAGACCCTGGCTTTATATATGGCTGACTCAGATTCTATCCCTGGCACCGGATAT
GGACCCTGAACACTGCCAGGAAGAATCCTGAACACAGCCTCCCCCCCTCAAAAAAAAGAA
AACAGTACATTTGGGTCTGGCCCACTATCCCCCAATCTCTGCCCTCTAAAGAGATTCCAG
GAGGTCAGTGCCTTGACTTACATGCACCGCTTTTTTTTGTGACCCCCAGCGTCGCATCTG
TATGCCTGAGAATCTCCAGTGCTCAGCCCTTGTGCACCTCTAGCTGTGGTCCAGATGTCC
CTCCTCCAGAGATTAAATTAACCAGAGATTTATTAAAGGCAGAATCAAAGGTCATACTTT
GCGGAAGTGTTTAATCTAGATAATGAACAGTCACCGTATCTCCATCTTTTTTGTGTGTTG
TTGTTCATCACTTGATTTCCAGCACCTAGACAAGCATCTGGTACATTAATAGTAATGGAA
TATTTCACAAATACATTGACAAATTGTCACCCTGTTCCCTGAAAGAGAACCATTGTTAGA
AGCTGTTATTATCTTTTGTTCTTTATATAACAATTACTGGTTTTACAAAATAGATGTATT
TTTTAACTTGAGCTTTTGCATTTAAGCAAATTTTCTACATATATTTAATACACCTCTCTG
TTTTTGTGAACTTGTGTTTCTGTACCAAGTCAACGATCATGATCACGAAATCCCATTAAT
CATCGATTTCTCGAGCGGGCTCAGTAACCTCTCCATTCGTCCTTTCCCTGAGATCTTAGA
AGTCTCTCTCGACTTGGCCCTCCCAACGATGTCACACTGGAGGCTCTTTCAGGGTCAGGG
GAATAAGATCCAGCTTGTTACTGGATCTCATGTGGCTAAAGCATATGAATACACCATGGG
AAGCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAAGCTTGCTTGG
CTGCGCGCTTTGGGGAGCTTGCTTTGAAGTCTCTGGATGTTGGCCGTAGATGGGATTACA
CACACCTGGGTTCCTCTGACAGCACCTTCATGCGTGAGGCCTGTCCGAACGTGTGGAGAG
GGGCCTTGAGCATGACTGTGGCTAGGTTCCAGTGGTCTTGGGCCGCCGGGAGCTCTGCTC
GGGGCAGGGAGGGAAGCTGGAGCCCATCCCCTCCGAGGGACCCCGGGGAAGACATCCAGG
CGTGCGGGCAAGAGACTCTCTGCCCTGTACCAAGTAGTCTTAGGAAAGAAAGTGCTGAAA
CGTAGAATATGAATGTTTAAATTCCAGTAAACATTGTCGAACTGACTCCCAATCCAAAAA
TTGTAAAAATGCCACTGTGCAAAAGTGCCTCTTCTGCTATACCCTTGTTGTTGGTTTGGG
GCCCGACCTGTTACTCAGGTGGTACGCTAGCTTGGCGCTCAGGGGAAACTCATGGGACCG
TCTTATATGAATCCTAGTAAAGTCGAATAGTTTTGAACAGTTTTGCCCTTTGATTTAATT
TCTTGCCCAATTTTCTTCTGGGTTACTTGATGAGTCCTCGTTTCCTGTGAATAGAGATGT
ATCTGGACGTTAGCTCCTAATATATATGTAAATATTTTCTATTTCTAAACATTGATGATA
TTGTCTTTCATTACATGTGTCTGAAAGTTTTCATTTTTAGTAGTAAGATCAGGCTACTAT
GTTTCAAGTTTTGTTGAAAATTCTTTCCCTGTATGATGATTATAAAAATTTTACATTTTT
GCTTTTTTGTGCTTGATCCGCAATCCACTTGGAATTTTATTATTATCTGATATAATCTAG
ATACCTAACTTTTCTTTTCCAAAGAGTGTGCTATTCTATTCCCTATTTATTAAATAAATA
AGGCTCATTCTCTTCCTAATCATAGGAGATCCCCTTTTTACATAAAATTAAAATCACGGG
GGCTGGAGCGATAGCACAGCGGGTAGGGCGTTTGCCTTGCACGCGGTCGACCGGGTTCAA
TTCCCAGCATCCCATATAGTCCCCTGAGCACCGCCAGGAGTAATTCCTGAGTGCAGAGCC
AGGAGTAACCCCTGTGCATCGCCAGGTGTTACCCAAAAAGAAAAAAAAATTACAAACACA
CCTTGGGTTAGTTTTGCGGGACTACGCTAACAAAGTGGCATATGCCACAGAATTTTATTT
TCTTTATTTTCTGTCTGGAAGGCAGGAATCAACATGTCGACAGAGCCACATTCTCATTAA
AGACACTTGGGGGAAAGCCTAGAGCCGCAATCCTGGGCATTCCTTGCCCTGTACTCAGCT
CTCTCTAATTTCCACCTCCATTTTCTCACAGCATTCTTGCAGCATGTGTCTGTATCCACT
TGCTCTTATAAGAACACCAGCCACTGGGAGGGAGCCCACCTTACTCCAGTATGACTTTAT
CTTAACTTGATCAGGTCTGCAAAGAACTTATTTTCAAACTGGATCACCTGCGCAGATTCT
CGGGATAGAACTTGAACATACCACTGAGGACAGTACAAGACAAACCCTTCTTCATTGCTT
AATGTTTCGGTATCACATAAATTATTTAATTATTCCGTTATGTGATTCATATGTGGTACG
GCAAAAACTGACACCTTTTTATTTTTTGCTATTGTGGTTTTACAGTCTTTAAGATGAATT
TCATAGTTTGGTACCTCTGAAAGCTTTGATGGGAATATTTGGTTAGAACTACATTAAATT
TGTAGAATTACAAGAGGAAAGTTATTTTAGCATTAAGTCTTCACAGTCAAGAATATTCAT
TTTTCTGATTTTTTTGTAGGCTTCACCAAAATGTTATGATTTCTTATACCAAGTCCTTAT
GTATTTACTACTAAAATAATACATTTTATAGTTTTTGTAGTCAATGGAGTTTTCCTTCTG
TCTTCAATCTAGTTATTGCTAGTATGCAAAATTCACATTTATTATTAGTATATAAAATTT
TACACATTTGTGCATTTCTTTTTTGTGGGTTCCTTCCCAGTAGAATGGGGAGTAACCCAG
TACCATTCTTGGTGATCCTTGGATATTTGATCTGGCAGTGTAGGCCTTCAGTGCCTTGGC
CTATGTTGCTTGGACTCACTAGTCCTGGGGCCACACCAGTAGTACCCCAGGGACCACGTG
GTGCCATATATCAAACCTGGTGCCTCATGTATGCCAGGAGGCATATACTTCAGATCCTTG
AGATACGTTTTGGCCCCTGTTTTTTATTTTTAATATCTTGGGATACTTTTTTCCAGAAAT
CAAATAAATAAGGGATGGGGTGATAGTCCAGCAGGTGAAGAGCTTACCTTGCATGTAGCC
GACCCAGGTTCAATCCCTCGTACCGCATAGGGTTCCCCAAGCCCATCAGGCGTGGTCCCT
GAGTGCAGAGTCAGGAGTAATCCCTGAGTACTGCTGGTTGTGGCCCCAAAACAGAAGGAA
AAAAATCAAATACATCATCATGGACATTTTCAGTTAAAGAAGTGTGAGATTACTGTACTC
TTTTGTTTAAAATCCTTCAATAGTTTTGTGCTTCTTTTAAATAAAGTCCAAACAGCATTG
TAACTTATCAAGCCCTTTAGAATGAAGGTTTTTTTGTAGTTCTTCACATCTTGGCCACAC
TCTGCCCTCTACTTACACTGTAATCACTCTGTTTCTAGGCCTTCACACGTTGTGGTCCCT
CTCCCAGAATCCTGACCATCCTTGGGGTTCAGGTTTTAGAAACCTGTACCACTGAAATGT
CTTTCTGACACAGCTTCCATTTTCCTTTCCACCTTTGGTGTTTTCAGTTTGTGCTGCCAT
AGCTACATGTATGTATCCTAAGCAGCAATAGCGCACTAGATTCCATTGCTTATTTTTTCG
CTATATTTCCTACTAGTCTTGGGGCTCCTTCAGTTGTTGACCATGTCTGACATAGTCCAT
GTTTTATTTCTGGTTTTCAATAGCCTGCTGGTTTTGAAGAAGTGTATCTTTGTCTAATGA
ATCCATGAATTCCGTACCCTTTGGCTAGCACAGGGACTCAGTATAGGGCTTCTTGCCCGG
GTTCCCTGTAGTCTAGACTCCTGCCTCTCTCAAAGCATTTGAGGTGTTTTGCTTTATTAG
TATTTAGTAAATATATACTTCCATTTAATCAGATATATAAAAAATCAGTATTAATACTGA
TTTTCCTGCCACTATCTAGTTGCTTTTTATGTAACAATTATTAATTCTTTTAGAAGGAAA
GCTTTCAGATATTTTTTCTAGTCTAAAGCATTTTTTCATTGTGATGATACAGGGCTGTAC
TTTCCCTCAGAATACACACAGCATTAGAAACAGGAACAGTAAAAGGAAACTATATTCTAC
AGATTGCGAAAGTGCAAGACTAATATATTAGCAACTATGTGGGTGAAAAAGCTGTTGAGT
AGATCATTCCAGATTAGAGGAATTGGGTTTAAATATATTAGTCTAATAATTATATTTAAC
AATATTACATCCCAAATATTGTATTAGCTGTAAACTTTTTAATAATATTTGCACATTTTT
ATTTGGTCAATAAATGTTATTCTGACTAGCAAAAGTTTAGAGGTTATATTAGTTAACCTA
GTTGATGCAACATATTGCTCAAGACTCAGTGACTTAAAACACATTATCTCATCATTTCTG
TGAGCTGAGGATCTGGTCATAGCTTAACTGAATCCTTTGACTCAGATCTTTTGTCATAGA
TTGCAACCAAAGACTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGT
TAGACACTTAACCATGTGCGTGCTTGCATTTGGGGGTTTTTGTCATACAGCAGTTTAGTC
TATACTCTAACTATATCTGCCAAGTTGTTAATAAATGTCCTCTCGGTGCAAGAACTCTAG
GTGTTTGGGAGGCATAAATGTATATAAAGGAAATTTGCAGGTTTAAAATAGGAAAGTAAG
TCTATTTGTGTCATTTCTCATCTGAGAAATTTTTGCCCAAAATATATTGAATAAGAGCTG
GAAGGAGAGTGTAGTGGTTAAGGCTTAGTTCAGTCCTCAGTACCACATGGTCCCCTGAGC
ATTGCAGGAATAGCTCTGAGCATCAGTGGGTATGGCCCCCAAACAAACAAGTTTATATAA
AAGAGAAACTTGGTATTTGAAATTGTGAGACTTCGGTAATTTGAAGAACAACATTTAAAT
ATGAAAAGAAAATTTTTAAAATTTTAAAAGAGGAATTTATGAGATCACAGTGATTTCAAA
GGTGTATAGGAATGGGAAGCAAGCCTTATTTATTTTCAGCCTCTAAAGCCTCAAAAAAGT
TCAGTACAATTACCAGATACAGTGCAAAGTTAGAGGACTGAAAACTAAATGGACTAATGG
GCCACACATGGAGGTGCTCAGGGACTACTCCTTACTCTGCACTTATGAATCACTCCTGCC
TGTGCCCAGGGGACCATATCGGGTGCTGGGGAACAAACTCAGGTCAGGCAAGTGCTCTAT
CCTGTGCACTGGTGCACTGACCCTTAAAGAAAGCCTTCATTCTTGACCCTGCCCTACACA
GAGAAAAAACAGAAGAGATTTCATAGACAAAAATGAAATAGAGAAGCTCTAAGTTTGGGG
TACCCCAGGTATACCAGGAAGTAGTGTTGGCTCTGGGATAGCAACAGAAGGCTTCCTACT
TTGATGATGTGAATAATCTACCCATCATTGGTATCATTGCTTATCCCCACAATGGGTATT
TCCATGTATTTTCAGGCAGGATTGTAGATAGAGCCTTTTTTCCTGGGAAAAAAATTGAAT
GGAGTCAAATTAAAGACCCTCCAACAGTGGCATTTGGAGGTCTTTAGTGTAAAAACTGGC
TACTTGACTAGTTAACCTCCAAGAAAGCCTGCTAGCTCATAAGCTACAGAGCATCTAGTA
TACTTCATACTGCCAAACTCGAGTATTAGTGAAAAGCCAGAAAACAAGAGATATTTGAGG
AAGACTTCCAATATGAAATATTGAGGCCTTGGAGGAATAGGCAATGTAGGAAAACTAAAA
ATTCAATTATTAACATCTTTTGAATAGTTAAAACAGAATTGAGGGCCAGAGAAACAGCAC
AACATGTGATACACTTTTGCCTTGCATGTGGCCGACCCAGGTTTGACACCCAGCACTGAA
TATGTTTCCCCAAGCACCACCAGGAGGGAACAGAGTGCCAGGAGTAAGCCCTGAGCACAG
CTGTGTGATTCCCCAATATTTAAATAAAACCTGATTCCCTAAAACAATAATAGGATGCTG
TAGAAAAAAAATCAGAAAAAGAAGAAATTCTGAGAAATTAAAATTATGATATGAATGTTT
AAATTTTAGTAGGAAATTTAGACACTAAAGGAAACCTCCATCATACAGAATGAAAGAAGA
AGAGAGAAGATAGAGAAGAAAAAGAGAATCACTCTAACACCAACCTAATAGGAATTGTTA
AAAGAGATTTGTTAGTTTAGGTACCATGGTTATAATAGTGTTAATACTTACAGTATTGAC
GTACAAAGTTACTGCAACCCACACCACCAAGATGCCAAGACCCTCCATCACTCTTCCTGT
GTCAGTGTGACGTATTTTGGGGGACCACACCCTGCAGTGCTCAGGGCTCACTCCTGACTG
CACTCAGGGAACACTCCTGGTGGGGTTCAGGTCACCATATGCCAGAATCAACCAGGATTG
GCCTCATGGACCCACTGGACTATCCAGCCCAGTGTGACACATCTTAATTGGAAATATTTT
TCCTTTCATAATGGTACTGTGATAATTTTTGCTCTTAGATTATGTGGAATACAAGAATAC
GAAAAATTCCTCCAAATGAGTAGCATGAATATCCAAATTAAAGCATTCCACTAAAAGGCT
GTTGATGGAAAAAAATTATACTCTCCAGAAGGATTATCATAATAAAATATCAGAGTACCA
AAGTTTCCGATATTGATGTCTTAATCCCCAGTGTGATAATACCATCTTGTAGGTACAAGC
TTTGTGAGATCATGTTATTTAAGGAAAGGTCCTCATCAGTTGTATTGATGCCCTTTTATT
AAAAAGAGAGAGAGAGAGACCCCAGATGGCTCCTTCCTCCCTCTGCCATATACCGTGACA
CAATGAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCATGTTATGATGCATAAAGGATA
CTTTAGGAGACTAGTTCATTCAGTAGTCACATTCCTAACATTCCTTACCTCAGCAGTGAA
CAACATCTGCTCAGTTATAATTACAAAGACTAAATATTGACTTAAGCAGATTTTGTAATC
TGAGTCATATGTAATAATCCTAGCTATAATGCTTGAAATTGAGGAATTGAGAAAATAATG
TAAGGTTATTGTGTATCACATAGAGGTAGATGCCAGTGGGAACAAAGAACTAACCAAGAG
CTCTGGGTTACTTTGTACCAGTATTTGAATATTTAGCCTTTAAAAAAGTTTTTAAAACTA
GGTATAGTTTAAAATAAAAATTGAGGGTGCTGGAGCAATAGCACAGGCGTTTGCCTTGCA
CGCAACCAACCCAGGTTCAATTCCCAGCATCCCATATGGTCCTCCAAGCACCGCCAGGAG
TAATTCCTGAGTGAAGAGCCAGGAGTAACTACCAGTATGCATCGCCGGGTGTGACCTCCC
CAAAAAAGGGGGTAGGGAAATTGTAACTGATGTGGTCAGATTAAGATTAACCTCAGTTTT
GCGAAGAAAATGTAAACATTTGGGTGAAGATATTTTCATGGGGGTATAAGAAAACCAAGG
GTGAGCAAAGTAGAAATGTTTCAGAGGTGGTAAATTAATTTGAACAAAAGCAATAGCTCA
AAGGAGAAACAGACTTCTCCAGATAAATATCTTCATTTAGACCTTGATGTAGGAGCTGTG
ATGTTTCTTAATAAACATATCCTTGAGGGGAGCTGATGAGATAGTACAGTGGTTAGGGCA
TTTGCCTTGCTCACAGTCAGCCCGGGTTCGATGTGGTCCCGTGAGCACCTCCAGGAGTAA
TCCCTGAGCATAGAACCACAAGTACACCTTGAGTACTTACTTATGTGACCCAAAAAACAA
AGGAAAAAACTTACCCCCTAGATTACAATTTGAGGAAGAGCCTTTTTTTTCTGGCTATAG
CTTTCCTTTCATCAGCCCTCATGGCTTTCTTTGTTCTTTGCCCTGCCATCTGTTGCCGCC
CCATATCTTAACTCTTTCCCTGTGCTTAGGCACCTACTGCTAAAACCTTACATTTTCACC
ATGTATTTCATAATAGGAGAAAGTATATTCTCCTATAGCACTATATATTCTCCTGTAGCA
CTGTTGTCTCGTTGTTCATCAGTTTGTCGAGCGGGCACCAGTAACGTCTCCATTGTGAGA
CTTGTTACTGTATTTGGCGTATCCAGTATGCCCCGGGTAGCTTGCCAGGCTCTCCAAGAG
GGATGGAAGAATCGAACCCGGGTCAGCCGCATGCAAGGCAAACACCCTACCTGCTCCAGT
CAGGAGATAATATATCTCTGTAAATGGACGCGTAGCAGAATATAGTGGATAACTCTCCCC
GTCCATTGTCTCCCTCCATTGGGAATAGTTGCTTCCTCTCCATATTTATGCTTTAGCTTA
ATTTCTCACCGATTAACTTGCTCCAACCAGCCAATCTCTTTTATTCTCCTTTCCCTGCTA
AAGAGAGTTGATGTTTGTATCCTTTATTCCTGTGGGGCTGTGGAAAGAGACTGCTGTTAC
AGCAGGAAGGTACAGTGTCATATAATACCTCAAGTGAAGATGACGTCCCGACTTACCATT
CTTCCTCAGCTGCCCAGAGGACTGCATGATAGTCTCAAGAGCAGTACCCATATGAAGGTC
AAGCCGAAGGAGTGTACCAGCAGTTCCCCGTTCTTTTTAATGCCCTAAAAGCATGTGGTC
CTCTACAGTAGTTTCTTCCAAGTTACACACAAAACCGTTACCCTTAGACAGCTGTGATGT
GTCCAGTGGTCCTCAAAGTATCCAAGGAATTTGATCAGTTCCCAACTACCTCCATTTCCT
CCATTTCTTTGACTGTTCCCTCAAACTACCTTCAAAGTTGCATTTGAACCCTTGGACAGA
GATAGCGGGAAGCAGACACTCTCTGGCAGAGAGTGCAGTGCAGGAATATTTTATGTTTGA
AATCTTACCAATAACACTTGTAAGCCATGGTGCCCAAGGCAAGATCTTAAAAATAAAATG
ATGTTTATAGCCATGAGTCCAGCTCACTCTTACATACCTGTAGTCATCATGAGTCAAACA
CAAAATAAACTACAAAAAGAGAATCCCTTCACAGAGTCAATAGATAGTGAAGAGCTTTCT
CAACACAGAAAGTGAGTGCTCATTGGCAGGGAGTGTTGGTGAAGTTGTGCTTTAATATCA
TTTATTGGCTAATTAGGCAGAGAACTGTCTGTTGCTCTGTCATTGGCTGAGCGTATATGC
ATTTTAGCACTTAAAGCATGGGGAATATACTAGATTTAAGTGTATACTGCTTGGAAAAAT
ATTTCTAAGATAATGTAGCATTATAATTAGCTCTGCATGGTGGCATTAAATGGAGCATGT
GAGCTGCAAGATTTCCAAACATGTAAGGTTTCCCTGTGCTATATTTTTGGCTCTCTTTCA
GAGCTATTTTTCCACTTCCTGGTGTTCTTTCCTCCACCGGGAAGAGCTTTTTAAAAAAAT
AATAGCCCCTCCCCTTTCTTTTTATCATGGCTTTCCTATTTTATGTAGTGCCTCCGATCC
AAAATTACTTGTCTGCTCTACTCAACTCTGGAATATCCACTTTTTTTTAATCGTCTAATC
CATAATTGGAAAGGGAGCAACTGATTTGATTAAGTTCTATTCTCAATACTGATTTATCGA
GTCAATGTGAAATACTGGCTTATTGAAAGATATAACCCTTCTACCTAAATGGGCCTTTTA
ATTTAAGCATCTTAGACAAACGTGAATAAGTAAAACCTCCAGGCTAAGCAGAAAAAGTGG
ACAGGGAAATGAGCGATACTGTCTTGGCATTATTACTACTTGTTGCAAAAAATCCGACCT
GTTCAGGGGTGCTGCTGCCCTCTTGCCCTGTCTTCATTTCGTCTGAGATAGTGCAAGTGA
CCATAGCGTGACTCTCTTTGAAACAGGGCTATTGGAACTCAGGAAGCTACTATTGTGCGT
CTCAGGTTCTTGGTCATGAAACATATTACCTATCTCTGAAAACCTTAGAACCATAGCATT
GTATGACAGGCCATACTGTTGCATTGTGCTGGATTCTAATTCAACTGTACTTAAATAGTC
TCGAAGTAGTAAAGTATGTAGTGCCTTACAATTGAACGATCCATATAGAAATTGTATCCA
AAGGAAATCAATTAAGAGCATGTTATATTATTAGGCTTGTTCTTTTTCCAGCAGGGGTCA
GCTACCATGAGTTCATGGAGATGATTGATAATTGGGTTTGATACACATGTAATGTATATC
ATAGAAAAGTGTTTAGATACTCTGCTATAATTCTTCTAAGCCGTCTCCCTTCAGGGTCAT
CTCAAACGGCCTCACGCCTGGTTTCTTCACTACACCAGCAATTAGCCATACAGATAAGTA
CTCCTTCTCCAGATAGAATTACCTGATTTTGCTCTCACCAGGAGTACAGTCATTCCCAAT
TAAAAACTGTGTGAACTCGGACATCAGCTTCCTTCATTTCTATTCTCAGTAACACTTTCT
TCATCTGTAACATGGAAGTGAGTATTTCATTGTTGTGAGATTGTATATTTTCATGTAAGG
CATAGTGCTTAGAATATATTTGTTAGAAAACATATATAGTATATTAAATGATATTTTCAT
ACCTTAAAAATTATTATAATGATAAAATTCAAATCAAGAAACTGAGGACAGAGCTAGAAA
AAGAACTACAAAGTAAATCTATAAAAAGCAGAGGAAGGAATTAAATATAAATTCCAAAAT
CAGTGAATTAGAAAACAGGAAAAAAAAGGCAAATGCACATTAGGAAAGCAAAACAGGATA
TAACCACAGATAGGAAGGAGATTAAAACATAACAACTGAAATATTTACAGATGGAATGAT
AAAATGTCTGGGATTTGCTTCAGAATTAATTGTGGGAGTGGGAGGAAGTGAAAGAGTGTA
TAAGACAAGATTGGCCACAAGTTGATAATTGTTAAAGCTGAATGCTGGGTAGATAAGGAT
TGGCTATACTATTCTACTTTTAGATATACATGGTATTTTACTTAAATATGAAGAGCAGAA
TAGTATTCCTCAATACTAGTATGAAAGTCTTCCCAAAATAATGTATTTTTCTAGGACAAT
CGAAATGCTTTAATAGGAAAATCTAAAAAATTGATTATACCAATCACAGTGAAGAAATTT
AAGTTATTATAGAATAAGGACCAACACAACTCCCATGTAGTGCCACACCTCCTGGTATTA
TAGGAGAAACTTTTGAAATTTTTTAAAAGATAATTCTGTAATCTTTAAGTTGTCACATAG
TAAAAATTCAAATTGCTCTCTGGTTTGTTCTAAGAAATTAGCGTAAAACTGATAATGAAA
GTTACGAAAAGGAAGCTGTACCAACTTATTTATAACTATAATTTCAAAAACTCTGAAAAA
TAGAGATCAGACTCCAGCATTAGATTTTTCCTAACAGAGCATGCATATTTGGACAAATAA
TCTGATATGAAATAAGAGAAGAAAAGTTATGTGACCATATTAATAAATGCTAGACGACAT
TTTATAAGATGAAGTATTCATTCAGATTCTAGTGCAAAGAAAATGGTCTTAATATGGTAA
CAGATATCTAAAACCCAAATGTTGACATCTTGTTTATAATAAGTCAAGTCAGGATCAAGG
TAGCCTTTATTATTCCTAAATAAAGATCAGAATAGCATTTATTAGTGCTGACTCTATGCT
CTGTAGTCAGAAAGTTGCTTTTTTGTGATAGGAAGTCATTGTGGCAGAGTCATAAGCAAC
TCTAATCTCTGTTTAAGTTTATTCTGTTGCAGTGAAGAGAAAAGATTGGATAGGGGAAAT
TGGAAGCAAAGAAACGAGTTAAGATGGCACTCATGGGGCTAGAGCGATAGCACAGCGGGT
AGGGCATTTGCCTTGCATGTGGCCAGCTTGGGTTCAATTCCCAGCATCCCATATGGTCCC
CCGAGCACCGCCAGGAGTGCATGAGCCAGGAGTAACCCCTGTGCATCACTGGGTGTGACC
CAAGAAGAAAAAAAAGATGTCAATCATTATGTGATCATGATTTATATTGAGGAAAAAAAA
AACAAGAAATTAATTTTAGGTTTATTTGAGACAAGTGAGAGTTTGTTGTTGAATCAGCTA
TGAAAGGAAATAATTAGACAAAAAGGACATACAGGTTTGAGTGTTGTATGATGCTGCTGT
TGCCCAAAATTATACTGATAATTTAGCCTAAATTCAAACTTATTGATGATCTGTAAGGCT
GTATTTAATATACTTCTAACCTACTTCTTCTTCTTTTTCCTTGGTGTTCACCATACATTA
GCCACTGCAGTCTTTCCATTTTGCTTTGAATTTGTTCCCAAAAACTGAATTCAGAAACTG
TACTCAAAAGATATTTGCACTCTTATGTTCACTGCAGCACTATTTACAATAGCCAAAGTC
TGGAACCAACCCAAGTGTCCAAGTATACATGACTAGGTAAAGAAACTGTTGTACCTATAC
ACAATAGAGTGCTCCTTGGCTATACAAAAGGAAGAAATCATGCAATTTGCTGCTGCATGG
ATGAATGTGGAGAGTATCAAGCTGAGTGAAGTTAGTCAGAGGGAAAGAACAAATGCAGAA
TGATTTCCCTCGTATGTGATATATAAAGAAAACATAGTGAGGAAACAACAGATATCCAAA
GGTGACAGAAACAAACTGGTCTTCAGTAGGAAGCATGTCACTGATGTTGGGACAGTGGTA
GAGGGAAACTCACACTCCACTGGAAAGTATGATGTTGAAATGTTCATGCATGAAACCCTG
CTGTTATCAATATTATAAATCACGGTGCCTAAAATAAAACATTTTAAAAACCAATTGGCA
TTAATATGCAGATAGCAATGGGCCAAGACTAGATCTAGCCCCAATTACTAAGGCCTAATT
GGTGTTTTCACCTTCCCAAGGTTTTGATGTAGTTCCTTTGTTATCATATAGACAATTCCG
GAGGACAATTTGGCATGGTAAGGTAAAAAAAATCTTTAAGGGCTGGAGGGATAGCACAAC
AGATAAGACATTTGCCTTGCACGTGGCTGACCCTGGTTCGATTTCCAGCATCCCATATCG
TCCCCTGAGCCCTGCCAGGAGTAATTCCTGAGCCAGGAGTAACCTCTGTGTATCACCAGG
TGTGACCCAAAAAGAAAAAAAATCTTTAAAATGCTGAAACTCTACTTCCAGAACTGCAGC
TCCACTTAAAAAAAATTTTTTAATTTAGAAAAAAACATGAGGTAAAATTCTAAATTACTG
TGATTATGCAAAGGATGAGGATATTCAAATGTTGTGGAATATCAAATTCCCTACAATAGG
GAATTTGTAAAGTTGAGACCTCTGTAATCATTAATAACCTATTAAAGATCATTTAATACT
AGAGAGTGGGTGTCAAAAAGCTATACCCAAGATCTGTCACCTATTTATGTAAATTAAGAT
AGTGAAACACATCAGTCATTTTTTTAAATGGCAGTGGTAGAATTGACAGCATATGACCAT
AGCCAAAATCATCTATATCTGATCCTTTACAGAAAAAAAGTGATAATAGTATAGAATGGT
CCAAGTTTTATGTATGTACACAGTAAAAAAGGCTGGAAATAAAAACATCAAATTGGTGGG
CTTTTTCCTTTTTTCCCTTTCTTTCATTTTTAAAAAAATGTTGATTATTTAGGTTTTTTA
TAAAGGAAATCCATAAACAATAATTCCTGGTTTCATGCATGCACAGCTGCATAAGTAGCA
TCTGTTTCCAGTTTCAGCATATCACACTTCCTCAGGCAGACATTATTTGAGGGCCTCTAA
TAGGCTCCTTTTGATGGCGGTAAAAAGATAAGTGCAGTGCCCATTCTCAAGATCAGTCTA
TCAGGAACTATAGTCAAGGCACACATTTGATGAGTTCGCTGTCTCTAAGGAGAGCTCAGT
TCAACAACTCTTTACTAAGCAGTAAGTTGTGCTTAAACAATAATAGTTTTAAGTGATGTG
CCAGAGCACCTTACTATCTTTCATTTTACTTAGGTGATGGACAGCATCTGGATAAAGCCC
TGTGATGAGTTGTAACATAAATGCTACCTATCACTTCAGCTTATCCTCATTGTTAATGAT
ACTTGGCATGGAGAAGTTTTTGAATTTTAAAATAAAATATTCTTTTCTGTGTGGTTTTGT
GTGGTTTTGATTTAGGGCCATACCCAGTGATGCTCATGGCTTACTCCAGGCTCTGAGCAC
AGGGATCACTCCTGGCTGTACTTGGGGCACATATCAGGTAGCCAAATATCTGAACATCCC
CTTCAATTATTTAAGTGCCACATTTATCCCTTTCTGTTGTTCTACTGGTCTTTTGAACAG
CAGTACCATTTTCTTTTAATTAAGATACCATATTGTTATTTCAGATTTTGGTTTCTGAAG
TATTGTATCATTTTCTTAGTTGTTATATTGAAATTCACAGAACAGCATAATGTGGATTAT
TAACTTGAGCATTAGTTGTCACTAAAACCAATTTAGACAAATTTCAAAAAACGAGGCCAG
AGTGATAGTACAGTTGGTCGGGCAGCCTTGCACAGCCCAACACAGGTTCGATTCCTGGCA
CACCAGATTGCCCCCTGAGCCTTTTTGTGGGGACCTCTGGCCTCAGAGACAGGAGCAAAT
GCTGAACACTGCCAAGTATGGCCCTTCCAAACCAAAAAAATAAGTTCAAAAAATGATTAT
TTGGTTGTTCTGTTCAGGAGTATAACTTGATGACTGCTATATGGAGACTCCCTATTTTGT
TTCGTTTTCAATTGTTCCATAAGCATGATTTTTGCTGTTTCAGACTGTTCTTAAGGGACA
CCTCAGATTCAGACTGTAATATTGTATTAGTGCCTTGCTTCCCTTTTGCAGCATTGTAAG
GAAGCTTAAGTGATTCATTTACGAAAATGAAAGGGTTCATGTGTGTTGAAAAAAATTAAG
GGCTTTCCTTGCTGAAATTTTTTGAAGAATTATTTATCACGGATTTACAATACTATGTAA
ATTCCAGCAGAGTTGTTTCATACTTCTGTTGTATAAACCTCACTGTTGCCCAACACCAAA
ATCTCTGCGGCCATTCCTACTTAGGAGAACTTTTTAATTGAGCCATTTTTTTTAGCGATT
GCTTAATTACCATTAGCTTGTTCATTTATAGAACATTACCATAAGTTTTATTTATTTATT
TATTTATTTATTTTGCTTTTTGGGTCACACCCGGAGATGCACAGGGGTTACTCCTGGCTC
TGCACTCAGGAATCACTTCTGGCGGTGCTCAGGGGACCATATGGGATGCTGGGAATCAAA
CCCAAGTTGGCCATGTCAAGGCAAACACCCTACTGCTGTGCTATTGCTCCAGCCCCATAA
ATTTTTGATATAGCAGGAAAACAGGTCTTTCATAGAGTACCTGAAGCACCTAATGGGTAC
ATTAATGTTTGCTTAATAAAGGAGTGCCAGGGCTAGAACAGTAGTCCAGTGGGTAGGGAG
CTTACCTTGCATGCAGCCAACCCAGGTTTGATCCCCGGCACCATATATGGCCCCCTGAGT
CCACCAGGAATAATTATTGATCCACCTCCAGCTCTGACCCAAAACCCAAATAAATAACTA
AAAATAAAGGAGTGCTGAACTGAGCTTCCATTGGAGATAGCAGCAGCATTAAATATGCAC
CTACTAGGACACAGTTCCTTCATCCAGGAAACAAGCTGATCATCTCAGGGTTTCTCAAGC
AAGTTTGCTAAATTCATACCACTGAGGTTTTTGTTGATTGCACATAGATGAAATGTGCAT
TACAGCGAGCCTTTTCCCACAGCTCCCCATGCTTCTTTCTTGGGCAGTGATCATAAGTGC
CATTATTTCGTTGACCAGGTTCTGAAAATTGACATACCATAGAAAATATTTTAAAGCAAA
AATATACTAGTAGTATGTCTGTGTGCTATTAGAGCATAAAATGGAGTCATGGGGACCCTT
CCTTTTCCAGGTTGGCTTCTCCAGGAACTGTTCCTTTTTGTTTACTCATAACCAATTTAC
TTTTTAATCACTTAATATGAATTTTAGGTTTGAGCCTTGAAATCTTTTTTTTTTAATTGA
ATCACTGTGAGATTCAATTAAAATGCTGTTCATGATTGGGTTTCCATCATACAATGTTCT
AACACCCATCCCTCCACCAGGGTACATTTCCACCACCAGTTTCCCCAGTTCCACCACCAC
CACCACCACCCTTTCCCCACCTGTCTATGGCAGGCACCTTTCTTCTGTTTTCTTTCTCTC
TCTCTCTCTCTCTCTCTCTGTCCATTATGGTTTGTATTACAGGTACTAAGAGGTCATCAT
GTTTGTTCAGGGTTTTCAGTATTCTTACTGGGAAGGCACAGCTGGAGTGGCTTTTTTTTA
ACTGGGTGGTGGCTTTGGAGTGTGGATGTGACTGCCAGGCTTCCAGAGGTAGAGGGAGCT
AGACAGAGGTAGCCCACCCGGACTCTGTGAAAGCATAGAGGTTTCAGTCATAAAACCCAC
ATATTAGAATTTTCCGCTGCTTAATTTCTCTGTGAGATCTGTCCCAAGATAGTGGAGTCC
AGCTAGGGTCATAGTGGTCATTTTGCATCGCAGGACCCAGCGGCTGCCCGGGGTTCTGCT
TTTATTTAGAGTCTCTGAAGCAAGACTGACAAATGAGCTTGTATGGCTGAGGTGGAGGTG
GTTTGTGGGTGTGGCTATCACATACCTAACTTAATTTCTGGGGAGACTTGTTCCTGAGTT
GTTGGAGTCTGGCCTGAGACAGAGCGGTGATTTGGGGGTATCAGCCACTCACAGCAGGTG
ATTAGGGTCCCGGATGGGCTCGGTGGTTCGTGCCCTGAGCGGTGGTTTTTTAGTCTTGGT
GCCTTGCCGGCCTCAAGTTTCTGGATTGGCCCAGCCACCCAAGCCAATGCTCACGGCGGA
AACCTGGGGTGCCACAGCAGTTCCAGTCGCCACACTGGCCTTGAAAAGTACCTTTGGGAC
AATGACACAAGGGCCAGGAAGATTGCTCCACGGTCGGAAGCCTGTCACATGAATACGGGG
AGAAGGCAGCTGGGATAAAGAAGGGATCACTAAGTCAATGACGGTTGGAGGAATCTTTCA
GGATGGGAGATGTGTGCTAAAGGTAGATAAAGGACCAAACGTGACGGCCTCTCAGTATCT
GTATTGCAAACTGTAATGCCCAAAAGTAGAGAGAGAGTATGGAGGAAATTGCCGTAGAGG
CAGGCGGAGGGTTGGAAAGGCGGGAGGGGGGGAGGGGGTGTTATACTGGGGATATTGGTG
GTGGAGAATTCGTACTGGTGGAGAGATGGGTGTCCAGTTATTATACAACTGAAACTCAAA
TGTCAAAACTATGCAACTATTTCACGATGATTCAAAAAAAGTGCCTTTTGAAAGAATTCA
CACTTCCACGCATTCCTATGAAATTATGGAGAGGTTCGTGCTGTGGCACCCAGAGGTTGC
GGGGTCCGAGAGCTGCCACGGCCCCATCATCCCCATAGCTGCTAACGCGCCGCCACAATC
TGGGCTCTGAGAGCTTTGAAATCTTCAGTGGTTGAGAATTCATGGTTATAGCCAAGGCGA
ATTTTAACATAGTTTATTTTGATTTAAAACAAGAATAATTTTCTTCTTAGAGCCCAATGA
AGTTTATTCTTGTCATTGTCTACCCATAGTCATTAAATTTTTCCTCATTGTTGGGGAACT
CCCATGACAAAGTCTAATATGACCTTAAAATATTCTCGAGATATCCTTTGGAAATTTTTC
ATGTGCGCTGGTGGCATATTGTTTTAATCAAGCTAGTAATTCCAGTTGCTTTTAAAGAAT
CATATATTTAAGAAATACTGGCATTTCTTCACTCGTTGTGAAATGATCTGAATTGGTGGG
AACCAAGAGTCAAGAACACTTCAACAGGATTTTGCTATCAGCAAATCTGTTTTGGTTTCC
TGTTCTGGCCTCCCTACCTAGCGACTACATTAATGCTCTCACCATTACGTTTCTCCTTTA
TTTTACCACAGGAAGATTGTCAGGCCTCTTTTTCTAGCATTTTCAGGACCCGCCTGACAG
GAAATTTTCTAATTGCCGGAACAGCTGGTAGGAGAAAACTTTACAGGGGCTTGGTCTTTC
CTTTCTAGCTTACTTTTTTACGGTCAGAAATTCTTTTATCACCATCATGGTTTCATAGCC
ATGTTCAAGTTTTTGTCTTTCCGTGTTCGCTCTATTCAGGTAAGCTTTGTTTGATTTCTT
TAAAGTCTAAAATGTTTTAGTTGGAGCCAAGTATAATTACGCTAATTAAACAATTACTTC
ATTTATCTGTTATTTTAAGAAGCTTTTCAAAATTCAAAACCAACTTTTAGAAGAACTTGT
AGAAGATAGTATTTCTGTGAACTAAAAGTAAGCCAGTTGTGTATGGTATACTTTACAACT
CTATATATCTCGTAAACTTATTTTTGCATTAGTTTTTTAATATTATGGTCATTTAAATCT
TGTTAATGTTTGTCTTTTTTTATAATAAAACAGATAACAGTTTTAGTCCAGGCATGAAAA
AAATTGTGAGCTTACTGACATTTAGGAAATTACAATAATGTGAAGAGTATTTTAACAGAG
AATGTATTATTTTAAACAGACAACTTAAAATCAAACTTAGTTAAAATCGATTTCTTCAAA
ACCTTGAAGTTTTCAATCAACTATATTTAAGTAACTTTAAGCAAGTAGTTTTATTTAACT
TGGCGTAGACAGAGTTTTCAAAGCACTCCTTTTGTTAAAGTATGCTTAGTGGATGATATT
CTGGTATTTTACCATGAGAATTGGGGTATTCTGCTACTCTTAAAGAAAATTAAGTGTGCT
GTTTGTGATTCCTGAAAGGGAGAAAACTCCATGATGTTTATGGTAGTGATTGAGAAAGTT
AGTCTAGAGAATTAGCGATGGGCTTTTCTTAAACATAGAAACAGGAAACTGGTTTGAAAC
ACTATCTTGACAAATTTGGTTAAATGAAAAATGCCAACCATATTTATCATCTATTAAATG
CAAATAACGTTAATTGGTTTTAGTTTGTAATCTAGAATAAATTAATGTGGTTTCTCACTA
TGATTTGAACTCATCTAAGTATATATCATAGTCTGATAATTTTATATATACTGATCTTTA
AAACTACTGTATAACATAAACCTTAAGTTTCTTTGTAGAGAGTGATACTTTAGTTTAGAA
ATATATTTAAGATATAACATCTATGCTTTTCATTTATAAGTTCAGGGGGAAATTTCCTGG
ATTTTACTAAGGAACATTTATATACTTCAAAATATAATAATAATATTCTCATATTCAAAA
CAATTAGGAAATACGAATGCCTTAAGAACACACTTCCTGACTCAAGGGAGGAGAGGAAAA
AGGAAATTATGTATACAAGGCAGGGCATAATGCCAAATGTTGACTCATTCTTTAAAATCA
ATTAATACCATCCTGCTTATTTTCCTACATTTTAACACATTACCTTATTATTATTTAAAT
ATATAGCACTGATATCAGTTCGCTTCATCCAATTTTGCATTTTAAGAAGCAGAATTGTAT
TTTCCCCTTTCAAAGAGTAAAAAGGAAGCATTGAGTTAACTTTATCCCATTAAAAGGTGA
ACCATAAAGGCTATTTAAGAGGAAAGTAACAAGGTGACTTTCTGTGTGATGAAAGGATCA
CCTGTTCAAGAATATTCTGCGCTTTTTTCTGTAGTGTCCAATGTAACTGTTCTGGACATT
TTCCACAGTGTTTACTTATGCCTCTTTATAACAACAGTTTGTTTTATTTGTACAAGAATC
ATCCCAACTTGGATTTATTTAAAATTCTAGATAAGTTCCTAAAGGACAAATGTGCCTTAT
CTTGGTATGTCTAATACCTAGCGTAGTACCTGGCTGTTCTCTCAATTGCCTTCTAACAAA
AAGGAGTGGGACTAGGAGAATATGTCATTGATGAGAACATTTTCATTGGGACCAGGCTAT
CAAGAGCATGGCAGCCATCTGAATTTTAGTCCCGTCTCTTCCTTGGCCTCCACACCAGTT
CAAACACTGGTCTCCGTGTGTGTTCCCCCTCAGGCCTTTGCACTGGCTTGTCGCGTTGCA
GGGAACATTCATTCTTCTGATGTTTGATTCCCTCAAACATTAGAGTCTCTGTTCAAGTAG
CACCTTGACAATAAAAGTGGCACTCATTTAAAATTGTAAAGCTCCCTTCCTACCTCTGTT
TTTCTGATCCCTTTTACCCAATTTAATACATTTTTCTATTGTATTTACTATGATCTAACA
TGATATCTTTAATGACAGTGGCAGTGATATCTTTCCCCCAAGCGGCAGAGATGACTATAT
TAAAATGGAAACTTGTAAATTAATATATTTTAAAATTTTAAAGAAAAAGGCTTTTATGGT
AATGAACAGCCACATAAAATAACAGCTGTGGCATAAAGGTAAAAATACATGAGCCTTAAA
AATTAAAATGGGTATAGCTTAATATCTAAGCCACGTTGCACTGGCAAAGTTCTTTTTACC
ATAATAATATATTTTTTCACAGTATACTTAAAGGCAAAAACATAATTTTACAAACTGTCA
AACTTCTGTTTTCATGTGACAGATTTATTTCAGTAACAGGTAATTTAGTGACATAAGACG
TGTTTTCCACACATAGTTTTCACAAATGTCATCTGTTGTTGCGTTATCACCGCCTTCAGA
AGTTTGATACTACTCTCTGCAACTACAGTGTTGGTTGGATTCCAGATATAATCTGCTTTC
CTGCCTATTGTCCAAAGATTAGAATTATATGTCTCAGTTGAACCTCAGATTATTTCTAAA
GTACTCATGGCCCCATAAGTCAGAAAAACTGGTAACCTTAAACACAGTCTAAGCATCAAG
CTACCAAGTAAGGATACTTTGCCTTTATGTGTATACATAAGTGAGATGAAAATAGTTTGC
TGCTGTGATTAGGAAACTTTGAACTTGGAATGAATGGAAGAATGTGTAGAGAATAAAACA
GGGTCAAGTTTTTGGAAATGTGGCCGTCGGCAGTGATGGATCATTTTTCTTAACCTCCAA
GAACATCTTATTACTCTCTAGACCCTAATGCAGAAGATTTTTATCAAATTTTACTTTAAT
ATAAGATGTACCATAATAACAGAATTCAGTATGAGAGTGTGGTGATAAAAATCAAAGTAG
CTTCTCAGAATATAGTCAGAAAATATGAGAAAGAAATAAGAATCAACTGTAGACATAAAG
TTTCCAACTTATACCGGAATTGCAAAAATGACAGACCCTTAAAAATGGATTAAAGGTAAT
TATCACAGAAAAGTTAGATTTCCCACAGAAATAAAGAATTCTGTTCTCTTGGGGCGGAGC
CATTTACAGTAGGTAAGGTACTTTCCTCTCACGCAGCTGACCTGTGTTCAATCCCTGGCA
CCCCAGTGGGTCCCCAGAGTAGTACCAGGAAATTTCTCCAAGCCTCCAGAAACAAATCGG
GCGTGGGGGGAGCCCAAAGTGTATACTAGGCTGCACCACCTCTCAATAGCATTGGGTTCG
AGAAGGCCACAGACCAATGGTGACAACATTCAGAGGCAAGGTGACTTTTGGTTCTGCAAT
TTGATACTAGGCCAGTACCACGCAAAAATGGAAGGCAAAATAAAAGCATTTCCAGATGTG
TGAGGTTCAGAGAGTTTCCTGCCACATAACCTTTCTTAGGAAGTTCCCAGGGAGTAACTT
AAGGAGGGAGAGGGAAAGAGAGAGAGAGGAAAAGAAGAGGAGGGGTGGAGGGGATAGCAA
CCAGGAAAGCACTCAAGAGATATCCTGAGATAAAGCTGTGCAGCAAGGCCTAGAGAACAA
TCATTCCCAATGGGAGGGTAAGGAAGGAATCTCAGAAGAATGGAAAATATGGTTAAGGGA
TAATGGATGCCTACGAATCATTGTGAAATTAACCTGCCCCTCACAAGGACTATGGAGGCT
GCTAGAAACAGGGAAAATAGAAAACTGTACAAGAAATTCATGGTCCAAATGGAAATAGAA
ATAAAAGATATTGTGAATTAAAGCATTTGATGAAGTGAATTTTTTTAAAATAAAACAGTT
CAAGAACAGGAAATATCCCAGGTTGGAGATAATAGCAGGAAGAGAAACTATAGATGCCCT
CAAGTGGCAAGGTGAAGTGTCAGTGCATTTTGTTTAGGGAAACTTGGAATATTTTAGCTC
TCTTCGTATGACTGGAGTTTCCTACCTTGAGTTCATCAAGAGGATGAATCGGAGTGGCAG
TGGCAGGAAGGGGTGTTTCATTGTGTTCAGATTATTTGATGGTACCTCTCTCCCAGCATT
AAAATTAAGTCTATGAGTTACTGTCTTGTGATCTTTACCTAATATCTTTAAACTCCAAAA
ATTGATCATTCAAACCAGCTTTGAAAAGTTTTCTCATTTATGGTGCTGTGTGGGGGATCC
TGAACATTCTAAACTGTTTTGGCTTTCTCTGGGGTATATCCAGTATTTTCATTAGCCCTC
TCCAACAGGTACAAAAATACCTGACAGACAGACTTGATACCTGGTATGTGTTACACAGAT
ACTCACTGAGTTTTAATCTAAATATTAAAATAACCTACATTTTTCTTTGAATGTTTTTTT
AAAAATACTTTATTTATTCCTTCCTTTCTGACATAGGTACAAAAAACCCTTATACATAGT
TCATCTCATTTGGAAAAGGGTTGGGGAGGTGGTTAGTACTTGATTCTGTCCTTTTATGTA
GGATAGTTGTGAGGCTTAAAAGAGATGATGAGGGGCTGGAAAAATAGCACAGTGGGGAGG
GCGTTTGCCTTGCAGGCGGCTGACCCAGGTTCAATTCCCAGCATTCCGTATGGTCCCTCG
AGCACTGCCAGGAGTAATTCCTGAGTACAAAGCCAGGAGTAACCCCTGTGCATCGTCAGG
TGTGACCAAAGAAAAAAAAGAGAGAGATGATGAATATAAAATTACAAAACCAAAGACAAA
ACCATGTTATGGGTTGCATTTGATTTTTGTTTTGTTTGGGGGGTTGGTTTGTTTGGTGGG
CCATACCCAGCAGTGCTCAGGGAATATTCCTGGATTTCCGGTCAAGAATTACACCTGAAG
GGCTTGGGGGGATCATATGGGATGCTGGGGATTAAACTAGGGTCGGCTGTATGCAAGGCA
AGCACCCTCCCTGCTGTACTTTCATTCCGGCCATATGGGGTTGTTTTTATTACTTTTGCC
AAAGTTTCAATAAGTTCAAAAGAATAAAGCTGCATACATACTTATAACCTTTATTTTTCA
AAGCAAATAGAAAGAAAGCCTGGATTTCCTCCTTGTCTTTCTACAAGTGCTTTTCTCTCC
TTTTATTTCTTATTTTCAAGAGTTAGCCTATTTGGATACCCTGAGAAATCTCTGTGTTTC
TCTCTTTAATTTTTTATTTAATTAAATAATACTGATCTACAAAATTACTGGTAAGTTGAG
TTTTAGGCATATAATATTTCAACACCAAACCAGTGTCCCCTTCCCTCCACCATTGTTTCC
ATTGTCCATCCTCACCCCACGCTTCTCCAGCCTCAGCCACCATGTCCGGCACATCGTGAC
GTTCTGGTAGTTGCAGTTTAGATCTCCTGTCTTCCATGTCATGGTCTGTGTTTTGCATCT
GGAGCTGCAGCACCACTCTGCTACAACCCCAGTATAACTGAAGGCTCCCCCCTTCTTCCC
ATTACTTCCCTTTCTCGTCTTCTTCCTTCCCCTCTACCCCCCTGATTTCTTCCTCTCTCT
GTCTTTTTTTCTCCCTAAATTCTGGGGTCAAGGGTGCTCTAGGTGTAATTCCTTTATTGT
GAATATTCTGTGTGTAGGAAAAATGTTAATTGATCTCAAACAACTATATGGAATGCAAAA
ATAACAAACGTGATGAACAGTTTGTATAAAACTTTGAATCTTGTTAGTAATACCTGTGCA
CCTAAGATTGCATGCCCCAGAGGTAAAAATGCTCCTTATTTCTGGTTTCATTGCTAGAGT
TTTGAAGTATAGTATATAGTACCTTGATTTTAAGTGTTCTATGTAATTTTTTATGTTTTA
GCCTTTCTTTTCTACTTCCTTTCTTTAGAAAACCAAAGTGTCCATTGTCTTTAAATTTTC
TCCTCTTAACCTGGAGATCAGGCCATCATGTGAAACAGTTTTTCTGTGTCTAATCATCCA
TCCAAATTTTAGACTTTTTTGGTTTTAAGTTTTAGAGTGACTCTTTTTTTCCCCTATCCG
ATCACAGGTAGCCTTGGGACAATACATCATCTTAGGTATTTCAAGCAGAAAAGAAAGTTT
TCATATTTATTCAAACAAGCTTTCTGTGGTTTAAAGTCTTCATATTTACCCTGAAGTGCT
TTTTTCAACTACACTCCAGTAAAGAGGGTTTTTCAAATGGATGTTAGTTCTGTCTTGTAG
GTCCACATATCAGAGAACAACTCAATACTCTGGTGTTTTGATATTTCTTTGTTACTACTT
TCCTCATCTTATGAAACAAGTCTAATAGTCCTTAGTAGGTAATGATGACTTGGAAATACT
CAGTACTAATGTTACACAGATGTTAAATTGGCCTACCCGGTAGACTGGTTTTAGTCTAAC
TTGAAAGTATACTTGCCTGGCATGTTCTACTTGGTCAATTAATGAAGGTGGTTTGAGGAT
ATATAGCATGATATATATAATATGATATGCTAAATTTATATTGCTTGGTTGTGAGAGAAC
ATGCCTCTAACTCTTTTCTGCCTTATATTTGCCTAATAGGAAGAAGGCAGTATCAAAGAA
ATTGCTATCACACATCATGTGAAGGAAGGACATGAAAAGGCAGATCCTTCCCAGTTTGAA
CTTTTAAAAGTGTTGGGGCAGGGATCATTTGGTAAGGTAAGTCATGAACACATGCTTTTC
AAAATATTTGTTTTGGAAATTCGTGTGTATGTATATTTCATGCACATAAGAAACAGAACT
ATTTTATGAAATGCTACTAATGGTTGGTTTTCTGTGTTTTTACTTTTCTATCAGTAAGCA
TTTACTTCAGTTCTGGGGTGTTATTTCAAATGAGTCCATCAGCAAAAATGTAGTACCAAA
CACTAAAGGAAATGGGGCCGGAGCGATAGCACAGGGGGAGGGCATTTGCCTTGCACATGG
CCAACCCAGGTTCGATTCCCAGCATCCCATATGGTCCCCTGAGCACCGCCAGGAGTAATT
TCTGAGTGCAGAGCCAGGAGTAACCCCTGAACATGCCGGGTGTGATCCAAAAAGAAAAAA
AAAAAGTAAGCGTGAGAAAGTGAATAAAATCACTGAGAGTACATTGAAACCTTTTAAATG
TTACAGTATTCATACTATCTCCATGACCTAGGACTTCTTTAAAAGTGCACATGTTGAGTT
GATTAAAAATCAGAAGAATCAGAAGATATGCTCTTGATGAGCTTGGTCACTTTGAGTCTC
CACGAAGAACTGGAGGGGGATCTAGCAGCATATCTCAGTCCTCCATAGGGTCCCTAATCC
AGCTGAATGTGCATGGGTACTCCCAAGGAACTACGGAGGGTAGTATGTACCTTCTAATGA
GAATGAAAGTTTGGGAACATATAACATGTCTTTAAAATGAGTGCACTGCTTGTATTTTAG
TCAGTGATGTTCATATTTATTTTAGTTTCAAAAGTGTCCCAAACTAAAACAAATCTACTT
GGTCCATTTCTCATCAAGTGAAAAATTCAGCCTGCCTTCAGCTTTTCACATTGCAAATTC
TTCCTTACCACCTGTCAGTGAGGAATCATCTGAAGACGTAATGCTTTTACAGGCTTCAAA
ACACTATCCCTTAAATAGTCCCCTTAAAACCTAAGTTTAGCACTCTTATGTGTTAAGGGG
ACTATTTAGCAGTTCTTAGTTAATAGTTCCAGCTGTTGACCCCTTTCAAACCCCAGGTTA
TACTTTGACCCAAATATAGATGAAACAGCCAACGAAAATAATGGTTATAAGTTTAGACTT
TAGGTCACCAGACAAAGATTCCATTTCTGTTTACTTAACACATGTGCTTGTGCTCATTCT
CAGCCTTTGTAGCCCCATGTTTTCCTTTTCTCTAATGCCTAAGTGTTAAAGTTCTTCAAG
GTTCCATTCTAACCTGCTTGCTTTCTCTGTCTCTCTCTCTATTCCCTATTAATTGTTTTT
TCCGTACCCACTCTCTTAATTATAACCCACATACAACTGACATAACAGATTTCTATCTCC
AATCTAGATTGTGCTTCTGAGTTTTGAATTCTATGTATAGCCTCTTATATTTTGTTCATG
TGGTATGCTTCAACGGCACATCTTAAAATTAGATTCTTAAAAATATTTTATCTTTAAAGT
CTAAGATGGGTAAGACCAAAGTCAGGATGACTCCCTTACCCCCAAACCTGCCCTAATGAA
TTTTTCCCTATTACTATGACTAGCACCAGTTAAAATAAGCGAAAAAATTGGAAGGCATTC
TTGACATAGCCTCCAGTCCCCAGCTTTTTCTCCTCCTCCACCATCTGCCGCCAATCTATC
TGATCCGTCAGCAGATCTTGTGGACTTAGTAAAGGAATCTCAAATCCTCCCTGTCCTCTT
CTCCCCTGCCACTCCTCCAGTTCGTGTCACCACCTGGTGAAGGAGGCTGCTCCTTCAGGC
TTAACAAATTTATTGTCGCCTCAAGTATTTGCATGATAGCCAATTCTTGTTCATTTTATC
CTTTTGCCTCTTTACTCTTTAATAGCCTACCTTTGCTTTTTGGATAAAAAATCTCTTAAG
ATATAAACAAGGGCAAGGAGGACTGGTCAGTGGTTGGAATCTACCACAAGTGTGTATGGG
GCAGAGGGGTAGGTAAGATAGAGAAGAAACCAGTATGACAATAATAGTTGGAAATGATCA
CGGTGGACCAGAACTGAGTGTAAAAGTAGGCAAAGCATATACACTACAACCTTTCAGTAC
CTGAATGCAAATCACAGTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
GCCTGCCATAGGGTGGGTGGGCAGTGACAGAAGGAAATTGGGACACTGGTGCTGGGAAGT
GTGCACTGGTGGAAGGATGGGTGTTGGATCACTACGACTGAAACCTAGTCATGAACAGCA
TTGTAAGGGGAAATCTCACTGTGATTTAGCTAAAAGAAAATTTTTAAGATGGCTGAGGAG
GACCTCATTCCAACCCCTAGCTACCTCAATAGCAATTATTTTCTATACTTTTCACTACCT
ATGTTCTGGACATGTTAGTATTCTTTTTCCGTCCTTAAGCACCTGTCTCCCTCCCACCAG
AATCCCTCTATTTGAATCACTCCACCCACCACCACTCCTTCCTCATAGAGGTAGCTCCTT
TCTTTTATTGTTGTTGTTTTGTCTTTTTTTTAACTTAGACTCTCAAAGTTAAGTCTTCCC
TGAAATCCCAACTAGATTACATCTCTCCTCTGTACTCTCTTAGAACATGCGTGCCCATAT
TCATAACAACACCATTTTATTTTTTATTGTATAATTATTTATTGTTCATTCCTGTCACTA
ATGTTCCTTGAGTGCAGGGACCATGAATTGTACTGTGTCTTAGCATTGAACAATTAGTAT
ATTATTCTAGCATATTATTCTACCTATATAAATTACAGACTGTAGGTAGAATTATACCTG
TTCTGTATATATTATTCCTCGCGTATTATTTAAAAAAAGAATGAGTAAATAATCATAGGA
AAGTATTGAGAAGCAAGTGACATTAGTCAAATATATCTGTGATGAGATTGTAGTTTAGTA
CAGAATATTATTCATAAGTCAAACAAATGTTTGCTTGCTATATGTTAGACTTTCAGGAAA
AATAATATTTTAGTTCCCCTAAGTTCACATGCTTCTTCCTTTGTTTCTTTAAATGTAACT
TAAATACTTTACTATAAATAGCAAACATTAAAAATAGGGCGTCTCCTCTCTTACTCATCC
TCAAACGCCACTCTAAGCCAGGGAAGCAGGAGTGACCTGTCAGAGCCTAGAATAGCTGCA
TGGGGGAGTTCGAAAGGGCACATGCTCTCGTGGGGTCACATCCAACATCTGCGCCTGCTT
CTGCTCCTCCTAGGCTGGTGCCCAGCCTAGGGAACAGATTAAGAGTGCCCTGAGAAATGT
AAATCAAAACTACACTCCAGCGTCACCTCCACCAGTGAGAATGTCCTACATAAAAAAGAC
CAGAAACAACTGCTCGCAGGGAAGAAGAGAAAAGGAAGTCCTCACTCACTGAATTCAGTC
TTTCTGGACAGCACCACAGTAGAACTACCTCTCCTGTGTGGTTGAGCAGTTCCATTGACA
GAAGTCTATCCCCAGACCTCAACACTGACTCGAAAAGATGTATCCACACCCATGTTTANN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGATATTTTTCC
TTTCCTCTCCTTACAGTATAGTTATATAGAAATTGTGAAGGTTGGGGTACACATTTTGTA
TGAACACAGTAAACTTAAAGATTTGCTTCTCCCACCTGGGGGTATCTCACTATACATCCC
AGACGACAGTCATCTGACCAGGTTAGTCTATCCTAACCCTAGGAGAGTCCTTAACTCAGT
TACTTCTTTTTGGGGCATGACAAAGTTTGTTCCATGACCGTGCTCCTACCGTTATATTTC
TTTTTTTTTTTTTTCATTTTAAAAATTTTTTTTATTTTTATTTTTTTTAATTTATGTTTT
TATTGAATCACCATGTGGAAAGTTACAAAGCTTTCAGGTTTAAGTCTCAGTTATACAATG
CTCAAACACCCATCCCTTCACCAGTGTACATATTCCACCACCAAGAATCACAGTATACCT
CCCCCCACCTCCCCAATCCTCCACCCTGCCTATGTAACTGATAAATTTCACTTTACTTTC
ACTTTACTTTGATTACATTCAATATTTCAACAAAAAACTCACTATTATTGTTTGGAGTTA
GGAAGTAAGGGAAACTGAAGCTTAAGTCAAGTAAATATAATAGTTGCCCAGGAGTAAATA
TTCTTCGGAGTCAATTAACTCTCATGTTACAAAAGCATAGCATCAACTGTCTTCCTGTGT
CTATACAAAAAGAACATTGCTAAACATGCAAAGGACAAAAATGAAGGAAAAAAGAATATA
GGATTATTAGTGCCTGATCGAATTGGGTGTGCCTCAGGAGCACTGTTGTGAAAGTAACTC
AGTAAACCTAAGCTCCATGTGGGAGGAGCAAGGGCAAATCAATATTAAGCAACAATTACA
ATAGCCCCAAACTGGAAATAACCTCGTGCCCAGCAAGATATGAATGGACAAAGAAATGGC
GTACATATACAATGGAATACTCCCAACTTTAAGAAAAGATGAAATCTTAAATTTTGCTAT
AACACGGGTGGTATCTTGAGGATGATCTTGTTAAGCCAAATAAGTTAAAAGAAGTAAGGA
AAATACAAGATGATTTCACCCAGATGTCATACATAAAGCAAGCAAGCAAAGGACTAGTCA
ATATCTATTAAAAACTAACTCTCAGCCTCCGCTGACAGAACAGAGGTTACCATGGAACGT
TGGGGGATAAATAGGCAGGGTCCTGTGGACACTGGTGGAGTGGTATTAGCATTTTGATAG
TGGGTGTGGTGAGGAACATGGTGCTTGTAAAACTTATAAATGATCTCCTGAACTGGGAGT
GGACCCTGGTCCCCCAGAGTTCCACTTGGAAGGCTCTCAAAACAAAATTTGAAAACATTT
CCATTCCTGTAAACCACTGTTACCTCAGTCATAAAATTATTAAATAAATACATTGGACAT
TACCCAGGGAAATGAGTCGGTCACAGAAGGAAGGAGATGGCTACAGAAAGATCTCTCATA
TGTGGGACTTTAATAAGATCTACAGCAAGGAAGCAACAACGGGCCAAGGGTGAGACGACA
GGCAAATGGTCCTTGGGGTCCTTGGGATAGGGAGGTCGGTACACTGGAACTAGGTGTGGT
TTGGAGCTACGTGCATGACAAACCAATATTACCAGTATTGCAAACCACAAAGTCTCCAAT
CATTTTTTTAAAAAAAACTTTTTAAAGTAACCTGAGCAGAAGCAGAGGATTGGGTGCCTC
TCAATATTAGTCCTAATACCTCCACCGTGAGTCAAGCAAATTATTTAAGCTCTCAAACGC
CCTAGTTTAGGTAGCCATAAACCTTTTTTTTTATGTAAGTCTACCTCCGAAATAATCTTT
GATCTATTACAAATACTTGGGGAAGTGCTAAAAAGGTGCTAAAGTGCTTTCAAAGATGGA
TGAAGAAAGTTTGGAATTCACCAGGAGAATTTTTTTGTAGAATGTCAGAAAGAAGCTTGA
TAGGGAATCCTAATTATCTCTGCCATTTTAAAACTTATTTCTGTTCAAAAAACATCGTAA
TAATCTTTGATTACCTTTAATGTTTGAGCATCATTCTGCCTTATAACAAGCCACCCTGAT
TAACAATGGTTTCTCTCGGGGCTGGAGCAATAGCACAGCAGGTGGGGCGTTTGCCTTGCA
CGCGGCCGACCCGGGTTCGAATCCCAGCATCCCATATGGTCCCCCGAGCACCGCCAGGAG
TAATGTCTGAGTGCGTGAGCCAGGAGTAACCCCTGTGCATCTCCGGGTGTGACCCAAAAC
CCCCCCAAAAAAAACCAATTTCTCTACATAGTTTGACTCCCTGTTACTAACTGGAAAAAT
AACCAAAAGGTGCTGCAAAGGCAGGTGGGCGAGGGGGAGCAATTTTAGGAAATTTAGCAA
ATATTTAGGATCTTTGCAGAAGTTCTGGAGTTTTGCACTCGATGTCGTTTTCCATTACCT
TTGGCATCATTTCTTAAAATGAGCATCTCTGCCTTGCCCTAGAATCAGTTGGATGAATTA
TGTTTTGATTTTGTACTAATAGCTTGCACACTAATGCAGATAATTGCAAACTGACCCTAA
AGTTAATTCTTTATGATAATTGCATTTCTTCTTCCCATTTGTGGCCACTAATAATACTTT
TGAGAAAGAATGGAGAAGACAAAAGGTTGAAATTCAGGTTCATTTAACAAGTCTGTCCAA
AGGTTTGATTGCAAAGATCATGAAATTAATGGTCAAAAATGAATAGAGAGGATTTATTGA
TATTAGCCATATTGTAACATGACCGTTAATTATACAGAGCAAGTTTTTATTCCTTTTTGC
GTAAATCCCGTAAAATATTTTGAAAGCAATTAAAGGTATTTGGAAAATCGGGATGCTTAA
TAACATACCTAAGAATTGTGCTCTTCATACTTAGGTAGACGGTAATATGATGTGGAAAAG
GGTGAAGCGGCAGGGATGTGACTAAGTCATGATAAATGTTAAACATGTTAGACTTTTCTT
TAATTGCTAAATAGCTTAAAGGTTTTTATTTCTGTTTTCTATATTTTTTGGTCTTTTGGA
AAAGGCAAACAACAAAAAGAAAAATATATAATTCATTCATTGACACCCAGTTACAACCCT
GCTTATAATTATAGTTGATCCATTAGGAGGAAAACACAATATACTGTGTATCTCAAAATC
TTACTGGTAAATAATTGTTACTACCCAGGCATATATACAAAGGGAGGTGTGGGAATGTAA
CTGAATGCAGCCTCTATGGAAATCACTATGGAGATTCCTTAAAACATCACTGTCACTGCC
ATCCCATTGCTCATCTATTTGTTTGAGTGGGCACCAGTAATGTCTCCATTGTGAGACTTG
TTGTTACTGTTTTTGGCATATCAAATATGCCACGGGTGGTTTGCCAAGCTCTGCCATGCA
GGCCAGATACTCTCAGTATCTTGCAGGGCTCTCTGAGAGGAAAGGAGGAATCAAACCCGA
GTCAGCTTTGTGCAAAGCAAATGCCCTACCCACTGTGCTATCGCTCCAGCCTACCTTAAG
ACATAAAATTGGAAAATCCTGTGACCCAGCAATAATACTTCTTAGGCATTTATCTGAAAG
CCATGAAAACAAATAACTTGAAAGTATATTTGCACCCCTATGTTTATAGCAGCTTTACAT
AAAATAGCCAAAACATGAAATCAAACTAAATAATCATGTAAAGATCACTGAATGAAAAAG
CTGTGGTGTATATGCTAAATAGAATATTATTCTGCCGTAAAATGATGAACTTGTGATTAT
ATATGAAGTAACTAAATCAACACAATTATCAAATGTTTTTTTTCGTATGTAGAATGTAAG
TCATGCGAACAGACTCCCAGAAGTCAATAAAACTCGCTCCCACCCTGACTTGGTGACAAC
TCTGATTATTGGAGGGAGAGGGAAGGATGGGTGGACGGAAGGGGTAGAGATGTATTTTAG
ATGGTAGGATTGCACCGGAAGTGGTGGGGTTCACATAATGAGGTATAAAGCTATATCCCA
AAAGTTTTGCAATGTTCAGATTAATAAGAAATCATTTTTAAGACAAAAGGGTGGCATTAC
TGTTAAAAGCATCATCTCTTGTAGTTACAAATTTTGTGGTTTTATTCCCAGTTTTCTCTC
TCTCCCTCCCTCTCTCTCTCTCTTTCTCTCTCTCTCTCTTACCAGTGAAAGCTTGGCAAG
ATGCTTACCCATTTGATCCCTGAGTGGTTTGAGTGTTGGGTTTACACCCAGCAATATTCA
GGGCTGACTCCTGGCAGACTCAGGGGACCATATGAGGCTCTGGGGATGAGCCCTGGGTGG
GCCGTGTGCAAGGCAAAGACCATACCCTCTGTACTGTCTCTTTGCTCCCCTTGGGCCCTC
GAATTTTTATTGCTAAAATTAAGTACCGTTTCCATTCATTAGGTATCGTAATCCTTGGGA
AAAAAATTGAGTTTTTTCTGTGATCATAAAATTCTGACAAGTGACTGAAAAATAGATGAT
GAGTATTTTAGGCAAAGGGGAAAATTGCCATCTGGATGGCTAGATGAGGGAACTGGTGTT
ACCTACTAGAGAACCAGAAATAAGGCCAGTTTGGCTGTTTTTTACACCACTCTCCAAAAC
CGGCATTTCTTGAAAACAGCAGCTAGCAGTGTGGATGCTCAGGGACTCTTCCCCATACAC
TGCTCGCGGGTTACCCTTGTCGGGGCTGCTCAGGGGGACGTGTCAGACCCGCTTGGAAAC
CGAAGCCTCGGGCCTGCGCAGCGCGTGCTCCCGTCCGTTGAACTGTCTCCGTCACCCAGA
CCTTTCTGCTAGGAAATGATATAATGGCCAGGGCCATGGAATACTGGGGTAGTGGGTGGG
TGACACCGTGTAAACTGTGTTTTTTGAAATGCAGGTTTTCTTAGTCAAAAAAATCTCCGG
CTCTGATGCTAGACAGCTTTATGCCATGAAAGTGTTGAAGAAGGCCACTTTGAAAGGTAA
GTGCTGCTGCTGTTTAATGTTCGTGTAGTATAAACACGCTGCAAAGTCTCAGTCGATCTC
TGGAGAGCCTCAGGCTGACTACTTATATTCTGAATATGTTCCTATTACTGTCTATGAAGT
TGGACTGTTTTCTGGTGGGGCTTGGAATTGAAAGCCGGGCCTCACGCACGCAAGGCAAGT
GCTCTACAACTGAGCCATTTCCCCAGCTCACTTTGAACTTTTTTAAAGTGAATTTTTACT
ACTAGAAATCGCATGAATAGTAAGGTTATGAGTTGCCTAATTATAAAAGAAGTTGCTATT
ACGCTTCTTGGATTTGAGACAATATACCTTTTCTTCATTTAACTTTTCTGATTTTGAAGG
AACCAATCCAGTAGCTACCTCAGAAGTAATGAACAGATGGCTATTTTTTTTGTCAGCTTG
CATATCTGAAATTGCCTTTATTCTGCCTCCCCTGTAATTTGGCTAAGCATAAAATTCTAG
GTCAGAAATAATTCCGTCTGATATTTAAATGCATTGTTTCCACTGTCTTTTGTTTTTTTG
TGTTGCAATTACCAAGTTTATTACCATTCTGATTCCCAGTCTTTTGCGTGTAAGTGGCTT
TCCTCTTTGAAAGTCTTTCTCTCTATTCTGGATCCCTAGGGCTCTTAAATTTATTCGTGG
TGTGTCTTTAGTTGGAGGTTTTAAAATGCATCACACTACATATGAAGTAACCTCTGTTAA
TCTAGAAACTCAGTTCAACTGAAAACACTTCAAAAAACTTTGGGAAAAGTCTTTTACATT
TCTTCTCTATCCTCTAGTGGCTACTCTTTGAATATATTCTAGATTATTCTTTAATTTTAT
TTGTTTTTTTTTTTTTTTTGCTTTTTGGGGGTCACACCCAGCAATGCTCAGGGGTTACTC
CTGGCTCTGCACTCAGGAATTACTCCTTGCAGTGCTTGGGGGACCACATGGGATGCCGGG
GATCGAACCCGGGTCAGCCGCGTGCAAGGCGAACTCGCCCTACCCGCTGTGCTATCGCTC
AGGCCCCTATTCTTTAATTTTAATATTTTCTAAGAAATGTCCTTAACCGTTACCTAGTTA
TTCTACTGAATTTTGAACTTTTTACAATATTTTGTATTTTCTTATATTTTTCTTGTCCCT
AATCTTTCTATGTTAAAAAATTTTAATAGGGGCCACAGCATTAGAGCAGTGGGTAGAGCA
CTTCCCTTGCATACAACGGACCTGAGTTTTTATTTCTATATATAAATGTATATTTGTATG
TATACATAAAATGCTTATTTTTAATGGAAAATATCAGACATTTACAGAAAGAAACAGAAT
AGAGAGAAATCCCACATCACTTATGTTTGCTTCAGCATTGTACATCACTAATCTCCGCTT
CACCATTGTTCAGCCAAAGACCATGCCTTTTTCATTAATTATTCTTCTTCCCCTGTGGTG
TTATATTGAAGCAAACCCTAGGCATTTTATAATTTCTTCCATAACTGGTTTAGAACGTAG
CTCTTACAGAATCCTAACAGAAGTACACACTTTGTGTTTTGCCTTAAAATGCTATATAGT
GTTCAAATTTTCTTTTGTCCCTATTTTTGTATCTTGATTTTTTTGTTTTGCAGCTATTAA
ATCAGGATTCATATAAATGTACGTTTTGCCATTGGCTTTTCCTTTTTATCTCTTAGTTAC
CTGTCTCTAATTCCTTTCATTTTATGTTTGCTGTTTACTATTTGGAGATACTGCTTCCAT
CCACCCCACTGCTTTTAATGTTGCTTATTTCATGATTGGCATATTATCTTTTTCTATCTC
AGTAGATTTAAATTGTATGGTTGGATTTTTAAGTTTTCTTCTGTTTATATTCCATCTATT
CCTTTTTCTGTTTATTTTTATAACTGATTATGTTTAGAGCCATTCTTCAGATGCTTGTGG
ATTTTTATATTTTTCCTGGGTTTAATAGTAAAATACCAAAAATCCGGTTGGAAAGGGTTG
TATGGCACGACTTTGCTTTTTTCTCATTGTCTTATTTCCCCGAAGCTTAGATTTTAGTTT
CTCTGATCTGCTGTGTGAATCACTTGTCTTCTTTTTCTCCTATCCTTTGTCATCGTGAGT
TTATGTATAATTGTTTCTAAAAATTTCAATGGGATTTTGAAAGAAAATAGGTGAAGCATT
CATATTTAACTAGGGTTTTTTTTCCATTTAAAAATTCTGTAATAAGTAGAGTCAAATAGA
AGTCGACAGCATTGCATTGAGTTTATGAGAACATTTGTCCTACGTGTTCTATGGACCTAA
AAGTAAGCCATCGCTTAAAAGTTGTCTAATAATCATCCTGGTAACATTGATAGTATTTTT
TCTTGTTCTGTCTCGTGTTCAAATAAAGGAGGATTTAAAAATTTAGCGATTATTGGGGCT
GGAGTGATAGCACAGTGGGTAGGGCATGCATCGCCGGGTGTGACCCCAAAAATAAAAAAT
AGTGATTACTGTATAAGAAATTTCAGAGGAATGTAGTTCCTTTGCCAGCATTAGTCATAT
TAACAAATCCTACTTAAACTTTATAATTCAGCCAATAAAAATATTCCTTCTTCTGGGGCT
GGAGCGATAGCACAGCGGGTAGGGCGTTTGCCTTGCACTCAGCCGACCCAAGTTCGATTC
CCAGCATCCCATATGGTCCCCTGAGCACCGCCAGGGGCAGTTCCTGAGTGCAGAGCCAGG
ATGACCCCTGTGCATCATTGGCTATGACCCAAAAAGCAAATAAAGAAATAAATAAACTTT
AAAAAAAATATATTCCTTCTTCTGAACCATTCTATCCTTAACTAAATTTCTGAATGTGGG
CTAATTTATATTTTTCCCCTGATACTTACATAAGCAAAATAAACCATATTAGAATTACTA
CAAAGTCCCCCCTTAGACAACATGAAGGTTTTCTTTTTGAGGGAATCTTAGTATTTATTT
TCAACTAAATAAGATCTTACCTATATATAAGATGAGGAAGCTATCTCACAAGATAATAAT
TTTTAAAATCATCTTGTTCTGGCCCCTTATTTTATAAAGAAGGAAGCAGGACATCGCTAA
GCTTTGAAAAAAATGTGATCAACAGTAATTCAGCCAGTTATTTGGACGACCATTAAACTA
TAGTTCTTCACTTCCAAGAGTCAAGAAAGAATTTGCTTATTGCAGTAAGATAATAAAAGA
AAAAGAGTAAATAAATTGATAGTTTTGCTGCTTACTAAGCAGAGGAATGTTATTTAAATA
ACAAACTTGGTCAGCTTTGAAATTATTGAAAGAAGTAGGCATTTGGAATCTAGGTTTATG
ACAATAGGTACCTATTTCAAAATAGTATATACTGAGGAAAGAGCAGATCTGGGCTAGACT
GGAACAGAATTTTCAGTAGGCCTAATGATGAACCTTATTCACATAAATAATAGAAAAGGC
CTGTTTGATATAAGACACCAGAGTTGTAGTGATGGGATAAGATAATGAAATCTGAGATTG
ATACTGAATTTAATATACCAGCTGGGCAAGTAGTCAAAAGAGCAGCTGCATAGACATCAA
GAGCAATCAGTTCCTATTCCTCATTTGCCCATTTTCAGTTACTGGCACAAAATACTCATC
CAGTTAGAGGTAGAAAAGTAGTAGAATGGAAAAGAACTGGAATTGTATCTTTTTAAAAAT
TATTCCCCCCAGAGGTCCTATTTCTGTCTTTTTAAAATCTGTGGTCACCTAAAATTGAAA
AGAAAATGAACTCATCTTTCTGTGTCCCCACCCCCAACCTATTCTTTCTGTTTCACTTTT
GGCACAGCTATTCAGTCACTCTAGCCAGAAAAATAGAAGTCATTTATGATTTAACTTTTA
TATTATGCAAAAGAAGAAAAATAATGGCCATTCCCCTTTAGAGGTGAATCCATTGAGGTA
GTCAAGACTATCCGAATATATTCTACTCATTTCTTTGCTGTCATTCCCACCTGATTGAGC
TTCTTTTTTTTTCTTTTTTTCTTTTTGGGTCACACCCGGCGATGCACAGGGGTTACTCCT
GGCTCATGTACTCAGGAACAAAACACCCTACCCACTGTGCTATCACTCCAGCCCCCTGAT
TGAGCTTCTTGAAAAAAAAACACACTTTTTAAAAATCTCTTTAATGCCTCACAAATAGAA
TTTGTTTAGAGAGGGGTTGGAGCAATAGTACAGTGGGTAAGGTGCTTGCCTTGCACATGG
CCAATTGATATTCTATCTGTGGCATCACATATTGTCCCCCGAATGCTCCCGGGAGTGACT
CCTGAGTACAGAGGCAAAAATAACACCTAAGCACCACCCCATGCGCCCCCAAACCAAAAT
AATTAATTTTTAAAAATTGTTCAGAGAATGGTAAAAGAGAGCTTTGCCTATCAGGTCAAA
AAATTCATCCTGGTATTTTAATTTTTCAAGAATCTGGGTCTTCACTTCTTCTACTCCTGG
TAGTAAACCTGTTTCCACGCTCTGGTTCCTTCCGACTAGTCATACATGCCCCCCCTCCAT
GTTCTTTCCTGCGCTAATACTTTATACCTCAACTTGACTCTGTAGGCTCCACTCTTCCCA
CTGAGCCTTCTAAATTCCATTCTAAAATTCTTAAATGTGTACCCTACTGCTACCTCTTCT
CACTGGCCTTCCTCTACAAGTAAAACGGAATTATTCTCTACTACATAATTTTGTCGTGCT
GTGGTTACCATTTTGTTGGATATCTCATTCAACATATACCAGTTTCGGGATATGCAAACC
TTATCCCAGATCTGATCACACAGTCCCCAAAAGTACAGAGATGTTATCCCTGTTTTATAG
ATGAGAGTTAAGAGATGATGAGAAAATTTAAATAAGTCACTTGCTCAAGATTACAAAGGT
ATGAATCTAGATTTAACTCCCAAAAAAATCTGTTTGTTCAGTTATATCACAGTATCTTCT
TTTTTTTCCCTTCCTTTTCCTGTCAGAATAAACTCTTTAGTTTATGTCCTTCACGAAATC
TACACATTTCCTATACATCTAATGAATGTTGTTCAACTTGAGTTCATAGGAGTAGAAATG
GTAGAAAACCATTCTACCATTTAATGCTTTTGTATTTTATTGAGATGCCTTGTTTGGAAA
AAGTAAAAGATGCCAAAAATGATTTTGTTTTAAAATTGTCTCTGAAAATTATCTCATTGT
AACCATATTCTCATTTTTCTGTAGTTCGAGACCGTGTTCGGACAAAAATGGAGCGTGATA
TCTTGGTAGAAGTTAATCATCCTTTTATTGTCAAGTTGCATTATGGTAAGTAGTGTACTT
CCTCCCACCTCATCCTCTGCTTTCCTGAGTTCATTTAGATATACTATTATATAGAAACGT
ATATTTGTGTGTCTGTATGTGTTTAGCAAATACATATAAAATCATGGAAATAAAGCTATT
ACTTCTTAGACAAACTTTGGAAGCTTTGTTTGCATTAGATTTTGTTTCTTTTAAACGTTG
TCGTTTCTGAGTCAGCCATATAAACTGTTAACAATAACCAATGGCTTTTGTAATAATATG
GCAGCATTTTATCGTGTTAGCCCAACTTCAAAACAAGGACGCACCTTATGCCAGATTTCT
GGCATTTTCATCACCTTCCTTTTCTCAAAGCCACTTGTGCTGTATTTTTAGTGTGTAAAG
GTATACTGATTCTTACCATGTATAATTGAAGTTGAACAGCCTAAATTTTTGTGTAGCTAA
GTGAAAGAGTTTTTGTATTTTGTCTCATGGTTAAATAAGTCCCTTTTCTGATGGGAATTA
TTCTGGTCTTGTTTTAAAACAACTACATCCTGAGAGACCATTGCCTGAAGAGAGAAGTCT
AACAAACGTTGTAATGGTTCCATAATAAGAAACAATACATTTACATTTCCACACGAAAAA
GAAAGAGAAATCAGTGGCTATCTAATTAGTAAAAATCAATGTTGATCTTTGATATGATCA
TTAATTTACTGAAAATGTTCACTTGTGAATTAGTAGACCTCCTGTGAGCTTAAAGAAGCA
AACTGTGATCATCTAAATGGAAATTTCTGTTTCTTCATTCAGCTTTTCAAACTGAAGGGA
AGCTGTATCTTATTTTGGATTTTCTCAGGGGAGGAGATTTGTTTACACGCTTATCCAAAG
AGGTATATAATTTATCTCTATTTTAACTCTTTTTATATGCATCCTGTTTCAACTAAAGCT
TCATGTTATTTCAATATTATGTTTGTTGTATTTTCTCTAGTGGCATAAGGTGTATATTAA
AGAATCAGATCCAAAAAGATTTCTTTTTAAATTTTATTCTGAAAATTGTACTTTCCATTG
GTAAATGGTTTTTGTCTTCCATCCTGCTTCTTTAGCTTATAGCTTATATAGAAGCAATAA
TGTTTCAATGAGATGCGCTTAAACAATTAGCATGGAAATTCAGCATGCATTTTTTAAATA
ACTTTTATTTTTAAGACGTTACTATGGTGGGGCAATGATGATAAAATCTTAATATAGTTC
CTACACAGTGCATATTCACATTTAGCAAATGTATAGTTATGTTGGCTGATTAGGTGATTT
TTACAAATCTCTTTCACAAGGAAACTGTCTAAAACACCATATAAATTAGCAGATTTATGG
ATTTTTTTTACTGTTTAAACTCCAGGGTAAAACTTGAAAAGTAAAAATCGCCAGCACTAA
AAGAAAATAAAATCAGAAAAATTATTGTTTTATTTTAGGTGATGTTCACAGAAGAAGATG
TCAAGTTCTACTTGGCTGAACTTGCACTTGCTTTAGACCATCTCCATAGCCTGGGAATAA
TCTATAGAGACTTAAAACCAGAAAAGTAAGAAATTGTGCTACTAAGTTGAATATAGTATG
ATATAATTATCTAGAAATTAATAGAAAATAAAATGACTTCATAGAAGAAATACCACAAGC
ATTGGATTAGAGGGCCTGTGTTCTCATACTTTTAAATTTATTAATTTTTAAAATGATGTT
TTCCTTCATTTGCATGGTTTGATTTTTTTATTGGGGTTGTGATTTATGTCCATAGGTATA
TAGGGTTTGGGTATATTTTTCTATTCACTTTGATTTGTAAGGGATATTTACAAATTAAGA
AGAAAACTAATACATATTGCAAATCAATTTTTGTAGTGTATCTTTTATTTGTTACTTGAA
CCTACATAAGTATTTTTTTCTCTTCACTAGCTCTGCTAATCATTTGTAATTTCTTCATTG
GCTTTTTTTCCTAGAATGACTTTTTCAATCCCTTTTTCCTTTCTTCCTTTCATTTTTTTG
TATTTGGGTCACACAGGACTCATTTATTACTCCTGGCTCTAGGGTTAGGGCTCAGTCCTG
GCGCAGCTTGGGGTACCATTATAGGGACTGGGATTCAAGCCAAGATGGCTGCTTCCAAGT
TAAGCACCCTAACCACTGGACTGTCTCCTGCTCTAATCTATAGGTGTTTTTTTTTTTTGC
GGGGGGTATAAGAGATGGTATAAAGCTAATGTTTTCCTCCTATCATTTTCTGCCTCTTTC
CCCTTCTGTCTATTCTTTCTAAATAATTTTTTTCAGGTTGGGAGGAAACAAAATTCTCTC
CTCCATCGAATTTTAAATTTTACATGTGAGGTGAATGAATAGCCCATTGCAATTATCAGG
AAATTAGTATTACTTAGATTGGATGTACCTCTGTGATTTACTTTGTTTTTGCTTCCTCTC
TTTCACTATGAACAAGACGTTGATTTCCTTTTCTGTTTTGTTGTTGTTGTTGTTATGCTT
TTGGAATTTTTGTGGCTTGCCTAGCAGTGCTCTTGGGCAGGGGGTGGGACGAGCACTGCA
CTGAGAGTCAGTGTCTGAGGTGCTGCTGCTCAGTGCTAGGTGGTGTTTTTCTGTTTTGAA
TGATACAGACAAAAGCCTTGCTCTCCCGAAAATTGTTCTAATACATAATTGAAATGTAAT
TCACATACCATGCCGGAGATTTTAGCCTTTAAAATGCACAGCTCGGGGCTGGAGTGGTAG
CACAGCAGGTAGGGTGTTTCCCTGCACATAGCCGACCCGGGTTCGGTTCTCAGCATTCCA
TATGGACCCCTGAACACCACCAGGAGTAATTCCTGCCTGAGTGCATGAGCCAGGAGTAAT
CTCTGTGTATCCCCAGGTGTGACCCAAAAAGGCAAAAAAAAAAAGAGTACAACTCAAGGG
TGGAGAGATAGTTCAGTAAATTGAGTGCATGTTTTGCATGCAAAAGGTTTGGGTTCAATC
CCCTTTACCACATACGGTCCCTTGAGCACCGTCAGGAGCAATTCCTGAGCACAAAGCTGG
AAGGTGCACGTGAGCAGCACGAGATGTGACCCAGAACCCCAATAAATAACAAGATGCACC
CTTCAATGGGGGATTTTTTGTTATTAATAGCTGTGCAACCGTTGTTTTATTAAGAATTTG
AAATTATGTTTATATGCAAATTTTTGCTTATAGCTTACAGCAGAAAGCAGAAATACATTT
TTTGAATCTTGTTAAGTCACATGTAGAAATTCTTAGACTTTGTTTGCCTTTGTTTTTCAT
ACATTTTGTTTTCAGATTAGTTTCATATGGTTCTGTATTTTCCAAATTAACTTCTGATAT
TTTTCATCATTTTTCCAACTTAGCTTATCACCCAGAACGATACAGTCTTTATGAGAATAA
GTATTCAGGCACATATTCCTTAAAAGAAAAACAATTTTTCAGTAAAGTTAATGTGTGGAT
CCAGGGACATAGCTCAGAGGTCAGGGAGGCGTGCCTTTCATTGCACAAGGCACCAGGTTC
CATCCCTGGCACTACATGGTCCTGTGAGCACCACTGAGTGTGGCACTGATGTCCCCCAGC
GCCACGGGGTCCATACAGCACTGCATCACCAGGCTTTCACGTTGATTGCCTATATTGATC
TCACGTATTGCTGGCAGTGACCCCAGCCTCCAGAGGACCGCTTAGAAGACCCTCCCCCAG
TGCATTTGCCTTACTCAGATTTACCAAAAGTGACTTGCAGTTTGGTTTGTTGGCACTTTG
GGTTTTTTTTTCCGTATTTAGAACTCCCTTAGCGTGTTTCGCCATTTCATATCAAACATA
ATCAAGATGAGCATCTTTGTTTTGTAAGTCCCTTATTATAAAAGACATTTGAAACATATG
CCCTACTGAATTACTCTCAGTGGTGAACTTTATTGTTATCATAGTTGGGTTAGTGATGGA
AGAAAGATTGGGTTGGGAAGTATTTTTTGACCTAGTAAAATTTTATTGTAGCAAAATTTG
GCTTTTATATTTTTAAGTTAAAATTCAAAGGAAGTGGGGGCTGGAGCGAAAGCACAGTGG
GGAGGGCATTTGCCTGCACGCGGCCGGCTCGGGTTCGATTCCCAGCATACCATCTGGTCC
CCTGAGCACCGCCAGGAGTAATTCCTGAGTGCAGAGCCAGGAGTAACCCCTGTGCATTGC
CGGGTGTGACCCAAAAAGCAAAAAAAAATTCAAAGGAAATGTAGGGCTAGAGAGAGAGTA
AGTATAGTGGGTAATTCTTTGCACACAGGTGACCCAGCTTCAGTCCCTGACACCCCAGAT
GGTCCCCTGCACCCAGCACTTGTGGCCCAAAAACAAAACAAAAAAATTTCAGAGGAAGTG
CTTATATTATGGTATAGCTTTGGAAATTATTTATTATTTCAACTTTGAATTCAGAATACT
AACTTTGGATTCGGTATACTAGATTACCTATCCAGAAATAGTTATTGTTTTACAGCTTAA
TACTCTTCTCTCCCACTCCTTAATGACATTACTCCCAGGCAACTGCTAAAGTCAAACCTG
CTGCCTTTTCCCTTTGCCCTTCTTGATAGCTAATAAGCCATCAGCAGTGAGCCTGTAGCT
CGGTGTTGGAGCACATGCTTTGTATGTACTGGCAACAGGACTAAAGAAAATCACTAAAAA
CCCTTTATGTTTCCCTCTACAGTGTTTTCCAGAAATCCTTATGATCTTTCCTGCCCTGGA
AAAGACACCTAAACTATTTAGAATGTCTTGTTGGCCCCTTTTAGACAGGCCTGATTCATT
CATCATAGATTTCTTTTTTGTATTCTCCACACACTCTCATATGGTGTTTCTCAGGGGAAG
CAGGAGCAAAGTGATAGTACAGCGGACGGGGCACTTGCCGACCCAAGTTTGATTGCTGGA
ACCCCAAATTGTTCCGAGAGCCTGCCAGGAGTGAACCCTGAAAGCAGCGCCAGGAGTATG
CCCTGAGCACCACTGTGTGTGGCCCAGATGGCCCCCCAAAAGGGGTAGTATGGAAACCCT
TGTGGGCCCCCCGGGGCAGTCTAAGGAGCCACAACTAAAAATCACGACTTGGGGTCCAAC
TCTAGGGTGGGGCTACAGGAAGGAAATAAGGTCCGCGGGAGGCTGCAGTCTGAGTAAGGG
TGAGGAAACTTGGCTGTAGTGGATCACTGCTTTCGGAAAGACGGAAGACAGCAGGCAGTG
AAGGCCGGGCGGAACAGCAAGGGGAGGGGTGCTTGGCTAAGAGGATTGTTTGGGTCATGT
CCGAAAGCAGTAGGAAAGGGCCAGGTGCCTTGAAAAGGACAAGATGGAGCTAGCGCTAAT
CCGCTTGACTGACTTATATGGCCCCTCTGTCTCCTGCGGCGTCACACCTACAGAAAGGCG
TTGAAAGAGCAACTGAGAAGAATATAGGTTTTCATTCTTTTTTCTAACAGTTCTCATTTA
CACAACTTTATGGCTTTGTCTTTAGGATATATTATTTGTGTATGCAAAACTGAATTTTGC
GGGGCCAGGGCGATAGTACAGTGGGTTAGGCATTTGTTTTGAATGTCGCTGACCCGGAAT
GGATCTGCGGCATCCCATATGGTTCCCCAAGCCAGCCAGGAGTGATCCCTGAGTGCAGAG
CCAGGAATAAGTCCTGAGCACCTATAGCACTCTCCCCAGCCCCCAGAAAGTTTTCCTCTT
TTGCTTTTTCTTTTATCATAATATAAGGCAATATTTTAGAATAAATGTGATCAGATGCTT
TACCCTAATTTCAGTTTTAGAATTTTTAAATTTCTAGTTGTTTGAAAAGATTTCTAACTC
TTCTTTCAGCATACTTCTTGATGAAGAAGGTCACATCAAGTTGACAGGTAAAACACCACA
TTTCATTAAATTATTCTGTCATTTAAGATTGAGGGTGGGGCTGGGAGATCACTCAGTGGG
TGGGGTACGTGCTCTGCAGCGCGGAGCCCTGGGTTTCATCCCTAGCACTGCAGGTTCTGG
CGAGCACTACTGTGAGAGTGATTTCCTGAGCACCACTGGGTAGGATACCAACTTCCCCCA
CTCCTGGAGAAAAGACCAATCATGGTACAGATACCAATTAGCATATTGTGTTCACATAAA
TGGTCAGGGAGATATCTTCACATGTGTAAGGCCCCGAGTTCAAACCCCAGCATTATTAAT
TGTTGGGACTCAAATTTAAGCTTCATGTGTGCAGATGATTATAGTACATTTCTAAAATCA
ATGTTGCTTTGCAGATTTTGGCCTAAGTAAAGAGTCTATTGACCATGAAAAGAAGGCATA
TTCTTTTTGTGGAACTGTGGAGTACATGGCTCCAGNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNTTTTCCTCTTTGTAGTTGAGATGCTCACTGGTACACTGCCTTTCCAGGGACG
ATGAACCACATGACTAAGATCTTTAAGTAAGTACACTCTAGTGAATATGGTGTGATGACA
GTGGAAAATAAACTTACCAGAAGAAACATAGGGACTTTGGCCGGGGGAGGAGAGTGCAAT
AACTTTTTATTTTACTACCGTAAATATTAATGCTGGTATGCCCACAATACCTAAAATATA
AAGACACTAATTAATAAGTGCTTCAAAATAAAAACTTAGGTTTTATGTGTCAGCTTCCAT
GTAAGAAATATGGAGAAATTCATTAACATGTGGTTTGAATACTTCTAAGAAACTTCATAG
ATGTCGAGTATATATTATCTTCATACTATCAGTGAAACATTTTAACCTACTACTTTGAGA
TTTGGAATGACAAGATGCCCATTCTACTGTTACTCTCATTATCCTGGAGTGCTAACAAGC
AGACTGAGGAAAGCAGACAGTATTTGCGGTTGGGCTGACCATTGAGTACAGCATGTGAAG
CACTTGCCTTGCACAGCGCCAACCCCAAATGGTTCCCCAAGCACAGCACGAGTAGTAGGG
GCCGAGTACCACGGGGCGTTATTGAAACACCAAAAAAGGATTTAGGTGAATAAAGGGAAA
TAAAATTGTCATTGTTTGCATAAAATAATTATGTCCATGAAAATCAAAATTTTCATATAA
ATACTTGAAACAAGAGCTTAGCAAAGTTGCTAAGTAAAAGAGCACTATGTAGACTCTCAT
GTTCTATGTGTATGCTTTGGTTGGGGCGTGGGGTTTCCCGGGACCACACCTTGCTGTTCT
TAGGGGCTTCTCTGGGTAATGCTCCCAGCGCTGCTCAGAGGCCATGAGATGCCTAGCTCC
AAAATGGATTTCTTGTTTTTTCCTTTTTGGGTCACACCCGGCAACACACAGAGGTTACTT
CTGGCTCATACACTCATGAATCACTCCTGGCAGTGCTCAGGGAACCATATGGGATGCTGG
GAATCGAACCCAGGTCAGCCGCGTGCAAGGCAAACACCCTACCCACTGTGCTATCACTCC
AGCCCCCAAAATGGATTTTTTAAAAGATACTGTTTACAGTAGGGGGCTGGAGAGAGAGTA
GAGCAGGTAAGACTTACCTTGCACACAACACAATGGGTTCCATGCTTGCTGCCCCATCTG
GTCCCCGGAGCCCTTGAGCACAGAGATGGGAATAAGAACGAGTACAGACAACCCGGCTGT
ATTCAAGCTTACTCCTGGCTCTTCGCTTGGGGATCACTCCTGGCAGGGCTTAGAGGACCA
TATGGGATTCCAGGGTTCAAATCCGGGTCGACCGTGTTTAAGGTACCCCACCCTCTACTC
CTCTATTCATACAGAGGAAACAAAACATCCTGTCTCACACTATACACAAAACGCTTTTCT
AAGTAATATAGATATATGTAAAAGGACAAAAAAAGTTTCAACTGTGAAGTTGAAAAAGTA
GTCTTTTTGACACAAAGCACTAGTCATCAAGGAAAATATACATTATTAATAGGTCAAAAA
TTAGTAACTCGTTCTTGTCTACAGATTCGATTAAGAGCAACGATTAGAAATTTGCAGCAC
ATAGGCACAAGAGTGCATCTTTAGCATGTGGGAGTCCTGGGTGTAATCCCCAGCACCGTG
TGCCGCCCCACCTCCCAGCACTGCTGGGAGTAGCCTCTGAGCACCGGCAAGTGTGGCCCA
GAACACAGGAAAGAAAATTACTTTTAATGCATGGAGCCAATTTGTATGAATTAGATATCA
GGTATATCAAAAATTAATGAGCTAAAGAAAGACCAATAGAAACACGGGTTGGAAATGTAG
AGACTTCCCGGAAGAGGCTAGCCAGTGACCAAAACACCGCAAAAGAAGATAGCCAATGAC
CAGTAGACACAAAAAGGCATTTGCTCTCATTAATTGGAAATTCCACATTAAAATCACAAA
TAGTTCAGTGGAAGCACTAAATGTAGCTCAGAGGTAGAGCACAAGCATCAGGTTGATTCT
GGGCACCAGAAACTGAAAACGAGCATGCAGTAGGGGCCGGGAATGTGATTCAGTGCTAAA
GCTCCTGCCTCGCCTTCGTCAGACCCTGTGTGTGATCCCCAGTACCATAAACACTACAGT
GACACAGTAACCATAGCGGCACAAAGTAGAAAGTCTGACAGTTGGAGTTGCTCTCCGGAT
GTAGAGCATTTCAACTTGCATACATAGCTGAAAGAAGTACACACACCTTGAAAGGCATTA
CCTTTGGCATTATCTTTGGAGATCACCTATATTTTATATGTATATACATTTTCATACATA
CGTATATACATACATGCTCACCCAATAGTTCCCTCTTCTAGGCACCCAAGTTATTTGTAT
CTAAGTCCTTACTTATGCGCAAATACATAAAGAAACAAGTATGGAGCCAGAGTGATAGTA
CAGCGGGTAGGGCACCTGTCTTGCACACAGCTGACCTGTCTTCAATCCCCAGCACCCAGT
ATCCCTGCCAGGAGTGATCCCTGAACTCAGCCGGAGTAATCCCTGAGCACTGCTGGCTGT
GACTCCAAAACAAATTTAAAAAATACATAGATATTCATAAGAGCGTTGTTCATAATCACC
TAAAACTGGAAACTGATGGGTAAAGTGGATTATTACTTTATTCTGTATTCAGTGTATTGC
AATAAGGGTTGATAAACTGTCTATAAATACTTTGGGACTTGTGGGCCGTACATGGACTCA
GTCTTTTTGCTTATTTCTAGCACCTTAAACACAAGAAAGTTCTTAATTTAAGAGCAGTAT
AAGAAGGCTGGAGAGAGAGTACAATGGGTAGGGGGCTTGCCTTGCACGCAACTGACCAGG
ATTCAGTCCCTGGCTCCATACATGGTTCCCCTACGCCCTGTCAGAAGTAAAACCTGAGCA
CTGAGCAGAATTACGTTCTGAGCACCACTGAGTGTGACCCAGAAAAAAAATAATAAAGAA
TAGGCCTTTGGCCCGTAGGTATAGTATGTCATAGAATTTTTTTTTAATCACCAGTTATAT
GCAACCACTTGAATAAATCTTAAAAGAATGTTGAGCAAAGGCAGTACAGAGTAATAAAAA
CTACATGGTTCTATATATAAAAGTTTAAAATTAGACAAGCTGAAGCATAGTTTCTAGGAT
CCATTTTTAGATGGCAAAAACCTGAAGCGACATAAGGGGAAAGTGATTACATTAGATGAG
GGGTTCTGGCAGCGATGTATTTCTTGGCAAGGTTTCGCTTCGCTTTTTTTGGTAAATCAT
TTCTTGGTTTTGAGTTTGGGGGATTTTGAGTTTCATTTGGCTTTTTATTTTTCATCATAA
TAATTTGCTCCGTAAACTAATATTTACTGAACCTTCGTCACCACATCTCCTTCTAGTTCT
TCATTTCAACTGATACTCTCTCACCAAAGACAATAATGCCTTAGCACTTTCACAGGTCCT
CCTCCAGGCAGTGGGGCCAGGATTTGGTAGCTGGTGCTGAGAGAAAACCCCCTGGATTGC
ATCCTTGCCCTGGCACTGTGCCAGCGGCATCTGTCACTCAGTGGGACAAAGAGAGAAAAA
CCTTTCTTTGACTCAGCTTCCTTTCATGTTTCTTTGCCATCTTCCTGTGTCTTTCTAACA
CAAAGTTACTTTCAAGAAGAATCTGCTTTCTGTTATTATTTATTTGGTTGCTTTTATTCC
AAGGCTGATTGTCTTTCCTCCCCATCACTCTATGGAAACTGCTACTATTTTGCTCATCAG
TGATCTTCTGGTTGCTAAAATCGGTGGCAGCGTATCAGAAAGGTGACTGGACCATTTGTT
CACACAATTTCTTCAACAAATGATGAACATCTTAGTATGGAGCATGGAAAAAGACTGGCA
AAGTCTCTGGCATTGCCAAGCTTTCATTCTTGGGGGAGGGGGGCACACAAGGCGGTGGAG
GTGAGGAACTAATATTGATATGAATAAGTTTAATTTCAGATAGTAATATGATGAGGAAAG
GAAGAAATGGCATGCTCCTGAGGTGTGAAGGAAGCGGTAGGGCACAGGAGTCATTTTATA
CGGGACAGTTCTAGACAGTTTCCCGGGGCTGGGCAGGTAGCTCGACAGATTGGAGTGCAG
GACTGGCGTCGACAGGGCTCTGGATTCGGTCTCCTGCTCCTCCAACCCACTTGGGTGCGT
GTCACCTCTGGGGAGCCCCCTCACCAACAAGGAAGCTGTCTCTGGGAAATATTTGATTCT
TGCTGACGCTCCTCCTCTCCCTAGCACGTAATTATTTTTTCTGCTTCTCTGCCTTTCCTG
CTTATTACTCCAAGCGGAGTAGACTACTGATCTTAAGTAATCCAGGGTTTGGAGGAAGGG
TGCAGGTGAAAAGTCTGCTTTTCAACGCCTCGGGTGAGCTGCCACCGTCTGTAAGAGTGG
ATGCAGTCTCTTGGCTGGAACTGGCGCTCCCCGGTGAGCACTCGAGCACGAGGGAGTCAG
TCTGTTCTTGTTTCCCGACCTCCGTGGCCGGACAGCAGTTCCTGGCTGGTTTGCGCAAGT
ATGCTCACGGGGAAGTTGCCTTTGATCAGCGACTGAGTGGAGAGAAAATAGTTTGGGTGA
CTCGTCCCTGTGGTTGCAATAGTAATGAGGTTTTCCCTGGGAATGTGGAAACTTCTTTAT
TGTCTTTGTGATGTTGTTGAATTCGCTCCCTTCCCCAGTTTTGAGTTAACTTTTTGGCAG
GATTCTTTCAGAGCTTATGCCCTTGCGCCCTGTTGCATCAGCTCGTGAGGCTTGCGGCAC
ATTCAGTGACGAGTTCCTGTGGTTACAGCTAATCCTCCCTTAGAAAGTTCCCTCTCAGGC
TTACTTCTAATGGTTTCATTCATTGAAAATCATTATTACAGACATTCCATTTTTAAAAGG
GATCTTTAAATTGTGATTTTCAAATTGCTATTTTCTTTCCTCATTGATTAGCTGGTGTTT
TCCGAACAATGAACTTCCCATCATCTACCCTAGGAGTATTTAGTTACCTTGGAATAAGAT
TCCAACAAGAAAAATTTAATAAATGCTTACTTCTTTTCTAAATTATTTCCCATTGCCAGA
ACTTTAATTACTGCCAGTGGCATTGTTGTCCAGTGAGTTGGGTTTTAGTGTTCATTTTTA
CTGTTATTTTTTTACTATTAAAAACTCATGGGATTTGGGCTGGAGCAATAGCACAGTGGG
TTTGCATTGCACACAGCCGACTCGGGTTCGATTCCCAGCATCCCATATGGTCCCCCGAGC
ACCACCAGGAGTAATTCCTGAGTGCATGAGCCAAGAGTAACCCCTGTGCATCGCCAGGTG
TGACCCAAAAAGCCAAAAACAAACAAAAAAAGGCTCGTGGGATTTGATCATCAGTATAAT
TCAGCCAATTGCATTCATTATATCAGTGCCCAGTTTGCTGAGGTTTTGTTTGTTTGTTTG
TTCGTTTGTTTGTTTGTTTGTAGGCCACACCTGGCAGTCCTCTGGGGCTACTCCTGGCTC
TGCATTCAGAAGTTACTCCTAGTGGTGCTTGGGGAACCATATGGGATTCGGGGGATCAAA
CCTAGGTTGGCTGCATGCAAGACAAGCACCCTCCTGCTGGATTATCTCTCTGGCCCTGTT
GAGGATTTTTTTCACCGCCTTAGAAATGTTCTTGTTTCCCAGAGTTCCATCTCTGGCATC
TTTTTTTCCCATTCCCATTCAGTTTCTGGGCTGACCTCAGTATTTCCTATATCTACTCTC
AAAATTGTAATGGTTTCTTTTAACATCAAAAGCCAGACCTGTACTTCTGCCTACTCATCT
GTATGGCTGTCCATGACAAGCATGGATGGACATCTTTAAAGTAAATACATCTCTGTTTGC
TCGTCTATTTTTCATCTTACTTCTCTGGAAGTGGCATTTTTATGTACCTTATTTCCCTCA
TCAGGGAAACGAAATCATTCTTGATTTCTTGCTCTCTCCTGCATATGCATATATTCACCA
AATTCATCCTCAGAAGTACTCGAGTGTTCCAGCCTTTCCTCTGCAGGGATCTGCTTACAG
ATCTGAAACCTTGCTGACCTCCTACCCACGCTTGCTCCTAAGTGAAACATCTGCTGCCTG
TCATTTCTTCCCATTCCAAGTTATTTTGTGCTACGCTTGGAGTTACCATCTCAAAATAGC
TTTGATCATGTTAGCTCACTGTTCACAGACTTCTGCTATGTCCTGTTGCCTAACAATGCT
GTTTCTCCGGGTTTGTTCACCAAAACACTAGGTTTTTACATTGTTTTTTAGATATTCTCT
GAAATGTGAGCATCAAAAATAAATGTTTAAAAAATACTGATTTCCAGGCGGGGGGCCAGG
TGGAGAAAAAGAAGAGAAAAGTTCCTGCCAGAGAGACGGGGGTGGGGCGACAGACAGGAG
GGAGATTGGGAGCATTGGTGGTGGGACATGTACACCAGTGAAAGGATGGGTGTTGGAACA
TGATATGACTGGAATCCAATCATGAACAACTCTGTAACTGTGTATCCCACTATGATTCAA
TCAAAAAAATTAAAAATTATATGAAAAATACTTATTTCCTTCTCAGAGAGCCTGGCAAGC
TACCGAGAGTATCTCACCCCCACAGCAGAGCCTGGGAAGCGACCCGTGGAGTATTCGATA
TGCCAAAAACAGTAACAACAAGTCTCACAATGGAGACGTTACTGGTGCCCGCTCCAACAA
ATCGATGAACCACGGGACGACAGTGCCACAGTGCAGTGCAGATTTCCTTCCCAGCCTTGT
ATATGTAATGTAGTAAGCTATGTCACTGTAGAGAATATGGGGGAGGGGGCGTATAATATT
TAACATTCCACATATCTGCCAAAAATTGCCTAAAATCCAATGTCAAAATGTTAGAACATG
AAATACTTTTTGTTCTTGCAAATACCTAGTGAAATTAATGTTATTCAATAAAATTTGGGA
GGAGTACTATTCAAATGAATGAATTCTGGCTGCTGGAGTGATAGCACAGCGGGTAGGGCG
TTTGCCTTGCACGTGGCTGACCCGGGTTCGATTCCCAGCATCCCATATGGTCCCCTGAGC
ACCGCCAGGGGTGATTCCTGAGTACAGAGTGAGGAGTCAGCCCTGCGCATTGCCGGGTGT
GACCCAAAAAGCCAAAAAACAAAAAAGAATGAATTCTGAACCTTTAAATTATATTTAAGG
CCATTCACAGTCTCTTGTGTTAAGTAAGCTACCCATATGTCTTTCATTAGCACTTTTTCC
ATGTATCTGAATGTGTCTATTATTTTACTAAAATTGCCTATATCCATCTTGGCCATGGAC
TAGGGTTATCTTTACCTGTCAACTCAGCACTAAGCAATGTGTACCTCAATAACAACACAC
TGAATAATAAATGGATGCATTTTTGAAGTAGAAATTTCTCAGCTGGTCATTTTTCCCAGC
AGTGTTTTCATTTTCATATTTACGGAATGTTTAATTTCCTTAATTTGTAGACTGGGGAAA
AATTAAATTATATATTAAGAGCTGAAACAGACCTCTAAGCTCATCTAGGCCAATGGATTC
CATACTGTGTGTCACAGAGCCTGAGGTGTTCCCCAGGCCTATTTCTCACCAGTTCTTCCC
TGCAGGACTGTTAAAGAGAATAAGAGCAGAAATTAGGCTTATGCAGCACATTTTCTTTCA
ACAGTTTTAAATGTTGGATTTCTAAATTCGCCTTTGAAAAAAAAAAAGGAATTCCACCAA
GGCGTCATTGGCCTGATTGCCCTTTCTAGGAAGTGAAAAGGGGTACTCAGCCGTTGACTC
AACCCCTCATCAGAAAGTCCTTTTTAGTTTTGTTTAGTTTTGGGAGCTACATCCAGGCAT
GCTCAAGGTTTTCACCTTCCTCTATGCCCACAGGGAACCATGCCAGGGATTTAACCTGGC
CAGCCACAGGCAAGGCAGGCAGCCTACCTACTGTACTCTCTCCAGCCCCATGACAGTCAG
CCGCTAAATATTGGAGCGGCTTTATTCATAGCAGCCCGCATTTGGATTCAGCCTAGATGT
CCTTCAGCAGATAAACGAATTAACTGTAGTACAGTAAGAATTCCCGCACGGCAGAGGCTG
ACAAGCTCCCTGTGGCGTATTCGATATGCCAAAACCAGTAACAATAATAGGTCTCATTCC
CCTGACCCTTGAAAGAGCCTCCAATCGTTGGGAAAGACGGGTAAGGAGAGGCTGCTAAAA
TCTCGGGGCTGGGACTAATGGAGACGTTACTGGTGCCCACTTGAATAAATCGCGAACAAC
AAGATGACAGTGATACCGTAAGAATTACAATTAATTGATTGCAAAATAAATTTGCAATTA
AAAATCAACTTTGATATACACAACTTACGTGACTCGTGGTACTTATGCTGAGTGAAAGAA
GGTAATAGTATGAATACGTTGAATTTTTGAAAAACTCTTAAAATAACAAATTTTAGAAAT
GAAAACTAGATGAGTTGTTTAGGACCAAAGGCAAGGAGGGAGATGGAAAGAGTAATAAAG
GGGGCAGTGTTAGGGATCCCAGTCGAGATAAACCATAACGTGCATTTACTGAGCTTTTGA
ATACAGGAGCTTCCGTATAAAATTGAAATCACATAAAGGTATACATACCCTCATGGTGCT
GGAGAGACAGTCCAGCAGGTAGTGTGCTTACTTTGCACCTTGCAGCTGAGCAGGTTTCGA
ATTCTGGCACTGTCTGTGGTCCCCAGAGCCCCAGTCGGAGTGACCCCTGAGCATTGCCAG
GTATGGCCCAAAAAGTACCCCTCAGAAAACACATACATATAAATAGTGGGATTAAGACCG
GGGAACATCTGAATAATAAGCTGGGTGGGTTGTCTCAATACCTGCGTCCTGGTTGTGATA
CTGTATTCGAGTTCTGTGAGTTGCTGTTACCTGGGAAACTAAGCAGAGGCTGTGCAGAAT
CTCTGTATCGTCACCTAAACTGGAGTTAGTCTACACTTCTTCTCCAAGTAAAGTTTAATT
GAAATTTTAAATTAAAGTAGATGCCTCTAAAAAGTAAAATGCTGTTATGTGAATTTATTA
CTTAGAGCCAAACTTGGGATGCCTCAGTTTTTGAGTCCTGAAGCCCAGAGTCTTTTACGG
ATGCTTTTCAAGCGAAATCCTGCCAACAGATTAGGTAAAAATTTTTAATGAATTTGTTTC
TTGTGTGCTTTGCAGTTTATTTTTTTTTGGGGGGGAAGATGTATATGTTTGTGTTGTGGG
ATTATGAAATATTAAGTCATGTATTGAAAGCAAAGAATAAATGTTTCCCCTTGAAATAAA
ATGACCATTTAATCATTATCTTTCATTTTAATAGGTGCAGGACCAGATGGAGTTGAAGAA
ATAAAAAGACACTTATTTTTCTCAACAATAGACTGGAATGTGAGTATAGTATTAGAACCT
ACTTGGGAGGCTATTTTTCAATGATTTACACATGTGTAAGTCTCTTTTTTTTTAACCTCC
AGAAACTGTACAGACGAGAAATTCATCCACCTTTTAAACCTGCAACTGGCAGGCCTGAAG
ATACTTTCTATTTTGATCCTGAGTTTACTGCAAAAACTCCCAAAGGTAAGGAGAAAATAG
GAAAATCCAAATATAAAACTGATTTTTTTTATTATCATAAAATCTTTTCCAGTTATATCC
ATGCTTCCATGCTGCCTTATGTCTCTACTGCCTGGCACAGTAATTTGTTAGTAAATACTT
TTCAGCAGTTTATAGCAGTTAAGATCCTTGTAAAATCTTCTAGCAAATTANNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGAGC
ATGATGGGATTTGGGGTGTGGAAGGTTTGACTGCCGGGGCTCTATTGGGCAGGTGCTGGG
CTCACCCACCGTTCTCAGGGTCCCGTGGAAAACTCAGTCTGGCAGTTGAGCCTGGCAAGG
TCTCCCCCCTTTCTCTTGTTAATTAGCTCAGAATATTTTTTTAGTGTCTGTAGGATCCAT
GAGTGGAAGCTGAAAGAGCAAATTAAGGGAGTCTTTTGGTTTTGTAGCACTAAGGTTAAG
GTGTTCGTATGAAATGGGTCACCACAATATCTCTCACCACCTGGCGGGTTGTACATATTC
ACAGTTTTGTCAGAAAACCAGTCCCAGGCGGCATGAATACAAAGGCACTTCAGCTGATTA
TTCTGGGTTGTTCCTCTCCGAGTAAACCAACCTTACAGTGACTTTCATCCAGTCCACCAG
GCTGGCCATTCCCTCAGGAACTTTTTGTATCTGGGTCCAACCAACCATCTGAGCTATGGG
CCGATAATCGTAGTCTTCCACGCTGCAACATTCAAATCTGAAGCAGTTGCCAAATGGGCC
ATTCCCCTTCCATCTCAGTGACGTTTCACCAGGCAGCCTACAAAACAGAACAAGTCTTGG
GCCAGAGCAGTAGCACAGTGGGGAGGGTCTTGCTTTGTACACAACCAACCCAGGTTTAAT
CCCTGGCGTCCCACATGGGCCTCCGACACACTGTACGTTCTGATTTATTGGTTTCTTGAT
TGTGACCTTCCCCTACACACTTTCTTGATCAGCAGGAGTCTTAATGGTCCTTACTCTTGT
CCCTGATCAATTTTAACCGTAAAGGGCAGCTTTGAGACGAGTGGCTTAAGCTCAAACTTC
TCAAATCTGATATGCTTTCGGGGCCGGAGTGATAGCACAGAGGATAGGGCTTCGCTTTGC
ACGCGGCCGACCCGGGTTCGATCCCCGGCATCCCATATGGTCCCCCAAGCACTGCCAGGA
GTAATTCCTGTGTGCAAAGCCAGGAGTAACCCCTGAGCATCGCTGGGTGTGACCCAAAAA
GCAAAAAAAAAAAAATCTGATATGCTTTTGCTTGAAGGTCCAACCAAACATCTTTTATAG
TTTGGCTGTCATAGTTAATCTTGTTTTCAGCTTGCATTTCCTTAAGTATCCATCTCTAAA
GTCCATTTGGGACTGTTCCATTAATAGCTGAGAGCATGGCACAGCTGCTAATCCAAACCA
TGAGTGGTAGGTCATGTGACTACACACGAAGCAAAGGTTCCTTATTCCGCTACCCTTTTG
TCCTTTGTCTTTGCTGATCACAAGCTTCATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTAATG
CTAATAGACAACACAGAATTACAGTAACAATACATATCATGTCCTAAAATATATTTTAAG
AATTACATATTGTGTTTATTCAGGCAATTACTTTTGTTCATCAAATATATGTGATGTATA
TGTGATAATTTTTAACTTGGGATCTATAATTCAAGGTTCTGACATCAAGTAGAAGACCAC
CAGAAACTGAATTTCTTTAGATCGACCTTTATTTTTCCCCAGCCTAAAACCATCACTTTG
TTAGTCTCCTATTTAGGCGTACCATTCAAAATGGTAGTCAAATTGTGTCCAAAATTGCCA
TACGTAACTATTTAATATGATGTACCATTTTGTATGTGTGAGGTCCTGGATTCGATCTCT
GAGATACACTAACCCAGTAATCCATTGATTTATTATAGTCTTCAAATGAGTTGGCAATTT
TCTGAGCTCTCAGGGGCTAGGATTTAATCTGATTAAGTGCCTCACTGACGTATCCTGGAA
ACAAGAGTTACGCATGGTTCCCCTTAATTTTTTCCCCTTAATTACCTTTCAAAGCAATTA
CCTTCTTAATAATCGCTCTTTCTTTTCAGATTCACCTGGCATTCCACCGAGTGCTAATGC
ACATCAGCTTTTTCGGGGGTTTAGTTTTGTTGCTATTACCTCAGATGATGAAAACCAAGC
TATGCAGACCGTGGGTGTGCATTCAATTGTTCAGGTGAGTGAAAGTCAAATTTAAAATGT
GCAATATTGCTTACGAAGTATGAGGAGATTATAGAGTAGATTTGTTTGCTTAGTTAAAGT
AGCTTTAAAAAGGTTGCATGGGCTGGAGAGATAGCACAGCGGGTAGGGCGTTTGCCTTGC
ACGCGGCCGACCCGGGTTCAAATCCCAGCATCCCATATGGTCCCCTGAGCATGGCCAGGG
GTAATTCCTGAGTGCAGAGCCAGGAGTAACCCCTGTGCATCGCCAGGTGTGACACAAAAA
AACAAAAAAACAAAAACAAAAAAAAAAAAAGGTTGCATGCACCAGAGTCTTGGATATGTA
TCAGGCTTCAATGTAAGATCTTTTTTTTTTTTTTTTTTGGCTTTTTGGGACACACCAGGC
AATGCTCAGGGGTTAGTCCCTGGCTCTGCACTCAGAGCTGGGTTTTATTTTTTAAATATT
TGAGGCCTTGTAGACTATGTCATATCTGTTTTGATTCAACTGACCTCTGTAGCACCAAAG
CTAGCATAGATAATGTATAAATAAAGGGATGTGCTTGTGCTGATAAAACTTTGTTTAGAG
CACCAGAATGATAGTACAGTGGGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNATTCATCCCTGGCACCGCATGTTCCTCCGAGTACCACCAGGAGTGATTTC
TGAGCACAAAGCCAGGAGTTAGCCCCAAAATTGCAATCTTTTCCCCTTGATGAATGTGCC
CTGTGTGATAAAAGGCAAGGTAAATTCAGATATCTGGCTAGTGATCTCTGGGGATCTAAT
AGAGTTTGGATTTCCCTGTAAGCACGCATGCCCTTTTCACATTTTCACTTTATGCCTGTC
TTTAGTTATGGTAGCGCCACTTTTGCTCTCAAAAAGTTCCTCACTTTGGGGCCGGAGCGA
TAGCACAGCGGGTAGGGCGTTTGCCTTGCACTCGGCTGACCAGGGTTCGATCGATCCCTG
GCATCCCATATGGTCCCCCAAGCACTGCCAGGAGCAATTCCTGAGTGCAAAGCCAGGAGT
AACCCCTGAGCATCGCTGGGTGTGACCCAAAAAGCAAAAAAAAAAAGTTCCTCACTTTGA
GAATTTCTCAAAATATATGCCAGATTTTGTACATTTTCATTTTTCTGATAGTGTTTATTC
ATTTTTCATATTGTAAGGATCTTTGAGGGCCAGAGAGAGAGCTCAGTGGCCTGAGGACAG
GCTTTGTATACAGGAGACCCAGGTTTGGTCCCTGGCATCCACATAGTGTACCAAGCACCA
AGCTGGGTTAGCCCCCATGGACTGCTGGATATGGCCCAAGAACCAAAACAATTAAAAAAT
AAATAAATAAAAGGGTCTGTGAACCAGTAAGAGAAAAGAACCACTGTTATAATATTTTTT
TATCATAAGCTCTTTCCATTTCATCAAATGTCCTAAGATACAGCAAGTTTTTCTAGGCAC
AAAACCGAGGCACCTGACAATATGATAAAGTTCAGTTTGCAGATCTTTAGTTGTATGTGA
ACGAATACTTCATTCAGTTCTTTGTCTTTCCTGTTAGATTGGTGGCCTCTGACCTCCCAT
TGCAAGCAAACTTAGCTTATAAGTAGGGCTAACTCATGTTTAGTTAGGATGGCATCCATC
TAACTCGTCATATACCTAGATCTAGTATGATTTCACTGTGTAAAAATTTGACCAGGAATA
TGGCTCAAATGGAGTCCTTGAGGGCAATTACTGGCATTGCTCCGCTCCTCCAAATATGGC
CAAGGAATAGCCCTAGTGGCCCTTGAGCACTGCTAAGTGTAACCCCTATTTTAAATTTTT
TGTGTGTGTATGTAGATGTGGGAGTTTGGATGTGACTCAAGCTGTAGGTTCCATCCCTAG
TGCCACATCCCCTCCCAGTACTACTGGGTGTGGCTCGCTGGTGACCCTAGAACACCATAG
ACCCCTGAGCATGTTCACTTCCAGGTGTGACCTCCCACAAAATAAAAATAAATCTAAAAT
GTCATCTTTTCACAGGAAATATTAAGGAAGATATCCACACAAATGTTCTTGCTGATTTAA
ACTTGGATGTTAATTTAGTTAAGAAATCATGAGTGTCTTGACAGGCTTTCTGTTGTACGG
ACGAGCCATAGAAATGTATTTTTATATTTACTCTTTTACTCATTGTTTATACTGAAATCT
GGGGGTCCATAGAAATTGTCAGATTATTTGCATGAAAGAAGATAAAATGATGAAGGCGGT
TTAAGGATGTGTCTTGCCTCAGTGTATCAGACCAAAGCAGGAGTATCCTGAGGTCCCCTC
TGAACTACAGACACCAAACCCTTGAGAATATCTTAAAGCCATTTGTAAACTCTTGTGACT
TAAAGTGGATTCATTAGATCGGTTCTAGCACAACAGGATTATGCTGAAATTACTATAGAT
CTAACATCTGTAAGCACAAATGTGCTTATAATGTAACCTGTGCACAGATTAGCAGATCAG
AGAGAGAATGTTGCCAAAAATAATAGCCCCTGTTGAAACCCTCTTCTGACTCTCAGATGA
CTAGGGCCCTGATCATCTCTCTTGAATTCACGTCTTCTATATTTCCTCTTAATCACCCAT
TTTCCTATTTTTTGTTTTGGATTTTTTAAAAATTTGTATTAAAGAACTGTAATTTATAAA
ATAGTTGGTAGTTGAAGGGGATTTGGGTTTGGGTTTGGGTTTTTTTTTGCTTTTTGGGTC
ATACCTGGCGATGCTCATGGGTTGCTCCTGGCTCTGCACTCAGAAATTACTCCTGGCGGT
GCTCAGGGATTGAACCCAGGCAAAGCAAATGCCCTACCTGCTGTTCTATCCAGCCCAGGT
AGTTGAGTTTTAGGCATATAATGATTCAACGCCAGTGCCACCACAATTATCAACTCCCTT
CACAGGGATCCCATATTCCCTCCTCCCCCAGTTCCCACCCCATCTCCCACCTGCAGATTG
GCAGTCCATTTGCTCTCTTCAGTGGATGCAGCTTAGATCTTATTTCTCCAGTTTTGTTGA
GTCCGTGTTTTGGAAAAATAACTACATCACTCACTTATATCATCAGTATAACTGAAGCCC
TGATGCCTGTTCTCCCATTACTTCCCATTCTCTTCTCTCCCCCGCTCCTTTATTTCTTCC
CTTCTCTGTCCTTCTCCTCTCTAAACACTGAGTTCGAGGGTGATTTAGGCATATCAACTT
TGTTTCCTCATGCCATATTCTATATCACAGATAAGTAATATCACTGTTTTTTTCTTTCTT
CTTCTGCTTACTTCACACAACATGATATCTTCCAGTTCCAACCGGGCTGCAGAAAATTGC
ATTATTGCTTCATTCCTTGCAGTTGCATAGTACTCCCTTGTGTATATATACCACATCTTC
ATAATCCATTCACCTGTCATTAGACACCAAGGTTGAATTTTACTGAGTGCAACAATGAGT
AATGGTGTGCATATGTTCTTCTGAGAGTGTCTTTATACTCTGGGGTAGATGCCCAAAAGT
GAAATTGCTGGGTCATAATGACATTTCAATTCTAAGTTTACTGAAGGGTTTGTCTAAGTT
TTCCAAAGGGTTTGTCCAAAGAGCGTTTTCATCAGCAGTGAATGAGAGTTCATTTTTCAC
CACATCCCTGCCAACACTAATTTTGATATGCACCATTCTCACTGATGTGAGATGGTATCT
CATTGTTGTCTTGATTTGGATTTCTCTGGGATTTGGATTTCGCCTGTGATAAGTGATACC
GAGCATTTTTTTATGTGCCTATTGGCCATCCTCCTGTCTTTCCTGAGAAGTGTTTATTCA
TTTCCTCTGCCATTTAGATAATTATATGCTGTCATCTGCAGTTGATTACACTGGACACCT
ATGTTTGTTTACCTCTGCTCTTCAAAATCAGAACTGTTTCACAAATAAATTGATTTTGTA
TAGTATATTTGGTTCTTATTGAAAGTTGCCAGGTCTTTCATAGGTTGCTGGAACATTTGG
GTACTCATTACATACAGACAGTAATTACAATTTAAATTGAAAATATGACAGTCACAAAAT
TTGTTTCAGACTCCCCTTATTATGAAATTAAAGCAAAATTTGTTATCATCAAAAAATATC
CTGCTTTACACATTAAAGTATTATGTATTTTTAAGAAGCAACAGATGTAGAAAGAAGAGC
TGGAGGTGTCAGATCCCATCCTGATTTGACCCTGGTACCATGTACGGTACCTTGACCATC
ACTATGTGTGATCTCTGAACACAGAGTCATGAGTGGGCCTTAACCCAGCCAAGTATGACC
CCAAAAGAAAAAAATGGCATTGGAAAGCTACAGTAGTATTTTACGTGTTTTATTATAATG
GTTAAACTTAATTCTAAGTGTGGTTTTCTGTATAGCTTTTTGTAGCACTGTCATCCCATT
CATGCCATTGTTCATTGATTTGCTCAAGCGGGCACCAGTAACGTCTCCATTGTGAGACTT
CTTACTGTTTGTGGCATATGGAATATGCCACGGGTAGCTTGCCAGGCTCTGCCATCTGGG
CGGGATACTCTCGGTAGCTTGCCGGGTTCTCTTAGAGGGACGGAGGAATCAAACCCGTGT
CGGCAGCATGCCAACCAAACGCCCTACCCACTATGCTATCACTCCACTCCGTAAAACTTT
TTGTGAAGCTTAAAAATTAATCTTATTTTGGGGCTGGAGCAATAGCACAGTGGGTAGAGC
ATTTGCCTTGCACGCGGCCGACCCAGGTTCGATTCCCAGCATCCCATATGGTCCCCTGAA
CACCGCCAGGAGTAATTCCTGAGTGCAGAGCCAGGAGTAACCCCTGTGCATTGCCAGGTG
TAACCTAAAAAGCAAAAAAAAATAAACTAATCTTGTTTTACTTAATGGTTAATTTCTTAT
AAGTAAGTACTACTTGTGGATTGGAGCGATAAGACAGAAAGTAGGGCGTTTGCCTTGCAT
GCGATTTACCCGGATTTGATTCCTCCGTCCCTCTCGGAGAGCCTGGCAAACTACCGAGAG
TATCCCGACTGCACAGCAGAGCCTGGCAAGCTCCCTGTGGCTTAGTCTATGTGCCAAAAA
CAATAGCAACAAGTCTCACCATGGAGACGTTACTGGTGCCCGCTCAAGCAAATCGATGAA
CAACGTGAGGACAGTGCTAAGTAGTACTAGTGGGATATTCTATTGAAGCATTTTAGTAAA
GAGATTAAAGTTAATTAAATAAAAAAAATGCTGGTGGTGATATTCTAGCTCTTGATAGGG
ATTAAAGTTGACTGAATTTCACCAACTATTTGAATAAGACCGGTTGATAAATGGCTTACA
TACACAATATGAACGTAATATAATACCTGTTGGGGCTGGAGAGATAGAGAAGTGGGTAAG
GTGCTTGCCTTGCACATGGCCAACCCTATTTCCATCCCTGGGACCCAAGCCCTGGGGGAG
TGATCCCTGAATGCAGAGCAGGGAATAAGCCCTGAGCACATCTGGGAGTGGCCCAGAAAA
CAAAAAGAAAACGCTAGTATCTGGAACTCTAAATACTAAAACTCATGAGATTTTTGTAAA
AATTATTTTCTTTTTAGATTATTGATAAAAGCAAGAGAGATCCAACAGAAGAAATTGAAA
TTCTTCTTCGTTATGGACAGCACCCAAACATTATTACCTTAAAGGATGTAAGTATATTCT
TTATTGTTAACCATTTGACTCCGTTCAAATATCATGATATTTGAAATGTGTTCAAATATC
AGGTAGTAGAAAGAAGCAGACATGGTTACATTAAAAATTATATTGAAAGGAGGCTGGGAA
GATAGTACAGAGGTAACTTGCATTGCACATGGCCCGCTTGGTTTGATCCCTGCCACTGAA
CATAGTTCCCCGAACACTATTAGGAGTGATCTCAGAGCACAGACCCAGGAGTTACGCTTC
AGCGCCACCAGAAATGGTGCGACACCCTCTGCCCAAAAAAGAAAATAGCAGGCCAACATA
GGTAGAATTATTCCACTTATAAAGAAAAGGTGTTGTAGAGCAGAGCAATAGTACAGAAGG
AAGGGCACTTTCCCTGCGCGTGGCTGGCTCGGGTTCAGTTCCCCAGCACCCCATATAGTC
CCCCAAGCCCATCAGGAGTGATCCCTGAGTACAGAGCAAGGAGTAATCCCTGGGCCCAGC
TGGGTGTGGCCCCCAAACCAAAAAAAAAAAAATAGGCTTACGTGTTATTTTTTTTCCACT
TCTGCCTCAAGAAAAAAATATATTGAAGACGTTATATTTAATGTCCATTTGTACTTGAAC
ATTTGGGTACGAGTAATTGTGGAATAACCAGGATTCCCCAAAGCATCTTCTATGGTACTG
CCAAGGAGCACTCACACTCTTACCTAACCATGACACTTCTTGTCCCTGCCTTCTGCCATA
GTAGTTGTCACACTTTTTCACATACCCTGTGCACCAACTATGCTCCAGCATGTCCGTAGT
TTCTTGGCACGCTTAATTTCCCTAATGCAGCTCAGTAGAGTGCCTTGGCCTGGATAACTG
CCTCACATCTCGCCTTGACTGAGACATTGTTACACCAGGAAGCCTGCACTTCCTATCTCC
ATTCTAGGGACAGAGTGTCTTGGCAGCTCTCTGCTCTCCATGGCTTTCATTGTAACAGAG
CTCTTGGTAGAGGGTGTCAGCTCCACCAGGCAGCATTCAGTCGCTTGTTGATGGTGCTCA
CAGACCTTACCTGGGTGCTGTAGACCAGAGAGATCACGCAATCTTATGGCTAAGCCAGAG
AACTTCCAAATACCTCCGACATTTTACGAATTCCCTAATTTATCCTCCTCCTTCCTAGCC
ACAACTTAAGTTCCCACAGAAGAATTTATCATTGTACGTTGTTAGAAGGAAAATGTTAGT
CCCATTAAAACATTAAGCTGCTTACTTGAAGTGATGCTTTAACAACTCGAACCAAGTAAA
TGAAAAAAAGAAGCATATAAAATACATTTTCTCAGACTTGACTTGGAAACTTGCCAAGAT
TTTAACTATTAGTTTCAGAACTTTGCCCCTTCTTTTCAAATTCCAAAATTTTCCACAACT
TTAGTACAACATCCCCAACACTTTCACCTCTTATTTCCATGTCTGTTTCTCCCTGCTAGA
ATAAAAACTTGGATGGCGTGTATCTTGCTTTCTCCTCATTTAGGGCCCCAGAATTTGCCT
ACCTCTTTTGAAATTAAAGAAAAGTATACAGTAGTTCTATGATGTTGGAATGTTTTTTAA
AGGACTAATCTTTAATAAAGGAGTTATTTCAGTTCAAAATTGCCTGGAGTACAATTCCAA
ATTGTAGTTTTCTATTCCTACTTTAGGAGTTCACTGGTATACTTCTGTGTGGTGGGATGG
AATTTTTCTCTGATACTTAATCTTCCCACACTGTAATTTGTCTTTCAGTTTAATGAAAAA
CAGAATACTCCATTTTTCAACCATGTGTTTAAATATAGAACTTCCGTGATTGGAATTGCA
AGGAAAATCAATAGATAGAAACGAGATCAAGAAGAACAAAACTTAAGGGCAAAAGTTTAA
TGCCTCTTCATATACAGTGTCCATGGTGAATTTTATTATCATGAATTAAGTTTCACAGAA
GAAAATTGCAGGATATATTTGATACCAAGTCTCATCAGTTCCTATTTTAATAATCTTATG
TGTCTATGGTTATTTTAAATTTTTTGACCTCCATTGGGCTAGAGCGATAGCACAGTGGGT
AGGGCTCTTGCCTTGCACGAGGCCAACCTGGGTTTGATTCCTCTGCCCCTCTCAGAGAGC
CCGGCAAGCTACCGAGAGTATCTCACCCGCACGGCAAGCCTGGCAAGCTACCCGTGTCCT
ATTCGATCTTCCAAAAACAGTAACAACAAGTCTCACAATGGACACGCTACTGGTGCCCAC
TCGAGCAAATTGATGAGCAAAGGGATGACAGTGACAGTGATCTCCATTTGTTGTGATAAG
TAAAAAATTCCTTGAATATAAAAGGAGTTAATTTTTCTTCATTGGACTGGAGAGACAGCG
CAGGGGTTCAGGTGTTTGCCTTGCATGATCCCCAGTACCACAGATGCTGCCCCCCACCCC
ATCCCTGCCAGGAGTGATGTTTGAGCATCAAGCCAGGTGTAAGCTCTGAGCACAGCCAGG
TGTGGTGCTCAAAAACAAACCAAAAAGAGGGTTAATTTCTGTTCAGTATACTAAACCTTG
TTCTGGGCATATGTAAAATTTCAAATAATTTTTTACATCTTGGTGTTGAATTATATAGGT
GTATGACGATGGAAAATACGTGTATGTTGTGACAGAACTTATGAAAGGGGGTGAACTGCT
GGATAAAATTCTTAGACAGAAATTTTTCTCTGAACGAGAGGCCAGTGCTGTCCTGTTCAC
TATAACTAAAACCGTTGAATATCTTCATGCACAAGGGGTAAGTTCTTTTTGACGTTTTAT
ACATAAACATACATATTTATACAGAATGCTACCTGCGTACCTTTTTTCTTACCTCTTTTC
CCTTAATGTTTGAGATGAAATTACAATGACAGAAGTTGCTGTATACAGAGAACGGGAAAT
ACTAGCAAAAGTTTTCTTCCGTTCTTCCATTACATAAATACCCATTGAGCTTCAGGTGCT
ACTTTGACGTTCTGTAGCAGACTGTAGCACTGTCATCCCCTTGTTCATCGATTTGCTTGA
GTGGGCACCAGCAACGTCTCCATTGTGAGACTTGTTCTTTCTGTGTTTGGCATGTCCAAT
ACGCCACAGTTAGGCTCTGAGGTTCTAGGTTGCTTAAATTAAATTCCTCTATTTTCTACC
AAAAATGGAAGGGAAGTCTTCTGACACAGAAGGCAGCGCTGTTTGTGGTAAACCACCCCT
GGTGCTGAGAGTTGGGCCCGTTTCAAGCGCAGAACCAGAACCAGAGAGACTGGAGTTGTA
TTTGGATATAAAAGAAAATCCTTCAATGGGGGCCAGAGTGATAGTATAGCGGGTAGCACT
TTTGCCTTGCACGCAGTTGACCCAGGTTCAATCCCTGGCATCCCACATGGTCCCCCAAGC
GCCACCAGGAGTAATTCTGAGTGAAGAGCCAGGAGTAACCCCTGTGCATCACTGGGTGTG
ACCCAAAAAGCAAAAAAATTAAAATTAAGATTGCAAAGAAAGGGAAAAATACTAATAGAA
CAAAACAAAGGTTTTAATGAAGGCAAGTCTCTGAGGGCAATAGGACCGAGGAGCAAATGT
TGGGTGGGGAGGAGCAAAGAAGAGCAGAGACTAATGCTGAGGTGACTGATTAGAATACAG
ACTCAGCAGCTGCTGGAAGAAGCACCTAAGTCTAATGGGGAAGGTTGACAAGGGTTATGA
TAAAGTATTCAAATAGATGATTAAAAACAGAAAATAATATGTAACTCCAAAAGAATGTGT
GTGGCAGAGAGAGAGAGATTGTCACTTGGATATCAGACAGTAATACCTAAAGTCTAGAGT
TTTACATCTTCTACACCCTTCCCTGTTTCATGGAGCCTGTCAGCACTTGTCTTGGATCTT
GTGTATGCCATTTCCTTCACTTAGGATGCCCCCCACCCAACTGTTCATACTTGCTCAGTG
TTCTCTGTGTCCTGGTTCGTATATCAGAGTTCTCTAAGAGTCCCCTGAACTCCCCCCTTC
TCCCCCCTTACACATTATCTCTTGCCTGTTAGAGCTCTGCCTTTCTCAACTGCAGTGTAA
GCCCCTAACATATAAAGCCGAGGACCTTAGGAACTTGTTCATCACATCATATAATGCAGC
TTCTTCTATATTACTCTGGCTCATGACAGGTGTTCACTAAATATTTGTTGAATGAATGAG
TATCCTGGAGACAGATTTTACTGCTAATTGCACCCACTTCCTCTGTTGGACAGAGGGAAA
CCCTGTTCTTTCTTCCTTCTCTCAGTCCTCCAGGTCTGTGGTATTAGAGTTAAGCTCATA
TTAACAGCATTTTACAATGGTAGGATAATTAAAAGGTCAGTACTCCTCATCTTCCTAAGT
GCATTGCTTGACAGCTGTTGAATAAAAAAAAATTTTCTGTAATGGAAATGTATTGCTAAT
GCAACTCTTTAATTTGTGTTTCAATTAGGTGGTTCACAGAGACTTGAAACCTAGCAACAT
TCTTTATGTGGATGAATCTGGCAATCCAGAATCAATTCGAATCTGTGATTTTGGCTTTGC
CAAACAACTCAGAGCTGAAAACGGTCTTCTCATGACTCCTTGTTACACTGCAAATTTTGT
TGCACCAGAGGTACGTTTTAGAGTTTGTGTGCAGTATTTCAGCATGTTTTAGAAATCTTT
TGCTGTGCTTAATTGAATAACTCATAGTTGTTTAATTAAAGACTTACTGACAAGTAGTTA
AAGTGTCCTTATTTTTTCTTATGTTGGCATTTTCTTCNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNTCAGGCTGCCTCTGTGGCAGGCACTTTGCCCCTCCGCTGTTGTCCTAGTGTTTCCT
TCCTTAACTTATTCCCCCATCCCACTCCTGCCCTAGCGCAAGCTCCCTGCTCTTCCTCTC
TACTGCCTTTTGGCATTTCACTTTGCCCTAGGAAGTTTCTTTATATCCACATATGAAAGA
GATCATTCTGAGTCTGTTCCTCTCCCCTGGCTCATGTCTCTTGACATGATGCTGTCCAGA
TCAATCCACATTCTGGCAAATTGCATAACTTTATTTCCTCTTAGAGCAGAGTAGGATTCC
ACTGTGTATCTGTATCCTGGTTTCTTTTTCTTTCTTTTTTTTTTTTTTTACTTTTTTGTG
GAGGACTCACACCCAGTGATGCTCAAGGGGTTACTCCTGGCTCTACACTCAGGAGTTCCT
CCTGGCAGTGCTTGGGGGACCATATGGGATGCCAAGGATTGAACCCAGGTCGGCTGTGGG
CAATGCCCTACCCGCTTTACTGTTGCTCCGGCCCCTATCGTGGTTTCCTTGTCCAGTCAT
CTGTCTATGGGCATTTGGGTTATGACCATATTTTGGATATTGTATGTAGTGTTGCAGTGA
ACGTAGGAGGAGTGTAGGTATCTTTTCTGCATTGTGCTTTTGAACCCTTGGAATATATTC
CCAGGAGTGTAATTTCTGGGTCATATGTGAGCTCAATTCCTAGTTTTTTTTTGAGGAATA
TCTGTATTATCTTTCAAAAAGCCTGGACAGTTGGACATTCCCAGGAGCAGTGAATGACGG
TCCCTTTCTCCCCAGATCCTTGCCAATACTGGTGGTTGTTTTTGATGAGCGCTTCATTCT
GTGGTGTGAACACTTACTTTAAAATATTTTATCCTGTAATGTATCGTGTTAAAATATCTA
TATTTTTAAATTTATTATAATAATAAATCTAGTATTAGTTACATGTAAATAATATTTAAT
AAGTTTTATCTTGATCTAGTACTTTGTGTAGCTTCATATTTAGCTTCATATCTCACTTTC
ATGGATTTCAGTGAAGTATTACATTAACTGAATTATAGGGTTTTTTGACACTGCAAATAA
AGATAACTAGCCAAAAAAAGAAATGTCACTAATTTGTATTTTCATTCTGTTATAAACTAG
TTACACTCCATTTGCAAATGGACCTGATGATACCCCAGAGGAAATACTGGCACGGATAGG
CAGCGGGAAATTCTCACTCAGTGGTGGTTACTGGAATTCCGTTTCCGACAAAGCAAAAGT
AAGTCTGACTTCCTTTATAAATGTCAAGATTATAATTTTTAAGTAGTATTTTGCAGGGCC
GGAGAGATAATACAGTGGGTTGTATGTGGCCTTGTATGTGGCCAACCCATGTTCAATTCT
GGCACCGCATGCAGTCCCCTGGCACCGCCAGGAGTGATCCCTGAGTGCACAGCCAGTTGT
GGCCTCCAAAATAAAGTGGTACTTTGAAATGGAAGTTATTAACTTTAGTTTAGAAATGAG
CCAGTTAATTTGTTCCTTTTCCAGAAGATACTTATTTGGCCCTATGATCCATACATCTAC
TGTTTCTGATCAATGAGCATGATGAATAATAGTCTTCATGATTTGTATGTCTACTGTCTC
CCACTGTACTTTTCCTAAGTTATCTTTAATCCTCCTAATCCTATAAAATAGGTGGTAGTA
GCCCCAGTCTGACTGGTTTCCACTTAATATGTTCAATTAGTGTTGCATAAGGGCACATTT
TCATGGCATTTCACAGTACTAGATTCTATGGGTGCAGTGTTTGTCCCCCAAAAGCCAGTC
AAATGGAAGAGATGCATCCACTTCACATAAAGCCCATTCAGACACACCAGCTTCCTACAA
ACGTTTATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCCTTCCTTC
CTACATTTTGCTCAGGGGCTATTCCTAACTGTGCTCAGGAATGTGCGGGGAGGGGGGGGG
TCCTGTGTGGCACTGGGGATTTGCACCAGAGTCAAAGGATGCAAGGCAAGCTTCTTAAAC
CCCATATACCTTGCACTATGTCTCCTGTTCTCCAAGTAAATTCCTGCTATTGGGCTCTGC
ATTTCAACCAGCAGCACAAAAAAAGCCTTGCATATTAAAAATTGACTTTGAAACAAGCTG
GTAAAAGAAATGAATAGAAACCAGAATATTCAAGGGGGGAAGCGCCACAGTCCTTACAGA
TGCATAATACGTGGTAACTTTAATCTTTGCAATACACCAAAAATATTGTTCCTCAGGGAG
AAAGAAAAGGTTGGGGTTGTTTGGATAAATTGTCATATGGATAATATTTCTGTGAGTCCA
AAGGGTGGGGGTTGTGTCTGAGGAACAAAGAACGCCCAACAGTATGGAGTGCTGTAGAAG
ATGCAGCCAGTGGAATCAATGGAAAGGTTTAGTGGGCTCGAGCTGTGACTCCTGGTGCAT
GCCTTGCTGGCAGGAGGACAGGGCTTGCTCCCCAGCACCCCGAAGACAAGAAAAACCAAG
AACCCGCCAAGGGTTAAGCTGGTCTTACTCTTTTTCCTATTACAGGACCTGGTGTCCAAG
ATGCTTCATGTGGACCCGCATCAGAGACTGACCGCTGCCCTCGTGCTCAGACACCCTTGG
ATTGTCCACTGGGACCAACTGCCGCAATACCAACTGAACAGACAGGATGCCCCGCATCTA
GTCAAGGTGAGCCGCCCTTCTCAGTCGGATTGTCTCCGGGCGCTTCCTTCTCATTCCCAC
TCTTCTTTCTTACATATAACCCCACCCCCCAAATAAAACCAACTCAGAGGTTATCTGCAG
TGGCCAAACACAGGCTTGCAAAGAGCACACAGCCCTGCAGTCTCACATTAAGAGATTGAC
GTGGCGGGGGCGGAGCAATAGCACAGCAGGTAGGGCATTTGCCTTGCATGTGGCTGACCC
GGGTTCAATCCCCAGCATCCTATATGGTTCCCCAAGCACTGCCTGGAGTAATTCCTGGTT
GCAGAGCCAAGAGTAACACCTGAGCATTGATTGACCCCCCAAAAATTTTTTTAAAAAAGA
ATTGACACGGGGGAAAATTCCTGGGTGGGGAAAAAAACAAGGATTGCTTATTAGGAGTCT
ATCCCTGTCTCTTGTATGTGATTCAGCCTCTCCTATTGTCATCTGCAGGGTTAGTTAAAT
CAGAGCATTTGAGCAGTGCAGTTCTTTTCATTATAAATCTAATAAAATCGATATACATTT
GGCAAGGAGCAAATTAGGGGGGGGTGGGTTTTCAGTTTGTATTCTTTGTGCATGGAACTG
TCCACCCATTGTCATTTCTGTGTGACCTTCCTTTTCTGTCATCAGGGTGCCATGGCAGCT
ACCTACTCTGCTTTGAACCGTAATCAGTCACCAGTTTTGGAACCAGTCGGCCGCTCGACT
CTTGCTCAGCGAAGAGGTATTAAGAAAATCACCTCCACAGCCCTGTGAAGTGACCTCAGT
GAGATCATTGGTACCATGGTGTAAGCTGATAGCACAAGTTCTGGCGACAGGTAGCACATT
CTGAGAGACACCTGCAAGCACACACTGTCCCAGCTGGTACCCATAATGCTGCTGCTCCTG
CTGCTGCTCCCGCTTTCGTCTCTTCTCGCTTTAAATGATTGTTAGCAAGTTAGATTTTCC
CGGAGCTTCGGATGAAACGGAAATGGAAACAAGATGAAGATGTATTCACTGAATCAATGA
GAAAAATAATGAACACATGAATACCACCTAAAATACACTGAATAAAGTACTCTACACCAT
ATAGCATTATTTTTATAGGAACTATTTCATGTCCCTGAGATATTCTTTGTTAGTTATAGG
GATGGACAGTTTATGTTAAGCACTTAGCTTAAACGATCCGTTTATATTAGCACTGTATCC
CTTGTGCCATCCAACATTTTGTATGTTTTTGTAAACAGTTCATATACAGTACATTTCTGT
ACTGCTTTCTTTAATGTATACATGCCTTGTTTAAACTTGCAATCTGTTACTATTAATCAA
TTGACGATTAAATCTGGTTCAATAGTTCACCTGGATTAACAGTATTGTTGGACAGCCGTG
AAAGTGGTCAGATAGTGGAACAGCTGTTGAATGTAATTCCTCCAAAATGTATATATCTTT
CCCCATGTCTCTTTCACTGGTTTGTTGTCTGTTGCTTAAAGTCAGGTGCTCTGTCAGACT
TCCCTAGAGAGCTGTTTTGGCAAAGAAAGGTTCATGTGTGTGGCATGACATCAAGAGTAC
TACACCTGTGAAGTTAGTCCATATACTTTGCAACTCCTTCGGGTTTCTTTTTCTTTAAGG
AAGTAGTCCTTGCACTTTTAATCATAAATTGTATCTATATTTAGTATTTGGCACATACAT
TGGGATTTTACCAATATGCTTTAAAGGACTTTACGAGTCATAGTGAAGTCATTGGTGAAC
GAAATTAGCAACTGGTCATTGAGGTCTC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1057, 26799..26915, 35614..35695, 40884..40964, 41742..41821, 42398..42504, 46749..46786, 47174..47316, 47545..47580, 47584..47586, 47589..47605, 56585..56673, 56854..56918, 57002..57104, 77189..77313, 78885..79010, 84917..85006, 87598..87756, 89428..89589, 90822..90898, 93120..93237, 94605..94745, 95385..95507
1001..1057, 26799..26915, 35614..35695, 40884..40964, 41742..41821, 42398..42504, 46749..46786, 47174..47316, 47545..47580, 47584..47586, 47589..47605, 56585..56673, 56854..56918, 57002..57104, 77189..77313, 78885..79010, 84917..85006, 87598..87756, 89428..89589, 90822..90898, 93120..93237, 94605..94745, 95385..95504
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved