Sorex_araneus Locus TFE3
snOPY snoRNA Orthological Gene Database
Sorex_araneus TFE3
Sorex_araneus
TFE3
GeneScaffold_496
SNORA42
5061..5182
11921
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTCTTTGCTTCCAAACCCACGAG
CAGCCTGTACACTGCCTCTAATGGATAGGAAGTTTATATCCAGGGTACTCTTCCCATGTG
TCATCAGCACACCTTTTGATTTACCCTTTTCTTTGGTGCGCAGAGAACTGTCCATAAGAT
CTCTTCTGGGGTGGGCTGGGGGGGTGGGAATTCTTTTTGTGGAGTGGTAAATCCTTCTGT
GAAGTGAATCATCAGTCACAGTTTTCTTGGTGATGAACACAGTTTGTATTCCAATGGCCA
GTTGGCCCCAAGGTTAGCTGAACACCCCCCCCCCCCCTGCTTCTATGGTGGGTTCTGGTT
CTGCTGCCAGGAAAACTGCTGAGGGGTAGTTGTGGGACTAGGAGAACTTTGCCTCGTCAG
GAATTCTGCGAAGTGAAACGTCATTCCGAAATCCTTTCCTATTTTCCTCAAATCCAGGTT
GTGACACGTGAGGGTTAGAGGGGAGGAGTTGGGAACCAAGTACTCATTATTTTGAATCTT
GAGGGCCTAAGAGGGAACACGAAAGGTAAAAGAGAGGAGGAGGGGGGCTGTGCCGTGGGG
AGAGTCCTCGGAATGTCTTGGGGGTGGTCTCCTCAGAGATGTAGATCGAGAGGGAGGCAC
GCATTTCCTGTGGCCTTCCCTTCTGGTGTGCTTCCCCCCTCTGGGGAAGAGGGCTCTTTA
CAATCCCTGACCATCATCCCTACCTCCCCCACCCTCTCAGCCTGAACTCTTTACTTCCTG
AATCCGGCATTGTTGCTGACATCGAATTAGAAAACATCCTCGATCCTGAGAGCTTCTACG
AGCTCAAAAGCCAACCGTTGCCCCTCCGCTCCAGGTACGTCTCTGCGATGGTGCTTCCCC
TGTCTGTGCTTCAGGCTGCAGCAACCCCTGGTCAAGCCCTGATTAAGTCCTTCAGTGCCA
GCCCCAGCTTGTTCTCCCCCAGCCTGTATTTTCCACCTAGTCAAATTAGGGGCTCGCAAA
AGCATGTCACGCCGAAAAGCAGGTGGCTAAGCTAGGATTCCAGAAGCTCCCAAGAGACCC
CACCCCCGCGCAGGCTCCCCTCTGCCAGCCCGCACTCCCATTCATAAACTAGTATTGCTC
GGGGTGGGGCGGGCGCGATCAAGCCCACACCTCCCCCCGTGGGCGGAGCTCTGCCCACAG
CCCCTGCGCATCCCCCTCCCCTCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGCCCCTCTGCTCAGCGT
ATGAACAGGCCCAAATCACGGGTTCATGCGAATAATCAAAGACAAAAAGTCCTCCATTAG
ACTTGAAGGCCTGGGGCAGGCTTGCATCGTGCTGTCTTCTCTAGCAGACTGTGACTGGGA
AGGCTGGGACTGCTCCAAGCACACCTTGTATCTCCCTGAGGGCCCAAAGCAGCTAAGGCC
TGATTCCTGTGTCTCTCCCGACAGACCATCAGACCGTGGCTTCTGAAAACAGGGCCTGGT
GCCGGTGTCTCCTCCACCCATCACTGTGATCCTGTTAGGCCTGGGACCGGATCGTTAGCT
TACCTGTGGCCCCATATTTCCCATTCCACAGCCTCCCAATCTCACTCCAGGCCACACCAG
CCACCCCAGCTACACTCTCTGCATCATCTTCTGCAGGGGGCTCCAGGACCCCTGCCATGT
CGAGCTCTTCTTCATCACGGGTCTTGCTGCGGCAGCAGCTCATGCGGGCCCAGGCGCAGG
AGCAGGAGAGGCGTGAGCGCCGGGAACAGGCCGCAGCCTCTTCCTTCCCCAGCCCTGCAC
CTGCATCTCCTGCCATCTCTGTGGTTGGCGTCTCTGCTGGGGGCCATACTTTGGGCCGTC
CTCCTCCTGCTCAGGTGCCGAGGGAGGTGCTCAAGGTAAGGCCTCACCCAGAGGTCCGGG
GATGGGGCACCTGGTGGCTTGGAGTGAGAGCACTGGGAGAATTACATGCATGAGGGTCCT
TGTTGAGTTTTACACTTTCTGGATGTTTGTGTGAAGTTGTGGGGGTGAAAGGGGAGTGCC
TCAGAGTGTCCTATGTGCCCCAGGTGGAGCCAGAGGCAAGTGGCTGTGTAGGAAGAGCTC
TGTGGCCTTGGGGCGTGTGGGGAGCTCCTAGGCCATTGGGCAAGCCGGATGCCCGCCTTA
TGCTCCTCCCAGGCCTGTTTAGGGGGGTATGATAGTCGAGGGACGGGAGTGGGTTGAGTG
ACAGGGTGCTCCAGAAATCAGGAGGGATTCTGCTCGCATTGGGCCAGTTTGAGAGCCTGG
GAGGGATTTCTCCGGGTGGCTTATCAGCATGAGGGGGGAGTAGGGAGGAGCCTCAGATTC
TGGGGCAGTTTGTGCTGGCCTGAGTACGGCAGCAGAAGTCACTGCACTGTGTTGATCCCT
GTTATCCTGTATCCCCTCCTCCTTTCTTTCATAGGTACAAACTCATCTGGAAAATCCAAC
ACGCTACCATCTACAGCAGGCGCGCCGGCAGCAGGTGAAACAGTACCTGTCCACCACCTT
GGGACCCAAGCTGGCTTCCCAGGCCCTTACCCCACCACCAGGGGCTGCGAATGCCCCACC
CCTTCCAGCTCCCGAGGCTGCCCACACAACTGGCCCTACCGGCAGTGCTCCCAACAGTCC
GATGGCCCTGCTCACCATTGGGTCCAGCTCAGAGAAGGAAGTAAGTGGCTGTGGAGAACC
CCCCTTCCCACCAGCTCTCCTCCCAGGGCCTACTTTCTTGGTTTTTTTTTTGGTTTTGTT
TCCGGGGCACACCTGGCAGTGCTCAGAGCTGATTTGGCTCTATGCTCAGGGATTACTCCT
GGCAAGCCTTGGAAGATCCTGTGTGGAGCTGGGCATCAAACCTGTGTTAGCCACAGGCAA
GGCAAGCGCCCTCCCTGCTGTACTATCTTCTGCCCACACCCCCGGCCCACCATCTTCTTT
CTTACCTGCTTCCTGCAGATTGATGATGTCATTGACGAGATCATCAGCCTGGAGTCCAGT
TACAATGATGAGATGCTCAGCTATCTGCCAGGGGGTACCTCAGGACTTCAGCTGCCCAGC
ACAGTAAGCCCTGGGATGAGTGGTGGGTCTGAATGAGTTGGCAGCCTCACGATCACCAAG
TCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCTTTATGTGCAGTG
GACCCTGCAGATGATTGTGTCTCCACGAGTGGAATCTCACAATGCCATTGTGGCATATTG
AGGTGCTGTTGCTTTACCCCGGGAGGGAGCATGAGGCAGGACTCATCTGGCAACTGGATT
ATACCAAGAGAGTCTGGTCATCGAGATATGGAAGAGCACAAAGTAATGGGAACATATCAA
ATGTCTGAAAACTTGGTGTAGTTGGACCTTGAAATAATTGGAGTGTATCATTCTCTTGCT
GTGTATTCTGCCAGAAGGCTTGTCCCCCCTGTAGAATGTGTATAAAACCCACTAGAGCAA
GGAGTGAACCAATAAATTGGAACACAGTGTTTCTGGGACAGTTTAAGTTTGCTTATTTGC
TCAGGTACATACTAACTGGTTGTACCTTTGCTTTGTTCCAGCCTCTCCAGCAGATAGGGC
CATATATAAAATTTAAAGATTGAGGGGCCAGAGAGATAGTACAGTTGGTAGGGTTCTTGC
CTTGCACAATATCAACCCAGGTTCAATCCCCAGCACTCTGAGCCTGCCAGGAGTAATGCC
TGAGTGCAGAGCCAGGATTAACAGGATTAAGCCCTGAGCACTGCTGGATATGACCCCCAA
ACCAAAAAAAACCCAGTTGATTGAAACACATCTCGAGATTGGGGCCTTATAGGGGATGCG
GCCAGCAGAGCGACGGATGTTTCAAGAGATAAAAGCTGATCCACATCCCCGTGGCCCCGT
GCTCCGTGCAGAGGAACGGTGGCCCTGAACCATCGCCTGGATCTTGCCAGTGGGCTGCTG
GCACTGAAGTGTGTCATAGTGCAAAAAAGGGATGAGCTTCTTTCGTTATAGTGCCTGGTG
ATATTGAAAAACAAACATGTTTAATATTTAGATATTAGATACCATTTTAGGAAGCCATTC
CATGAGATAACGTTTTATCGGTTTAACCACAGTTTTCATTTTCATGATATCTTACTTGAA
TAATCAAAATGTAGTGTGATTCAGTGATAATTTGTAAAAATAACTTGTTGCTCAAAAGTA
AATTGCTGTGATGAACTAAATGAAAATTTGAATTCTTACATGTCTTTAAAGTATTGATCA
TTGGAATATCTATTGGTTTGAAATTCATTAGTGAAGTTGTTAAATGACTAATATTTTTAA
TTTTGTGTGATTTATGTGGCATACTATTATTTATTAACAACAGAGACTGATCCAGAGGTG
GTTATGAATTCGTTTGTTGTTCTCAGTTATGTCCAGGAAAATGCAAAACAGAGGAAAAAT
CTTGTGTGACAAACAGCTCTCTCAGGCAAGCGCATCCAAAATTGAGCGAGAATGCTTGAT
ATCAGATTGCGCAGAAGGATTCATTAGAGGAGTGCTTAGTGTAGGCAGCTGAAACCAGTT
AGATGGTGTTGTTCAATCAAGTCAAAATACACTATTGGGCTGGAAAGGTAGCACCGCAGG
TCAAGTTCTTGCCTTGCAGGTAGCTTGCCTTTGTTCCATCCCTAACACTGCACAGGGTGC
CCTGGGCAATGCCAGGAATGGTCTCTGAGAACCACTGGGTGTGGTCCAAAAAGCAAAAGA
AAGGGGAGAAAAAAAACAAAAACAAACAAACAAAAACCTGGTTATCTGGCCGGAACTCTC
CAAAAGGCTAGATTTGGGGTGGAATGTTGCCATGACAATTTCTCAAGGTCTGAGCAGAGT
GGGCTGATGTGTTCCAAGAATTCTAGATTGGAATGTCCTGCTCTCAGAACGACTAATGGA
CCAGCGTGTTACATTAGAGCTGAACCATCCCCGACAAACCCCAGTCTGCCGAGACTGCTG
CAGTTGGAGAAAGGGGCTTCATCGGTTTGCTGAAAGGATCGCATGGGCTGAACCACCANN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNCTTGATGCTTAGGAGTATTTTGAGAAAATGGTGTAGTGCCAGAGATTGAACTTGAG
AGTTCCTGCCAGAAAATCTTGTGATTAAGCCCTCACAACTCTCTCTGTCCCCAGTGTCAC
TCTTTCTTGGAGGGGCGGGGGGGGGGGGGGAGCTGGTTTGTGTTGGGTCTACACCTGACA
AGGTTTGGGGGATCAAATGTGGTGCCAAGGATCAAACTGGGGGTCAATGTGTTTAGTAAG
GCTTATCCCCTATACTATCTCTCCACACCCCCTACCCTGGCACTTTTTTAAAAAGTCATT
TCCCCTTCCTGTACCTCTGAAGCTCACCTCAGCAGCTCCCCTCGAGGCCCTGTATCTTTG
TGTATGTGTGTCTGAGACCCTGACTGTGCCAGCTTTCTTACCACACCCACTTTCTTCCAG
AGACCGAGGCGAAGGCGCTTTTGAAAGAACGTCAAAAGAAAGACAATCACAACCTGAGTG
AGTGAACAGGGCTGGAGCGCCCTGCCTCGCTCTGCCCCAGCTATCCATCTGGGACCTTCT
TCCCTGCCTTAGGGTCCCCTGCTCTCCAGTTTCTCCTCCTCCCTCTGGGTCCCACCACTG
ACTCTCCCACTCTTTCTTCCCTTTCCTTGCCTCCTAAGTTGAGCGTCGCCGGCGATTCAA
CATTAACGACCGGATCAAGGAGCTGGGCACCCTCATCCCCAAGTCCAGTGATCCGTGAGT
CTGGGCCCTGTTCCTCCCTCCTCAAGGGTAGAAGCTGCTTCCAGGCATTTCTGCCCCCCA
CCTTTTCCCACCCACCTGAGCAGACTAACAGGTCCCCCCTACATGCTTTCCCTCCAATTC
TAGGTACGCACCATTATAGTCTCCAGGTACATCTGATTCCCCTGCCCCGGGCTCATTTTC
TGTTCCTTTTGTACTGTACTGATTTATTCAAGAATGAAATCAGAGCTTCTGCTTTGAGCA
AGGCCTGGAGGATCCCCTAGGGGGGAAAACATACCAATTTCCCTGAACGCATGGGTCATT
TTTTTTTTATGAGTGGGCAGACAAGAGGACTAAGTAAAATGCATGTGGACGATAGAGTGC
AGTGGAATGGAAGATCTGGGCGAGCAAGGAGAGGATGTTTGGCAGGGTTTATACTCCAGG
AAAAAGACGATGGGCCCAGACACATGGGAGGAAACGAGTGAGCCTGGAGCCATCTGGGTA
TGACTGAAGCAAAGGACATGGTGGGGCTGCAGACACTGAGGAGGGAATGCCTCTCCATAC
CTGGGGAATTTGGAGAAGCCAGCATGGCTGTAGTGGGAGGAGAGGGAGATGTCGTACAGA
AGCTGCAAGGGATGAGGTCAGAGAGCGCTTGCTGCATTCATGGCATGATGTGGCACTGTT
TGAAGGCATTGAGTAGGGGCTTTTCATCAGAACATTCCAGACCTTTGACGTCCCCCTCTT
ACCTCAAGGTCTAAGGCATGTGGTGTGGATACTTCATCTGCTACCCTTCCCCCTTCCTCA
GCTCCTAAGAGACTCCATATGTAGTGCTCCCCCTTTTTGAATTTTGAGCCACACCCAGCA
GTGCTCAGGGCTTACTCCTGGCTCTGTGCTCAGAGATCACTCCTGGCTGGCCTTTGGGAT
GCTGGAAATTGAATTCAGGTACTCCGCTGTACTGTCACTCCTTTTTTCTCCCCTTGGCAT
GAAGGGAGATGCGCTGGAATAAGGGCACGATCCTGAAGGCCTCAGTGGATTACATCCGCA
AACTGCAGAAGGAGCAACAGCGCTCCAAAGACTTGGAGAGCCGGCAGAGATCCCTGGAGC
AAGCCAACCGCAGCCTGCAGCTCCGAATTCAGGTATGGAAGGAGGTGGCTGGGGCAGGGT
GTGTGCACAGGGGGGCAAGCAGAGGCAGAGCAGGCCAGTACTTCCCCTCTTGACTTGCTT
GGGAGATCTCCAGGTTTCTTGGCTCACAGTGGTAATGATGATGGTGAAGAGAAACAGGAA
TCCTAACAGAGACAAGAGTAACAATGAAGATTGGCTAATGGACATAGTGTAGCTCACACT
ATATCTGTGATAGTCTTATGTCTATTTAGTAAGGAAGTCCTTGTGACAATCCTATCAGGC
AGAAGCCACATCACACCCATTTGTACAGATTGGAACTTTGAGGCTCCGAAATGATGAGCA
ACATTTTTTTTGGTATTTGGGCCACACCCAGTGGTGCTCAAGGCTTACTTGTGGCTCTGC
GTTCAGTAATCACTCCTGGGGGGGTGTAGGTGGCCATATGGTGTGCCAGAAATAGAACCC
AAGTCGGTCATGCATGTGCAAGGCTCTGGCCATGCAACATTTTTTTTTGGCTTTTTGGGT
CTCACCCGGCAATGCTCAGGGCTGACTTCTGGCTCTGCACTCAGGAATCACTCCTGGCGG
TGCTCAGGGGACCATATGGGATGCTGGGAATCGAACCTGGGTCGGCCATGTGCAAGGCAA
GCGCCCTATCCGCTGTACTATTGCTCCAGCCCCAACTTTTCTTAATATTATGACTAGTGA
GAGGCAGAGACTGAGTTCAAAGCACAAGGATCCTGCCCTTGGAACCATGTTACTCTTGTG
CCTCTGGGGAATTTGGAAGTGCATCTTATTCCCCTTCCCCACATTCCTGCTTTTTGCAGG
AGCTCGAGCTGCAGGCTCAGATCCATGGTCTGCCAGTACCACCCAACCCGGGGATGCTCT
CCCTGGCCACCACTTCAGCAACGGAGAGCCTGAAGCCAGAACTGGACGTTGAGGAGGAGA
GTCGATCCGGCCTTGGAACCTTCCATGCAGCTGGTGGGCTGGCCTCGAGCACGGCTCATC
AGCAACCCCCAGCACCTCCCTCGGATGCCCTTCTGGACCTGCACTTTCCCAGTGACCATC
TGGGAGATCTGGGGGACCCCTTTCATCTGGGGCTGGAGGACATTCTGATGGAGGAGGAGG
AGGGGGTGGTGGGGGGACTCTCAGCTGACGCGCTGTCCCCACTCCGGGCTGCCTCTGATC
CTCTGCTCTCCTCTGTCTCCCCCGCGGTCTCCAAGGCCAGCAGCCGCCGCAGCAGCTTTA
GCATGGAGGAGGAATCCTGATCAGCCTCACCCCTCCCCTGGGACTCCCCCACCCAGGAAA
GGAGGCCCCTGAGAATGAGGCCCTGCCTTTCCCCCTCCCCCACCCTTTTGCGGAGCCCTG
CAGTTCCCGGTGGCAGGAGATGAGACAAGATGAGATGAGGCTATGCCCCCTTCACCAGAC
AAAAAGGAGGAGCCTGGTGAGGCCCCCACCTTTTCTCCCAGAAAGCACCTTGTAGGCATT
GCTGAGCTCTGGGTACCCAGCCCTAGAGATCACAGCTGTGTCCCATGCTGCCTCATGGGA
CCCACCCTTGCCCAAGTGAGGGAAGGAGATAGGCTGAGGTCTGCTGCTGTCCCTTTCCCT
TAGGGACTGTCCTCACTAAGTGTCCTGGGATAGAGATGTGTTAGAATGTGGCCCCCAGTC
CCGCTTGGACCCTCTGGTTGCATCCATCCTGGCAAGAAAGAGGAGTTCCCTTGGGGGTTT
AAGTCCTGCCTCTTCCCCCATGAAACCTGACCTGCCCAGGCAAGGCCAGGAAGTGAGGGG
GAGAGCTGACCCCATCACCTAGGAATTCAGTCTGGGCCTCCTCCTAGCAAAGGAGGAGCC
CCGCCCCACCTTTCCTATAGGATCAACTCAGCGCAGGTATTTCGACTCGGACGAGTCAGT
CAGAAATGGCCACCAAGTAGAGATCACAGCCCTTGTCCCGTAGCCACATCCCATCCAAGC
ATTCCACACTGCATGGAGGAGTAGACTTAAGCTCCCCCGCCTTAACCTGGGACCAACTTG
ACTTAACCTAGGAGGGCTCTGAGCCTATTGCCCTTGGAGAAGGGGGATAGTCCTGATGTT
TGGTGGGTTCACATTCCAGACCTAGATCAGGAGGGGGAGTCAGGCCCTGCCCCCACACTT
GAGCAGAGTCCCGCCTCCTTCCTTGAAGGGCACTTTGGGGGAGATGGGGATTACAGGGTA
CTCGGTCTAGACTCCAAGAACCAGTCTTGTTCAGTGTGTAAAAGTGTCTGTTGAGGGCCT
TTTGGGGGCCAGAGTTTTCTGGACCAGAGAAAAGTGAAGGCAGAGGCATGGAGGGAGGGT
TGCAAAGAATATGTCCCCCACTTTTGTCTATCTGATTTTTAATGACACCCCCATTCAGAA
GCTAGGTCATATCCCACCTTTGGTCTTCACCCAATTCTCCATGTGGAGAAATCCTCTCCA
TTTCAGAGTAATTGAGGGTTATCCTTGCCTGTCCCCAGCCCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1113, 2731..3034, 3574..3819, 4098..4202, 6872..6989, 8040..8096, 8258..8333, 9304..9451, 10259..10639, 10644..10700, 10703..10720, 10725..10748, 10751..10769, 10775..10908, 10910..10921
1001..1113, 2731..3034, 3574..3819, 4098..4202, 6872..6989, 8040..8096, 8258..8333, 9304..9451, 10259..10639, 10644..10700, 10703..10720, 10725..10748, 10751..10769, 10775..10908, 10910..10921
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved