Sorex_araneus Locus GOLGB1
snOPY snoRNA Orthological Gene Database
Sorex_araneus GOLGB1
Sorex_araneus
GOLGB1
GeneScaffold_3866
SNORA26
87600..87720
90060
TGACAGTTATTCTTATTGGCCATCTACTTATCTCCTTTGGAAAGTGTGTTCATTTCTCA
ACATTTCAGGATGGGGTGTTGGCCTTTTTTATTTAGTTTTGTGAGTGCTTTGTAGATCTT
AGATATTAGCCTTTATTTGGTGTATACAGATATTTTCGCCATTCAGAAGGTTGTATTTTT
TTATATATATAGCTCGATTTTCTTCTGCTATGCTGAAGCCTTTTAATTTTTTGTAGTCCC
ACTTATTTTTGTTTTTGTTGTCTTTGCCTCTGTGGTCAGTTTCTTGGAGAGTTCTGCCAA
TGTTTTCTTCAATACTCTTTAATTTATTTCATGGCTTCTGGTCTGATCTGGAGGTCTTTA
ATCCACTTTGAGTTTACTTTTGTAAGTGGTGTAAAATACAATCCTAATTTCATTTTTGAA
CATGGGTATGTGGCCTTGCAATCTTCCCAGGATCTTTTGTTGAAGAGATTTTTTTTTTTT
GATTCCACTTCATATATTTTGCTCCTTTGTCATAGATTATCTGTACAGAGATCTGGGAGT
TTAACTCAGGACTCTGTTTTTTCCATTGGTCTGCAATCTGTCTTTATTTCAGTACCATGC
TTTTTTGATTATTATAGCTTTTTAGTACAGTTCAGGGTTGGGAACTGCAGTGCCTCCCAT
CTTTTGTTTAGGCTATTAAGTTTTATGGTTCCATAAGAATTTTAGTAGACTTTGTTCAAA
GTCTTTGAAAAAACATTCTCAGATGCCTTTAAAAAACTTTTATTAAAGAGCCATGATTCA
CAAAGTTATTAATAATTGCATTTTAGGCATAAAATAATTCAACACCAGTTCCTTTACCAG
TGTCAACTTCCCTCAGTTGCCTTTTTAAGAACATTAACTGGCTTCAGTTTTAGTCCCATA
TATATCGTCTGAAGTTCTTACTATTTTATTTATAGATAATATATTTACCAGTATAAGAGA
AACTAGATCTACTTTATTGATTCTTTTCTTTTTCTGCAGTAATGCTGAGTCGATTGTCAG
GATTGGCAAATGTTGTTTTACATGAATTATCAGGTGATGACACTGATCTGAATGTGATGA
CTTCTATGGACACTGTAAGTAACTCTGTTTTGAATTAGATTGATAGAGATATGTTTTATA
TTCATTTCAGGAAAAAAAATAGGATGGAAGGAGGGGTGGAGAGGTAGTACAATGACTAAG
GTACTTACTTTGCTTGTGTACAACACTATTTGATCCCTGACACCACATACGGTCGTTCAA
GCATTGCTAGGAGTAATTCCTGTGCACACAGTCACTAGTAAGCTCTGAAAACCACCACAT
GCCAGAAGAGTGGGAGTGGGGAGGGGAGGAGAGAGAGGGAGAGGGAGAGGGAGAGGGAGT
AAAGTAATATGAGTATCCTTTGTGTTAGATGGAGGATCATGAATTTATAAATTATCCTTC
TATCAGGTTGACTTAATAGCCAAAGTGATAGTGATTCCAGGTAAGATTTTGTTTGTTTGG
GGGCCATACCTGGCAGTGCTTAGGGCTTACTCCTGGCTCTGGACTTAGGGATCACTCCTG
GTGGGTTTGGGGTACCATATGGGGTGCTGGGGATTGAACCTGTGGTCAGTTGCATGCAAG
GCAAATGTCTTACCAGCTGTACTATCTCTCCAGCGTTCTGGATGATATTTGAAAGATCTT
TTCTTTTTGACCCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNTTTATTGTTAGATTGTTTAACTCCTGAGTACATAATCCTTCATATTT
AAAAGGAAGGTTTGGATAACAAATGGTACAAATGAAGTACTTTCGGGTTTGAGAAGTATT
TGTTTGCTAGTATAAAATTCCTCTACTGCTACTTTTACAGTGTGTATTGTACTTTCTTAG
GACTACATAAGAAATCAAAATATGTGGTCTGATTTTCTGAATAGATAGTAATATTGCTTT
CTCACTGAGAATGTTTTCTTATTCTTTTTAACTTTTAAAAAAAAATATTTAATTAAAGAA
CCTTGATTTATAATTGATAGTTGAGTTTTAGGACCACAGTGTTCTAGTGCTAATCCCACC
ACCATTGTCAATTTTCTTTCACCAGCATTCTGAAGTTCTCCTTGCCTCCCCACCCCCACC
CCAGCGTACTACCTTCACAGGCACACTTTAAAGTTTGGTAGTTGTAGTGTGAATCTCATG
CTTTCAGTGCTGTTGGGTCTGTGGTTTAGGTTATAGTTATACCACTCTTCCACATTACCT
GTATGCCTGAGGCGCCTCACTCCTGCTCCCTGTTATTTCCCTTCCTCATCTTCTTCCTTT
CCCTGGCCATTTCTCTTTCTCTGTACTTCTACTTTCTGTATGTCAGGTCAGAGATGATCT
AGGCATCCACTCATTACTATATAGCGTTTCCTCGTCCAGTTATTCTGCATACCACACATA
AGTGAGATCATCTTGTAATTGTCCTTCTTCTGGCTTACTTCACTCACATATCTTCTAGTT
CCATCCAGGTTGCAGCAAATTGCATGATTTTATTGTTTCTTGCAATAAACATCTTATAGC
CTAATTCTCGCTCTGTAACTGTATCTTATGGTGATTCAATTAAAAAGAACAGAAAAAAGA
AGGTCAGTCATTTTTTTTTTTTTTTGCATGTGGACCAGTTTTCTCATTACCATTAGTTGA
AGAGGTTTTCCTTGCTCCACTGCATATTTTTTTGCTCCTTTATTAGAGACAAATTATATA
TTGGCAGGTCTGTGCCTGGATTTTCAACTCTATTCCATTGATCTGAGGATGTGTCCTTAT
TTCAGCACTACACTGTTTTAATTACTACAGTTTTGTAGTACAGTTTGATATTGTGGAAAG
TAATGCTTTCCATCTTTATTTTTTTTAATGCAGTAGTAATAGAGACGTTACTGGTGCCCA
CTTGAGTAAATCGATGAACAACGGGATGACAGTGACAGTGACAGTGATACAGTAGAAGTA
CTGTTATTTATTCAGCCATTGATTAAGCTGACTAAAGCAGATATGAATTCAACATTACTT
TTTTGTGTGTTTTTTTTTTTAAATTTTTTATTGACTATCTTTGAGATAGACCATTACAAT
GCTTTGCAGGAGTATTGCCATTTTGGCCATGTAAATTTTCCTAATCCATGGGAAGGGGAT
GTGTTTCCCTTTCTCATGTCTTTTTATTTCCTTTAGAAATATTTTGTAGTTTGTTTTGTA
TAGGTCTTTCATCTGTTTATTAAGCTAATTCCTAGGTATTTGATTTTCTGATGGACACTT
TTGAATAGATGCATTTTTTGCCATGGGGTATTGGTGGCCAGTGATTCTGGTAACAGGGAC
GCTCTGGAACTGGAGCCATAACACAGCTGGTAGGGCATTTGCCTCACACACGGCTGACCC
AGCTTTGATTCCCAGCATCCCATATGGTCCCCTAAGCACCTCCAGGAGTGATAACTAAGT
GTATGAGCCAGGAGTAACCATTGACGTATGTGACCCTAAAAGAAAAAACAAAAAACAAGG
CAGCTCCTCCAGGGCTGCCTCAATGGGTCCACCCTGCAACCATGGCTCTGATCTTGCAGC
TTCCTTGTTTCAATTTTCTTGTGATTGCCCTGTTCAGGCTTTCCACTTCCTTCTCATTCA
GCTTTGGGGGATTTCATTACTCTAAGTATCTGTCCATTTTCTTTTAAGTTCTCCAATTTA
AGAGCATAAAGTTGTTCACAGTAACCTCTCATTATGTTTTGAATTTCTGAAGGATCTGTT
ATAGTTTCTCCCCTTCATGTCTGATCTATTAGAACTCTTTCTCTTTATTCTTTTCCTCAT
AAGTCTAGCTAAAGGTTTATATGTCTTGTTTATTGGTTTATATGTCTTGTTTATTCTTTC
AAAGAATGAACTCCTGGTTTCATTTGAATTTTTCAGTTGATTTCTTGGTTTTTGTATTGT
TGATTTCTGCTCTAGTTTTTATTATGTCCCTCCTTCTACTTCTTTACTTCTTTGTTATTT
GCTTTTTCTTCTCCATGTTTTTTACGTGTGTGTTTAGGTTGCTGATTTGGGCTTTTCTTT
CTTTATGAAGGCCTTTTGCTTTGTTTTCCCCCTTACTACAGATTTTGCTCTAACCCATAG
ATTCTGATAGCTTATAACTTTTATTCTCATGAGTTTCAGACAGTCATTTTATTTAATTTT
TTTTATTAAATCATCATTAGATACAGCTTTCATGTTTGAGTTTCAGTCATAATATGATCA
AACACCCATTCCTCCACCAGTGTACATTTTCTGCAATCAGTGTTCCCAGTTCCCCAATAT
CCCCCTACCCCTGACTCCTTCCATCTCACCCTCCTTCTGCCTCTATGGCAGACAATTTCC
CCCATACTCTCTCTCTATTTTTGAGTTGAGCATTATGGTTTGCAAAACAGATACTTAGAG
GCTATCATGTTTGGTCCTTTATCTGTTTTCAGCACACATCTCCATCCCAAGCGATCCCTC
CAAGCATTATTGACTTAGTGATCCCTTCTCTGTTCCAGCTGCCTTCTCACCCAGCTCATG
AGGCAGGTTACCAACCATGGAGCAATATTCCTGGCCCTGTTTCTACTGTCCTTGGGTGTC
AGTCTCATGTCATTTTTATATTCCACAAATGAGTGCAGTCATTATATGTCTTTCCCTCTC
TTTCTGACTCATTTCATTTAGCGTGATACTCTCCATGTTCATCCACTTGCAAGCATATTT
CATGACTTCATCTTTCCTAACAGCTATATAATATTCCATTGTATAGATGTACCAAAGTTT
CTTTAACCAATTGTCTGTTCTCAGGCACTTGGGTTATTTCTAGATTCTGGCTATTGTGAA
CAGTGCTGCAGTGAACACACAGGTTCAGATGTCATTTCTACTGTGCTTCTTTATTTTATT
TTTATTTTTTTGGCTTTTGGGTTCACATCCAGCTATGCTCAGGGGTTAGTCCTGGCTCTG
TACTCAGAAATTACTCCTGGCGGTGCTTGGGAGACCATATGGGATGTCGGGGATTGAACT
TGGGTTGGGCGCGTGCAAGGCAAACGCCCTACCCACTGTACTATTGCTCCAGCCCCTCTA
CTGTGTGTTTTTGCAGCCTCGGGATATATTCCCAGAAGAGGCATTGCTGCGTTGTTATGG
AAGATCAATTTCTAGTTTTTTGAGGAATGCCCATATTGTTTTCCAGAAAACCTAGAGCAG
TCGGCATACCCACCAATAATGAATTATAGTCCCTTTCTCCCCACATCTGTGCCAGCACTG
TTTGTTCTTGTTCTTTTTGATATGTGCCAGTCTTTGTNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNTTTTTTTTTTTTATAATATATATATGTGAATGCTATTCG
GTCTGATATAAAGTTTGTCTGTTCCAAGGTTTTTTTTTTGTCAGCCCATTGACTTGTATG
ATTGTTTTCCATCCCTTTCACCGTGAATCTGTTTATCTATCCTATGAATTTAGATATATT
TACTGTAGGCAGCAAATAGATGGATTTTCTTTTCTTTTTTTTCTTTTGCTTCCTGGGTCA
TACCCGGTGATGCTCAGGAATTACTCCTGGCAGTGCTCAGGGGACCATATATGATGCTGG
GAATCGAACTGGGTCAGCTGTGTGCAAGGCAAACACCCTACCTGCTGTGCTATCACTCCA
GTCCCCATAGATGGATTTTCTTTCCTGATCCATCCAACAACTCTATGCGTTTTTGGGTTT
TTACTAAAGGATGAGCTATGGTTCTTCCCTGGTCCACAGGACTTGGAAGAGCAGATCAGC
GATGGGGTGAGAGGAGGTCAAAGACTCCATGTATTCTTAATTTAAATATTTATACCTCCT
TCCACTTATGAGTTCTGATCCACTTATTGGGTCCTGATCTTTGCTTATCTTTGTATCTTT
GGTAAACTAGGAAACCACTGCAAATGAGATAGTTGTAAAATGCTGAACATTGCAAAATAA
TATTTTGTGGTTGCTATTATAGTGATTATTATAGATCAGACTGGGGAACTAACTTGCTTC
CTCCGTTCCTTCCTTCCTCTTTTCCTCCCTCCCTGAACCTCAAAGGCGAGCACTCTAGTA
TTGACATATTCCTGGCCTTCAGACTTAAGTAAGAATATAATTTTTGCAAAAGATAAGGTG
AAGTTGGACTAAAAGCATTGCGTTTTGAAAGTGAATATCTTTTTTCTGGTGCATTGAACT
TCTTAAAATTAAATTCTAGGAATTACCTCAAGAATCCAACATGGAGTTAAATAATACATC
ACAGCAAGATGCTTTGGAACGGCTGGCTAATTCAGAGAAGATGGTGGTAGAGCTCAAAGA
ATTGCTAAGAGAGAAGGATATTCAACTGCAACAGAAGGATGAAGCTCTTCAGGTACCATG
GTTATTTTTTCTTCTGAGCATTTGATAAATGACTTATTCACTTGTATCACATGTCATCCC
GTTGTTCGTCGATTTGTTCGAGTGGGTGCCAGTAACATCTCTATTTGTCCCTGTTTCGTG
CTAGTGTAGCCTAATGGCAATCTGCTCGCTCCAGGAACACTAAGAGCCTCAAACCATTCA
ATCAGGGTCTTGACAAAGAAGTCTGACTGTCTCATAGGTGGGTGGCCACGTAGTCTTTTG
ATGTCCCGTGGAATCCAGTCGCTAACAGCTCTAGTCCAGCGTTTAGAGATGAATTATTTA
TTAGATTTAACAGATTTCATAAATGAGACAGTCACAGTTTTTTTTCTTTATTTTCATGAT
TAAAGACTGATTATTATTTCTCCAGTTCTGCAAGGTAATGCTTTTTGAGAATAGCTTTTG
TTTTGTGCTCAATAAGTGAGGAGTAAACATATTTGTATTTTCTCTCATTGTTCTCTGACA
GGAAGAAAGAAAATCTGCTGATAACAAAATAAAAAAACTAAAACTTCATGCTAAGGCCAA
ATTAACTTCTTTGAACAAATGCATAGAAGAAATGAAGGCACAAGGAGGAACTGTTCTACC
TACAGAACCTCATTCAGAGGAGCAACTTCCCAAGGTATATTTATTTGGTATCATACGTGT
TTTCTGATGGTAAAAAGCCTCCCTATTTTGTGTATTTACTAGTCATAAACATTTATGAAA
CCAAAATAATACAGTACTAATGGCAGTCCTTTTTAACTGAGTTTGCAATCTATCTGGATT
ACTGGGCCTAAATACCACAGGAAAAATCAAATGCCAATTCAAAGCTTAGAAATGAAATGC
CAGTTTTGACCTAGGTTTTCAACTAACTCAAGAAACCAACAAATTAGACTACAAAATCAA
CACCCAAAAGTCCATGGCTTTCCTATATACAAATAATAAAAGAGAAGAAAGAGATATTAA
AACCACAATCCTGTTCACAATAGTGCCTCAGAAAAATCAAGTACCTTGAAATCAGCTTAA
CTACCTATACAAAGAAAATTATAAAACACTACTTCAAGAAATAAAAGAGGACACTAGGAA
ATGGAAACACACCCCTTGCTCATGGATGGGGAAGATTAACATTGTCAGAATGGCAATATT
CCCCAGAGCATTATACAGACTCATTGCAGTCCCTATAAAGATACCCATGACATTCTTCAA
AGAAATAGATAAAACACTCCTGAAATTCATATGGAACAATAAACACCCATAAATAGTTAA
AGCAATCCTTAGGAAAAAGAAGATGGGTAGCATCACCTTCCCCAACTTCAAGCTGTATAA
AACAGTAGTAATTAAAATAGCATGGTATTGAAATAGACACAGAGACCAATAAAATAGAGT
TGAATATTCTATCACAGGCTCTCAAATATATGATCATTTAATCTTTGATAAAGGAAGCAA
GAATTGTTGAAGTGGAACAAGGAAAGCCTATTCCACAAATGGTGCTGGGGAAAAACTAGA
CAGCTACTTGGAAAAAAAATGAACTCTGACCTCTAACACTAGGCACAAAAGTCAGATCAA
AGTGGGATTAAATATCTTCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNATGGTCCCTCAAGCTTCACCAGGAATGATCCCTGAATGCAGACGTTG
GGAGCAAGCCTTGAGCACTGCCAGGGGACCTCTCTACCCTCAATAGATTAGTCCCACACC
TAATTATGAAGTGATCGTCTGCTTCTTCAGAGTTTACTGATTAATATTACCTTACCCAAA
AAAAATGCTTTTACAGAAACATCAGGATTTATGTGTGACCAAATATCTGAGAAAGAACAT
TCTAGCCAAAATAACACATAAAATTAACCACCTTACTTGTTAAATATGTTTTCATGCAGT
TATTAATGCTTTCCACAAAATTTTGTTAAGGGAACTACATTTTGAAATTTATGGCATTAT
ATCAATACTAATAGAGTGAAAAATGAACCTTGTTGGATAAGGGGGTGCTTACTTTTAAGA
TGCTTGGCAGTAGAATCTAGCATAAACTTAATAGAGGAGGACAAATAAGAAATAAGGAAG
TCTGTTAAGAAAAAGAGAAACATAACCAGAAGTGGTTATAAGAATCAATGGGTAAGAAAA
AAATATGCAAAAACTGTAAAAGAAGGATTATTAAGATAATATTCCTTGCTTGGGAAAAGA
GGAAAAATAGAAAAAGTTTGTAGACATAATGTTATAAACTTGCTTCTTTGACTAAAAATG
TTTTAGTTCTTAGAAAATAAGCTTAGTTAAAAGAAAGTGAGGGTTGCTTGTCTTATACAG
ACAAAAAGTAGAATAAAGTTGTTCTTATTAATGAGCTTTCCCTCTGCTAATATGTGACTA
GTTTTAGTTTGTATAAATTTGAGTATGAGCACTACAGAGAGCAAAATACTTTAAGTGAAT
AAAAGTTTAGGAACAATGAGAATTAACTTTACATAATAATGTTAAATACAATCAAGTTTT
TCTTAGTAACTAATAAAATGGCTAATACTTATTAGCTAGCTAATACCAATTTCTAGCTAA
TAAAATGTAGCACTGTAGCACTGTCCTCCTGTTGTTCATTGATTTGCTCGAGCGGGCACT
AGTAACGTCTCCATTATGAGACTTGTTGTTACTGTTTTTGGCATATCCAATATGCCACGG
GTAGCTTGCCAGGCTCTCCCGTGCAGGCGGGATACTCTAGGTAGCTTGCCGAGCTCTCCG
AGAGGGATGGAGGAATAGAACCGGGGTCGGTCACGTGTAAGGCAAACGCCCTACCTGCTG
TGCTACTGCTCCATTCATAGCTAATAAAATAGCTGAAATAAATGTGAATTCAGGCAGTTA
GATTATAAAACTTTTACTCTTGGTGACTGTGTTATTTGTACCATTTCCCTCTACTTATTA
AATGGAATTTTCTTTTTATTATGTGATCCCGGTAATTTTTTAATCTCTTTGTTGGGTAAT
CTGCTTGTCTGTTGTTTATGGTTATCCTGTGTGATATTTTTTATACCAATGTATAGTTTA
GGAAAAAGGATCTTACACTTTAATTCCTTAGTATGGAAATATCATGAAACAAAAATTTCA
TTAATTTTCTGATTCCTCTTTATATTTAAGCAATTTTTGAAAGACAAGAGTTTCAATCTG
AAGAAAAATAGGTTCTGAAGTGATCAATATCAAGAAAATGAGTTCTAGGTTTCCTTACAT
GTTATGAATATAGCTTGGCCTCACTACAGATTGACAGTGTACCTTCAGTTAGATTTTCAA
GCTGATTTTAAAAGTACTTAGAAATTTTTGGTAGGAAGGAGTTTGGATGGAAATGTTTTA
GATACTAAAATAATACCACCTTTTAGTGGCTAGTTTTGGTAACATAATTACAACTTTTTT
TTTTTTTAATAGATCAGCATGGTTGATAGTAGCAAGCTTGCCAAAGGAAGCTTTTCTATG
GTGGAAAGTGGACAAGATATATTTGAAAACACATTTTCTCAGAAACATAAGGAACTATCA
GTTTTATTGTTGGAAATGAAAGAAGCTCAAGAAGAGATTGCATTTCTTAAATTGCAGCTC
CAGGGCAAAAGACCTGAGGGTGACCCTGAGGTCCTTAACCAGAAAGAGGTGAAACAGACT
GAGAATGAAGGAATATTGCTTGAAGATACAAGGCATCATTTTCCCCCAATGCCATATGCT
GAGAGCAGTCTCCAGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNACAGTTTGATATGCAAAGCAGGAAAATGAGAATATAGGACGCCAGCTAAGCCA
CTCCAGATTCAAGTAAAAGAGTTTACAGACAGAAAAGCCTTAGACACTGAACAACAGGAG
CCAGGATCTCCCACTCAAGAGTTAGAACCTTTATTCAAAGCCTCAGAGCAGCAGCTTGCC
CAGCCAGAGTCCAGTTTATGCCCAGATGGGCCTTCTCATCCAGGAGGTGCAAATACCCTG
GAGGGTAGTAATCTTATTGCCCAAATTAAGACACAACTCAAAGAACTAGAGACTAAAAAA
GAAGAGCTGGAATTGAAACTTAATTCTACAACTCAAGAACTTACAAAAAAATCAGAGGAG
GTATTTCAGTTACAAGATCAATTAAATAATCAATGTTTAGAAATACAGAGCATGAAGATA
GCAGCCCATGAAGCTGAGGCTCAGGCTAAAAGCCTGAGGCAGAGATTGGAAAGCTGCCAA
CTAGAAATTACTGAATTAGCACATTTAAGAGAATTACAGCCTGAGCTCAATGAACTGAAA
AAGCTCATAGACCAAAAGGAAAAAGAAGCTATATGCCTTTCTGAGGAACTTAGTGAGAAA
AAAGCAGCTCTTACTCAAATGCAGTCAGAGATAACAGAACAAGAGGATTTAATTAAGGCT
CTTCATACCCAATTGGAAATGCAAGCTAAGGAGCATGATGAGAAGATTAAGCAGTTACAG
GTGGAACTTTGTGAAATGAAGCAAAAAACAGATGAGGTTGGAGAAGGAAGCAAACCAAAC
CAACAGATACAAAGAAAACTACAAGCTGCTCTTATTTCCAGAAAAGAAGCACTGAAAGAA
AACAAAAATCTCCAAGAGGAGTTGTCTTTGGCTCGAGATACCATTGAAAGTCTGACCAGG
TCTCTGGCAGAGTGCGGAAATCCAGGTCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNCAAAATCTGTTCAGTGTAAATAAGACCTTAGCACAGCGGTTGGGCTTTCGC
CTTTCACGCGGCCGACCCGTGTTCGATTCCTCCGTCCCTCTCGGAGAGCCCGGCAAGCTA
CCAAGAGTATCGAGCCCGCACGGCAGAGCCTGGCAAGCTACCCGTGCGTATTGGATATGC
CAAAAACAGTAACAATAAGTCTCTCAATGAGAGACGTTACTGGTGCCCGCTCGAACAAAT
CGATAAGCAACGGGATGACAGTGATGACAGTGAGAAAAATTAGTGCTTAAAGATTTGGAT
TTGTCTTCACTGACTTTTATTAGAACAGTTTTGTTTTCTTAGTGGCAATGTGGTTTCCTG
AATTCCATCCTCTGGTTTTACAAGGCAGTTTTTGAGTTTTTTTTAATTTATTTTTTATTT
ATAGTTGGAAATAAGTTTCAGCCTTACATGGCTTTAACTGGTTTTGGCCTTAGACTGAAG
GACATAAAAGTAGGACACTTAACGTCAGTTTACTCTAACTGTATCATCTTGGTTTGTGTT
GCTTACCAGCATTTTCAGATAGCTGTTTTCCTATCTTTTACAACGTTTAGCTGCTGAGGC
AGAATGGGTCTAATGGGAGACACCTGATCATGCTGAAATTGAAAAACTAAAATTTCATCC
TTTTTTTTACATCAGTTTTCTATCAGTTTTTATCAGTTTGGTAAAACTAATCAAATACTT
GTATTGCTCAAGCTAGAGCAAAAGGTATAGAAAATGTTTAAATATAGTTCTTTACACCTT
TCTCTTATCCTTGGGAGGATAGAGCTTTTTAGCTTTTTGTTTGTTTGGGGGCCACACCCA
ACAGTGCTCAGTGCTTACTCATGACTGTGCTCAGGGAATCACTCCTGCTGGGGCATTGGG
GACTATGTGGGATGCTGGGGAGTGAATCGGGGTCAGCCACATTCAAGACAAGTACCATAC
CTGCTGTAATATCTCTTCTGCCCCAGCTGTAGTGCTTTTTTTTTTTTTTTTTTTTGTTTT
TGGGTCACACCTGGCGATGCACGGGGGTTACTCCTGGCTCTGAACTCAGGAATCACCCCT
GGCGGTGCTCAGGGGACCATATGGGATGCTGGGAATCGAACCTGGGTCGGCCGCGTGCAA
GGCAAATGCCCTACCCGCTGTGCTATTGCTCCAGCCCCTGTAGTGCATTTTTAATTAAAA
ATTTTTTCTTTAAAGAACTGTGATTTACAAAGTTATTGATAGTTGAACTTTAGGCATATT
TCAGCACCAGTCCCACTCAACTATAGTTCTTTTAAATAGATGACTTTGTCTCCTCCAATT
TTTCAGCTTGACAAGAGTTCTACCGAAGAGATGGAAGTAGAAAAAATAAAACATAAACTC
CAGGAGAAGGAGGAACTCATTAGCTGCTTGCAAGACCAACTTGCGCAGGCTCTCTCTCCC
CAGCAACACAGGTAGGGTATAAGTTACCTCAAAATAATCAAGTTAACANNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACATT
AGTACACTAGCCCCACCATCAAGATCCAAAGGCCCTTTGACCCTTGATCACTGTGTATAT
GTCACAGCCTGCCTTGTCCTTTCTCCTCCTTCCCCACTATGTGATTATTATAATCCATCA
ATATTGTTAATTCCCTTCTTTTGTTTCTTGATATACTACAGATGCATTAGATCATCTGGT
ATTTTTCCTACCTCTGACTTATTTCACTTAACATTTCCAGTTTCATCCTAGTTGCAATGA
ACTGCAAGATTTATCTTTTTCTTTTTTTTTAAATTGATTGAGATTCTGTGACGTACAAGA
CTGTTAATGATTGTTTCTTATGCACATAATTCCTGCACCACACCCATCCCCAGTGTACCC
ATACCCACCTCTCTCCTCCAAAGATCCAACAGCCTTCCTTTTCATCTCTCACCCCTAACA
CCACCAATTCAGTTTTGTGGATCAGTTCTTCCATTGTGTTGTCTTTGGCCCTTTGTTGCT
CTTTTGCTATGTGTGATATCATCTCTTCTTTTAACTGTGTAATAGTCCGCTGTGTTTGTA
TACCACAACTTTTTAATTTATTTATCATGGGACATTTGGGTTCTTTCATATCCTGTCTAT
AGTACTTCAGTGCTACCATGAACATAAGTGTGCATATATCTTCCAAGTGTTTTTGTATTC
CTGGTGCAGATGATGCAAAGTGGAATTGTTCAGTCATGGAAACTCTATTCTTACATTTTT
GAGAAGTTTCCATACTGTTTTCCACAAGGCTGAACTCAAGGACATTCATTCCGCACCAGC
AGTGACAGGTCTCATTTTCAACACATTCCTGTCAATGCTGGTTGATTTCAGTCTTTTTGT
TATGTCTGACTAGTGTGCGATGATACCTCATAATACCTGTGAAGACACACAGCTACCATC
TGTATGTCTTCAGAGAAGTGTCTGTTCATCTTGAGTGCTTCTTTTTTCTTTACTAAAAGC
TTTAAAATTGTGTATCTTCAGTTTAATAAGAGTTCCACAGAAGTGGAAGAACTTGTAATG
ATGAAACAGCAGCTCCAAGAGAAGGAAGAACTCATTGGCACTTTGCAAGCCCAGCTCAGC
CAAACGCAGGCTGAACAAGCTGCTCAGGTAGGATGGGGTACTTCATAATCAGTAAGATAA
AGAATTATTATATATTTAATAATAAAAATTTTCAAGATAAAGAATCAAGAACATCTAGTG
TAGAGATTTCCAAACTTACTTGACATACCACCACCTCCTCTCTCCCTTCCTCACTTCTCT
CCCTCCCTTCCTCACTTCCTTTCTTTTTCTTTCCCTTGCAGTCTTCAGGGCTTACCTCTG
ACTCTGTGTTCAGAGATGACTCCTGGCAGGTTTGGGGGACCATATAGGGTGCTGGTGATG
GAACCCAGGTTGGCTGCATGCAAGACAAGTGCAGTACCTGCTGTACTATTTCTCCAGTCC
AGGAATTCTTTCTTTAAATGAACAAAGAGAAAATTGCACTGTCCACACCAGCTGCATCAG
AGGCTAAAATACTGGTCTAGTGAATTATTGCATGACTAGTCGATTCAGTCAATTCTGCTT
TTTAGACTTTGACAGAGTAGAAGAAAGTATAGGCATAAGAGGCTTACGATAGAAATCAGA
AGAGCTGGTAGTAGAAGAAATGTGGAAGTGCTATTTACCTTGATAAATTATCTAATTGCT
AGTTGATTTTTACTTCCACAGGTTCAGATTTTTAGTATGACATAGAGGTTTATCTTTAAT
AGATAAATTAAAGATAGTAATATCTTAGGAGTAACCTCGCATACTAAGTAGGTAGTATCT
TAGGAATAACCTCTTGTACTAAGTTTAAAGGTCGGTAGATAAACCAAATACAATGACAAG
GTCCATTTCCCTATGTAAAATCTTAATGGAAAGTTAAGTTATAATCAGAAGATTACTTAA
TAAGTAATTATTTTTAATTATGTATTATTAGTTACAAGTAATTATTTAATAAAAAGCAAT
TAAGATTACTTGTTTATTACATGTAAGTGTAAGTAACGTAATTACTTAGTAAGTAATGGA
AAGGTTATGTGATTCAGTGTTAAATGGCACTGACATTCTTTTAAATATTTCTGCTCTCAG
TATGTGACTTTAGACTGACATTCTCAAGTCTAATTTCCTGTTTTCAGGTGGATCATATTT
GTTTATCCTTTGAGAATGATTTTTTAAAGTAATACGGGTTCCCACTCTATAGTTCTGGGG
TCATCATGGCCTCATCTCTGGTTCTGAGGGAGCCATGCATTGCTGGGGGTTGCATTCAGG
CTCTCAAACATGCTTGCCTTGTGCTCTACTGCTTGAGCTATTGTTCCCGGTTCAGAGAAT
GCTTTTCACTCATGAAAGAACCTTTTTCTGCAGAGTTATTTGCACAGTAGCTAATTCTAT
TTCTTGGGGACTTACTTGACTGATAATATAATAAAATATTAGTGGTGCCTTATGAGCATA
TATTCTTCTGTGCATGTAGTAGAAGTTGTGTATACTGAAATTTCTTTTACCTATGTTAGC
TTTTCTTCTGTCCTTTTATATAGTACAAGTGTATTTTCTCGCTGATAAAGGACTCTAGTG
TTTATACACTTTAGTATAAGATTCTGAATTCATAGTGATGTTCAGAATTTATATAATTAA
AAAATTTATAAGCTTTATTTTTTAAATCTATCTCCAAAGAAAGCCAGAGTCAGTTTTAGC
ACTAATAAAAGGCAGGATAGAGAAGAATAGGCTGTCATTTATTTTTTTATCAATAAGTAG
CTTCAAACGTGGAAAACTAAGATTTATGAATTTTTTTACATTCTATCAAAATGCAAGTCA
GTTGGAGTAAGTGCATAATACATGGCCACACAAATTATTTTGAGAGATGAGAGGTTATTA
TTCTCATAGTGACAACCGAGGAAGGTCATATTAGGAAACAACCTCAGAAAAGTTAGGATT
TAGTCACATACTTAATGAATAAATAATATTCCAGATAACTTGGAGAAAGTATTCTATTTG
TGGGGTATGTGCAAAATTCTCAGAGAGAAAAAAGAGAATATAGTACATTAAAGGGAAAGA
ATATATCATTTATAGGGTTTTCTGGCTAATAAAGGACTCCAGTGTCTAGATACTTTAGCA
TAAGATTCCGAATTCATAGTGATGTTCAGAATTTATATAATTAAAGAATTTATAAAGTTT
ATTTTTTAAATCTATCTACAAAGAAAGCCAGAGTCAATTCTAGATACGAAAAGTCAGCCA
TGGTTGAAAGACCAATTTCAAATGGGAAAGTTAAGAACTTTTGTTAAGAACTTTTGTTTA
GCTTAATCACAGATCTTAAATAAATGAATAAGAAAGTATACAGACTCAATATTTAAAATA
AAATGAGGTATTGTACTGAGTAGTTTACGGTTTGTTNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNACAGGATGACAGTGACAGTAACAGTGACATTCTGTTAGCTATGA
AAAATTTTTTTTAAATCAAGATGTAAATTTATATCAACTCTTGAATTAGATAATAGGGAT
TCTTTCACATTTGAAAAAAACTGTGAGCCTGTCTTTTATCCAACATTCTCATCTTTGAAA
TTTAAAACTTACAAAATAGCTATTTTCTGTCAAGTTCTCAGTTTCTGTCTTTGGAAAAGA
GTTGGAGTTTTGTTATACAATATTCTATATTCAAGGAGTGTAACTTGTTTAGTTTCTCTG
GTGTGTCTTCAGTTGAGTTCCATGCAGCAGGTGGTTCGAGAGAAAGATGCCCGCTTTGAA
ACACAAGTTCGTCTTCATGAAGATGAGCTTCTTCAGTTAGTAACCCAGGCAGATGTGGAA
GCAGAGATGCAACAGGTGTGTTGCTAATACTTAGTAGAATGGCTTTCACTAACATTTTAT
CATCATAGCCACTTTCCAGGCCTCATCCACAGCTCTTCACTTGGTGTTGGTATGTTCCTT
AGTTGGCTTCTTTTTTGTGTTTCATTTCTGGCATGTTGTTTTTTTCACATCCTTACTTGC
CTCTAATCATGGTGATGGTATTCAAAAGCTGAGTTTAATTCGCAGTTGTATGTGGTAGTC
AGAAATTGATTTCTTTTCTGTTTGCTGGTAGTAGCTGTCTTTGTATATTAAAAACTCAAG
CCAAAGCTTCAAATCAGTGAAGTCATTTTTAAACTTAAAAAATTAAACATGAGATGATTT
GGAAGTCATAAAATCTTATTAAATCTTTAAACATTCGTTAAGTGTAAAAATTCACTTCAT
TTTCTTAAAGTTTATCATCTAACTGAAAGGCATTTGTTTTTAGTTGTGTGTATTTAGTGT
AGTGTGTAGAATCCATAGGGATTCTAGTGATATTTCATGGTTGATGCATTTAATTGTCTG
AATGAAAGCTTCTAGTTTCTAAGCAGTCCTTCAGAATGTGCCACTACAGTTTCAGAATCA
TATTTTGAATGTATCATTGATTTGTTTATTCAACAAATGCTTACTTGAATGCATGTGCTG
TATGTGAAGCTATAAGAAAAATAGGTCTTCCCTGTAGAGTCCTTAACCATTCTCCTTAAT
GAATGAAAACTACAAAGTGAGTATGTGTCATTTCCTCTTAATTATTAAGAACTCTCTCTA
ATTCAGACACCTGCTTGTGTCTCTGTCTGGTTTTGGCCGTGTTCTGGAAGAGATTTTTTT
GTATATTATTTGTTGCTGCTGGATGGGGGAGCATGTTATACTGGTGTTCCACTCTAGAAT
CTGTCATCTTCAATATCACAAAATCTTAAGTACACAGATCTTCATGACATTTGGTAAGGT
AAGCAGGTAAAGATGCTCTTTTTGATTAGGACATTAAGTTTAACATATTTTCTTCACAGA
AATTGAGGGTGCTGCAGAGAAAGCTTGAAGAACATGAAGAAGCCTTGTTGGGCCGTGCTC
AGGTTGTGGACTTACTGCAGCAGGAGTTGACTACTGCTGAACAGCGAAACCAGGTATTGC
TTCTGATTGTTACTGCCTCTCTTTTGTGGTATTCATTTCCATGAGAGTTTGCTAAGCAGC
CGCTAGAAAAATCCTATCATTACCCTTTAGAGAATTGATGCTGGACTAGAGAGATAGTAC
AGCAGGTAGGACACTTGCCATACACACGGCTGATCCAGGTTTGATCCTGGACACCCCGTG
TGTTCTTCCGAGCTTGCCAGGAGTGATCATTGAGTGAAGAACCATGACTAAGCCCTGCGT
ACTGCATATGGCTTTTTCATTTATGACATGATACCTTGTCTCTTTTCCATAGGTTCTTTC
TGAGCAGTTACAGCAAATGGAAGCTGAACATAATACTTTAAGGAATAGTGTGGAATCAGA
AAGACAGGAGTCCAAGATTCTGATGGAAAAGATGGAACTTGAAGTGGCAGAAAAAAAATT
ATCCTTGCATAACCTGCAGGAAGAAATGCATCATCTTCTGGAACAGCTTGAGCAAGCTGG
TCAAGCACGGGCTGAACTACAGTCCCAGTACAATGATTTAGAGATAAAGCACAAAGAGGA
ATTACAAGAGAAGACTTCCCACATTTTGAGTCTTCAAAAGACTGAGCAAGAACGCGCACT
CTGCGTATGATGCTCTAAAAATGAAAACTCAAATNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNCGAAGCTGGCTTAGTTGGCATCTGAGGCGCTCCTCCTTTAACTTGT
AGGAATATGTCCATGATATCTTTTGCTTAAGTTCGTAGACTCAATAGAAGGAGTAAGAAA
GGGTCTCCCTTTCTCTTTTGTCGTTTCTTCCATCTCTGAAGTTATAATCTGGTTTAATAT
AGTTCACATGCTATCAAAACCTATACATAGTGATGTCCCAAATTATAAACAGCAATGCTT
TGTGAACCGTTGTGGCAGTCTGAAGGGGTTGGTGACTGATCGGAATAAAATTCAAATCAA
GAAAGAATAATTTGAAGATTCATCAGTATTAAATAACTGAACCTTAACCAGGAAGCCTTG
AGGAGAAAGTTTATGAGGACAGCATGTTAAATAAGCATGCATTCCTCTTAACTGCAGCAT
GTTCTGATTTAAAACTCATTAATTCGGTCATAAATCTTTCAGACACATTCTACTGAGTCT
AGGTGGGATTTGCAATGTGTAAATGAAGAGGGATGAAAAGAAAATAAAACAGACAAAAGC
TTTTTAGAGGGAAAGTAAAAATGATTCAAAAAATATACTAACGGAAGTATTTTACTTTGA
AATTTCTCTTTTGATATCTGAGAGCATTTAAAAATTTTAAATATTGTTGGCATTTTAATT
TGAATTAAGATAATTGAACTACAGTGTAGCATATAGTGTGTTCTAGAAGAGAATGACTGT
GCTTAAGGCTAGAATCTAGAACCAGGACAGAGTGATAGCATAGCGGGTAAGGCCTTTGCC
TTGCACGCGGTCAACCTGGGTTCAATTCCTCTTTCCCTCTCGAAGAGCCCGACAAGCTGC
CCATGGCATATTAGATATGCCAAAAACAGTAACAAGTCTCACAATGGAGACGTTACTGGT
GCCCGCTTAAGCAATCGATGAACAATGGGATGACAGTGCTACAGTGCAGGGCTAGAACCA
GAGATCATTTCTATTTATTTTATTTTCCTCAGAGCAACTCCAGCAAAAGTCTGAAGAAAT
TAGCCAGTTACTGAATAAACCAACCTTGCAAAAGTATGAAATAGCTTCTCAGACTTCTTC
CCCAGATATTTGCAGTGAGAGCACACAGGTAATTAAATGTATGCTTTGCGGGCTGGGGGA
TTGTGGAACATGGGGAAACGGGACACACCTGACTGTTCCCAGAACTTTCTCCTGGTTCTG
TGCTCTGGCATCGCTCTTGGCAGTGCTCAGGGGGATCATAGGTAGTGCTAAGGATTGGAA
CTTGGGCAAGGCAAGCTTTACTTGATGTACTCCTCCCTGGTCCAAAATGTGCATTTTTTA
ATGAACATGATCTATTCGTCTTTGCTGCATTTATTCTAATTTATTCATGTTTAATGAGAA
TTCATTTTGGAATTCTTAGTAAGCCATCTGTCTTTGCTGCCTGATAGATTATTTTTGACA
ATAAATAATGATAAAGTAATAGTAATAAGCACTATGATCTTGGTTTTCTTGATCTAAGAT
CTTAGATATTCATTTTGGAGTTGTCATTATTTTTCAACTCATGATCAATTTTCTCTGTTT
AGAAGTCAGTTTTGGTTTTGGCAGATTAAAATTTGATCAGCTGTACACAACTTGGTTTAC
TTATTGTAAAAATTTATTATGGAAATTAGTGCCTCCATTGAATAATTTGAAATTAAAAAA
TTACCACTGGCTGGTGTTGATCAATGTAGTCACTGTTCTTTTGTAGTCAGCTCTGGAAAA
CTAAAATATAATTTCCAGAAGGCTACTTTTAGGCATGAATATCAGAGCTAGGAGAGTTAG
TTTCATGGTCCTAATTGACAAGTGTTAATCTGGGATTACTCGATTTATTCTTAATCATTT
ATTAGTTTATTAATGTCCTTCATGTAAGGAAGATGATTATAACCATTTTATTTATTTTTT
TTAATTTTATTTTTTTATTTTTTTTCTTTTTTTAAAAATTTTTAATTCTTTTATTGATTC
ACCATGTGGAAAGTTACAAAGCTTTCAGGTTTAAGTCTCAGTTATACAATGCTCAAACAC
CCATCCCTTCACCAGTGATGATTATAACCATTTTAAATGTTGAACATAACATACTTAACA
TTTAACAAATGTTAAATATGACATATATTGGCTAGCAATCCCTTGTTTTCATCAGTACTG
TGCACTGTTAAGAAATTGTTGCTTGGTTTCTAGCATCAATGTCTTCTAGTCTCCCATTTT
CAACATTTTCCTCCTTTATTTAATTAAGACATTCTTCCAAAANNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCACCCCTCTCAGAGG
AGCCTGGCAAGCTACCAAGAGTGTCTCGCCCCGCATGACAGAGCCTTGCAAGCTACCCAT
GGTATATCATATGTATATATCAATATGCCAAAAACAGTAGCAACAAGTCTCAAAATGGAG
ATGTTACTGGTGTCCGTTCGAGTAAATTGATGAACAACAGGATGACAGTGACAGTGAACT
TTTTCTTTATAAACAGTCACTGTCACTGTCATCCCGTTGCTCATCGATTTGTTCGAGCGG
GCACCAGTAACGTCTTTCATTGTGAGACTTGTTACTGTTTTTGGCATATCCAATACGCCA
CGGGTAGCTTGCCAGGCTCTGCCGTGCGGGCGCGATACTCTTGGTAGCTTGCTGGGCTCT
CCGAGAGGGGCAGAGAAAGTGAACACGGGACGGCCGTGTGAAAGGTGAACGCCCTTCCAC
TGTGCTATCGCTTCAATTCGTTTTTATAAATCATGAATGGTATAAATTACCATTACCTAT
CAAGACATATTACTATTGCCTCACATAAAAATCCTTATATCTTGGACTAGAGTGATAGTA
CAGCGGGTAGGCCATTTGCCTTGCACAAGGCCGACCCGGGTTTGATTCCCAGCATCTCAT
ATGGTTCCCTGAGCACCGCCAGGAGTAATTCCTGAGTGCATGTGCCAGGAATAACCCCTC
TGCATTGCCGGGTGTGACCCAAAAAGCAAAAAAAAAAAAAATCTTTATATCCTTTTGCAG
TCAATATATGTTCTCCTCCAAAGGAGTGTTTGTTTTCTCACTTTAGATTAATTTCACTTA
TTTTGCATTATATGTCACTGTCACTGTAATCCCATTGCTCTTTGATTTGCTCAAGCGGAC
ATCAGTAATGTCTCCATTGTGAGACTTGTTACTGTTTTTGGCATATCAAATACGCCACGA
GTAGCTTGCCAGGCTCTGCCGTGCGGGCAAGATACTCTTGGTAGCTAGCCGGGCTCTCTT
AAGAGGGATGGAGGAATCAAACCTGGGTTGGCTGCGTGCAAGACAAATGCCCTACCCACT
GTGCTATCGCTTCAGCCCATCATATAATTTTACCTCCATATATTTTTAATTTTCAAATAG
TGATCTTTATTAATTTTTTTAATTAATGAATCACCGTGAAGGTTCAGATACAGATTCCAT
AGTCTCGTGCTTGTCTCCAGTCATACACAGCTTGAGTACTCATCCTCCACCAGTGTTCGT
TCTCCACTGATGACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCCCACAAGTTGTAACATACTTCCTGTCA
TGGACCAGTCCTCCTGGTCATTGTTTCCACTGTCTTTATTAGTCTCATACTCTGTAAAAG
TACAGTATTTTATCCGCCAAGGTACTGCCACTCTTTTTAGACATTTGCATTATAGTAGAA
CATGGAATAGAGCTTGGGAGATTGGATTCTGATTCTGGTGCTCTGTGAAGTAGCTGTCAT
GTCACTTTCAACATTTGGTCCTTGAGAGATTGGGTAGCTTTCTTCCAGTGCTAAAAATTG
GATGTTTTATGAACATAATGAGAAAACATTGAAACTACTCTGAGAGTGAATGCAAGATGT
TTGTTATGAACATAGTGGGATGATGGATCTATTAAGGCAAATTTATTGCTTCAGAAGCCT
CATATATTAATCACAAAAAGAGTCGCTAATGTTGCATGCACTGGCATTCTTCTCTTTAAA
ACTTTGTGCTATTATGTTTTACTCAGGTTAATAGTTGTCACCTCATACCATTCATCTATT
TCTTCATCTTTTTTTGCCATTTCTTTATTTGACAAAATGAGCTTTTTATACCCCTCCTCC
CAGCTATTTTTTCTGGTTGGGTTTTTGGTTGTTTTTGTTTTGGGGCCAGGCTTAGTGGTG
CTCAGGGCTCATTCCGAGCTCTGTGCTTAGGGATCTCTTCTGGCAGGGGTCTGGGGACAA
CCGGATCAAACCTCAGCTGGCCATGTGCAAGGCAAGTGACCTACCTGTTGTGCTATCGTT
TTATGTTTTTTTTGTCTTGATTATTTAATGTATCTCAGTCACCTCCTATACCGTCTTATC
TCTATTTTATCACATATATCTCTTAAACATGTTTATTTCATGATTTTCAGAAAAACTGTC
TTCTCAAATTTCTTTCCTGGAGGCTCAGAATAAAGTTTCAGAGTCAAATAAAGAACTCAG
TGAGGTAAGTTATGTGTCTTTAAAATAATGAGAGTTGAACTAGATGAATCAAACTTAGAA
CATTTTCAGAAATTTTTTATGTTGACAGAATTGTCTTACATAACAAGTGAAATCAGTTAA
GATAGTAATAATCGTTATGCATCGTTGAATTCGTTTCTGAATACTTGGAAATGTTTTTGT
TTAATAGAACCAGTACAGGAACAGTAACTTCTTCAGGAAAGTTTCTCAATGAAGAGGTTA
GATAAAAATCTTTAATTCTTTATTACCAGTTGGTATGGTTTTACTTAGGATTATATAAAA
AAAAAGGGTATCTTTGGAAATGGTGTTTTGTATAGTCTGAAAAGTACTGTGTGTGGTTTT
CTGAATATTGTTTTAATTTCATTGTATTATATTTAATCCTTGTCCCTTTGTAACTCTGAC
CTGACCTCCTCTTTTTACTTCTACCCCCCATCTTGCCTATTCCTTGATATATTTGTTTCT
GTAATCTAGAGCCAGTGTATAAAATAAAGTTTTAATACCTGAGAGATTTTTTTTTGAAGA
AATTGGTCCACAATTGTAGATGCTGACTAATTCAAAATAGAAGGGTAGGCCAGCACTTTA
GAGCAGTAAACTGGAACAGCCGCACTCAAATTGGAAGGCAGTCTGCTGTTGGACTACCTT
GTTTTTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACCATTTCCCTCTACTTATTAAATGG
AATTTTCTTTTTATTATGTGATCCCGGTAATTTTTTAATCTCTTTGTTGGGTAATCTGCT
TGTCTGTTGTTTATGGTTATCCTGTGTGATATTTTTTATACCAATGTATAGTTTTGGAAA
AAGGATCTTACACTTTAATTCCTTAGTATGGAAATATCATGAAACAAAAATTTCATTAAT
TTTCTGATTTCCTCTTTATATTTAAGCAATTTTTGAAAGACAAGAGTTTCAATCTGAAGA
AAAATAGGTTCTGAAGTGATCAATATCAAGAAAATGAGTTCTAGGTTTCCTTACATGTTA
TGAATATAGCTTGGCCTCACTACAGATTGACAGTGTACCTTCAGTTAGATTTTCAAGCTG
ATTTTAAAAGTACTTAGAAATTTTTGGTAGGAAGGAGTTTGGACGGAAATGTTTTAGATA
CTAAAATAATACCACCTTTTAGTGGCTAGTTTTGGTAACATAATTACAACTTTTTTTTTT
TAATAGATCAGCATGGTTGATATTAGCAAGCTTGCCAAAGGAAGCTTTTCTATGGTGGAA
AGTGGACAAGATATATTTGAAAACACATTTTCTCAGAAACATAAGGAACTATCAGTTTTA
TTGTTGGAAATGAAAGAAGCTCAAGAAGAGATTGCATTTCTTAAATTGCAGCTCCAGGGC
AAAAGACCTGAGGGTGACCCTGAGGTCCTTAACCAGAAAGAGGTGAAACAGACTGAGAAT
GAAGGAATATTGCTTGAAGATACAAGGCATCATTTTCCCCCAATGCCATATGCTGAGAGC
AGTCTTCCAGAATCTGAAAAAGAAGAGCAGATAAGCACTAAACACCAAAGTAGAACATCT
GAAGAAATACCTTTAACTAATGCTGGAATGGAATTAAAATCAACAGAGCAGGATGAATTT
AATAAGCTTCCTTCAGATTTACCGAGTATTTGTCAGTGTCACCAGGATGAATTGGAAAGA
CTAAAAAATCAAATTTTGGAACTTGAGACAAGCTTTAGTAAGGCAGAAGAAATCTATGAG
AAAAACTTAGATGAGAAAGTAAAGGAGATAAGCAGCCTGTCCCAGCAGATTGGAGAGCTT
AAGGATAATGCTGAAAAGGCCAACAGTGCATTTACTGCTTTATCTGAAGAAAAAGACCAG
CTTCTTTCTCAAGTGAAGGAACTTAGTGTAATAGGAGAGCTAAGGGCTCAGGTACAAGAG
CTGGAAGTGAATCTTGCAAAATCAGAAAGTCAAAGAAGATTTGACTATGAAAGTCAAACA
GCTCATCACAACTTGCTTACTGAACAGATTCACAGTCTCAACATAGAAGCCAAATCCAAG
GATGTAAAAATTGGAGTTTTACAGAATGAACTAGATGATATGCACCTTCAGTTTACTGAG
CAGAGTTCACTAATTACAGACCTTCAGAGCCAGCTTCAAAAGAAGGAAAGCGAAGTACTT
GAAAGAGAAGAACATGTTAAGGATATCTCAAATAAGGTGGAAGAACTTTCACAGACCCTT
TCACAGAAGGAATTGGAAATAGTAAAGATGGATCAACTCTTACTAGAGAAGAAGAAAGAT
GTGGAAACTCTCCAACAAACCATTGAAGAGAAGAATCAACAAGTCACAGAAATTAGCTTT
AGTATGACTGAGAAAATGGTTCAGCTTAATGAAGAGAAGTTTTCTCTTGGGATTGAAATT
AAGACTCTAAAAGAACAGCTCAATTTATTATCTAGAGCTGAAGAAGCCAAAAAAGAGCAG
GTAGCAGAAGATAAAGAAGTTTTTCCTGACAAACAGAATAGTGAGGAGTTGAATTCAGAA
GGGCTAATCATAAGTAAAGAAGAACTACAGCAGGAATTAGAACTTGTAAAGAAAGAAAGT
GAGCAGAGAAAAAGAAAACTCCATGCAGCTCTTATTAATAGGAAGGAACTTCTACAGAGA
GTTAGCAGATTAGAAGAGGAGTTGGCCAAAGTGAAAGATGAACCTAGGAGTGAGATTTCA
ATCAGTGAGATTGAGAAAAGGGAGGTGGAGGGAGATAAAGAAAACAAAGAAGACTCAGAA
AAATGTATGGCTCCTAAGTGCCAAGAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATGCA
GAAGCACTGATGCAGAGAAACACAAAGACTACAAAGATATGAATCTTCTTCAGTCCTATG
AGAATGTAGTACGAGCAGAAGGATGCAGCATGTAGTGGAAAATGTGAGCAGAGAAGCAAG
AATTATATGCTAAGTTAAGAAACACAGAAGCAAGCAAGAAAGACACAGAAAAGCAGTTGC
AGGAAGCTGAACAGGAAATGGAGGAAATGAAAGAAAAGATGAGAAAGTTTGCTAAATCCA
AACAACAGAAAATTCTAGAATTGGAAGAAGAAAATGACCAGCTTAGAGCAGAAGTGGGCG
CAGGAGGTGGGACTTCTAAAGATTGTATGGAATCACTTCGAGTTTCCAATTCTTGCATGA
AGGAGGAACTAGAAAGGGTGAAAATGGAGTATGAAGCCCTTTCTATGGAGTTTAAGGCTT
TAATAACTGAGAAAGACTCTCTAAGTGAAGAGGTCCAAGATTTAAAGCATCAGATAGAAA
TGAATGTATCTAAATCTATTAATCTAGAGGCCACAGAGAAACATTATCAGATGGATATCA
TTGAAGAGACACAGTCTGCCCTGATTGAGACTGATGAGCAAGGCTCTCTGAGTGTGAGCA
CAAGACCTGAAACTTTAGGTTTTGTTCCACTAGAAAACAGTACCAAGCCCAATATTAGTG
AGAACATCAGCTCACATGAAATTAATAACTACCTGCAGCAGATTGACCAATTCAAAGAGA
GAATAGCTGAATTAGAGGAGGAAATACAGAAAGAAAAAGAATTTAGCCAGACTTTAGAAA
ATGAGAGAAACACTTTACTGAATCAGGTAGCAGCAAAGGAGGGTGACCTGAAAATGCTTC
AGGAAGAAGTCATCCAAATAAACCTGTTAAATCAGCAAGCCCAGGAAGAACTTGCCAGAG
TTACCAAGCTAAAGGAGATAGCAGAAGAAGAGAAAGATGATTTAGAAGAGAGGCTTATGA
ATCAGTTAGCAGAACTTAATGGTAGCATTGGTAATTATTACCAGGATGTTACAGATGCTC
AAATAAAAAATGAGCAACTAGAATCTGAAATGCTGAATCTAAAAAAGTGTGTGAGTGAAT
TGGAAGAAGAAAAACAGCAGCTAGTAAAGGAGAAAACTCAGGTGGAATCAGAAATTAGAA
AAGAATATTTAGAGAAAATACAAGGTGCTCAGAATGAGCCTGTCAGTAAAGGCCATGCAG
AGGAACTTCAGGAGTTGTTAAAAGAGAAACAACATGAAGTAAAGCAACTGCAAAAGGATT
GTATCCGGTACCAAGAGAAAATCAGTGCTCTGGAGAGAACTGTTAAGGCTCTAGAATTTG
TTCAAAGTGAGTCCCAGAAAGATTTGGAAATAACGAAGGGAAAACTGGCTCAGGCAAATG
AATGCTGCAAGAAGACAGAAACTGAGTTAGCTAGTTCAAGAGTACTATTAGATGACACTC
AGAGTGAAGCAGCAAGGGTCCTAGCAGATCACCTCAAATTAAAAAAGGAACTTCAGTCAA
TTAAAGATTCAGTTAAAAGTCAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACAGAGTAATGTTCTTTAAG
TTCCAGTTTTATAATACTTTTAAAAATGACAAACTGTCGTTGTTCCCCATATTTTATAGG
TGTCTATTTGTAGTAGAATTTGTATATTCTGAGACTATTGACTTCACTGTCCTTCAACCA
AGATTATTTCTTAAAGGAACATAACATTAACTTATCTGGAACAAAGTAAAGCAAAATTAA
AGAAAGCATTGCCCATAGTTGTGTCACAAGAATAAGCAGTGTTCTTTGGAGTTTACTATT
TAAATGTATAAATATTTAAATGAAATATGCATTAAAGTAGAGCATTTAGTAGCACTCCTA
AGACTTCATTGAAAAAATGTTGACCACTTTGAATTATATTCATATTTATATATTTTGTAC
GTCTGAATACATGTTGTTACTATAGGTATTAAATACTTTATCCTTGAGATCTTTAGTTAA
TGACCTCCTTTCAATGACTTTGTTTTTTTCCCCAGACTTGAACATGATGAGCAGACTTGG
GAGTCCAAGGCCCAGACAGAGGTCCAGCTGCAGCAGAGGGTCTGTGATACCCTACAGGAA
GAAAACAAAGAACTTTCCTCCCAGCTAGAGGAAATACAGCAGTTATATCACAAATCTCAG
AATGAACTAGCTAAGTGGGAATCAGAATTTAAGATTCTCAGCGACCACTCAACTGATTTA
AATAACTCTTTAGAAAAATGTAAGGAAGATAAAGAAAATTTGAAAGGAATCATAAAGCAA
CAAGAGGCTGATATTCAAAATTGTAAATTTAGTTATGAAAAGCTGGAGACTGATCTTCAG
GCCTCCAGAGAACTAACCAGTAAGCTGCATGAAGAAATTAACTTGAAAGAGCAGAAGATT
ATAAACCTGCTTTCCGCGAAGGAACAGGCAATCCAAGTAGCTATTGCTGAAGTAAATCAA
CAGCATGATAAAGAAATTAAAGAGTTGGCAAATCTTCTATCCCATGAGGAAGGGAATAGT
GTCGTAGATGAAGATAATGAAAAAACTGTTCACAAAACAAATCAGCTTATAGAAGCATTG
AAAGCCATAAAAAATGAAAACATGCAACAGAAGGCTCAGTTGAATTCCTTTGTTAAGTCC
ATGTCTTCTCTCCAGGATGACCGAGACCGCATTGTTGGTGACTACCAAAAGCTGGAAGAA
CGGCATCTCTCAGTAATTGTAGAAAAAGACGGGCTCATCCAGGATGCTGCTACTGAAAAT
AATAAACTTAAGGAAGAAATTAGATGTTTGAGAAGTCATATGGATGACCTCAATTCTGAG
AATGCCAAGCTAGATGCAGAATTAATCCAGTATAGAGAAGACCTAAACCAAGTGATAGTA
AGAAAGGACTGTCAGCAAAAACAACTCCTTGAAGCTCAACTTCAGCAGAATAAGGAGCTG
AAAAGCGAATATGCTAAAATAGAAGAAAAGCTAAAGGAATCTGAAGAAGCAAAGGAGGAC
CTGCTGGCATCCTCTCGTGCTCTCCAGGAGGAAAAACAAGGTTTATCTAAAGAGATCAAT
AACTTGCAATTATCTATATCCCAACTAAAAAGACAAGTGACAGCCTTGCAAGAAGAAGGT
GCTTTAGCAATACTTCAGGCCCAGTTAAACACAAAAGAAGAAGAAGTTCAAAGGTTAAGT
TCTACGCTTTACTCTCTCAGAAGAGAACTGCAGAANNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNTGATGGAAATGGAACAGAAGCTACTCATGGTCACCCAAAGGAAATAAGATCTTACAGC
ACAAATCCCAGTCTTTTGGAAATTCTATGAATTCCCTGCAAAATAGTAGGGATAATGCTA
AAGAGGAGCTTGATGAACTGAAAAAGAAATATGATGCCAGTTTAAAGGAGTTGGCACAGC
TGAGAGAAGAGCGGGGCTCCTTAAACAGAGAAAGAGATGTTCTTGTTTCTAAGGCGGCCT
TTCCAATGCATGCCACAGAGGACAGCACCTTCCCTCATCTTGAGAAACTCAACCAACAGC
TTCTGTCCAAAGATGAGCAACTACTTCACTTGTCCTCACAACTAGAAGATTCTTACAACC
AACTGCAGTCCTTCTCCAAGGCTATGGCCAGTCTACAGAATGAGAGGGACCACCTGTTGA
ATGAACTGGAGAAATTCCGGAAGTCTAAGGATGAAAAGCAGAGATCTGCAACTGAACCTA
CAACAAGCCCAGCTGAAGTACAGAGTTTAAAAAAAGCTATGTCATCTCTCCAAAATGACA
GAGACCGACTAGTGAGTGTCTATTTCTCTCTGATCTGCCTTTGAGAGTTTGGGAAATTTA
AAATTGATTTTTAGTTCTGTAGAAAAAGATAAATTCTTATACGCATCACCTGTGCACTGT
TATGTAATTGACAGGTTCTTTTGATCTTAGAGGAACACATACACTATTTATTTAAATTAT
TTTGTGTCTGCCATTACAAGTTTCCTTTATGCAAATTTCTCCTTTTTCTTTTCTTTATTA
AAATGAGTAATGGAAGGAGAGGCCAAGAAATAGTACAGAAATTAGACTGCATGTCTGTCA
TGCATCTGACCTTGGTTTCGATCCTTGGCACCACATGGTCCCCTAAACATTGCTGGAGTA
TCCCTGGAGGTCCCTTGAGCACCCTAAGGGCCTCTGAAGCAATGCCTGGGTGCATTGGTA
ATCCCTGGTACTGCAGAACCTGAGCAACACTGTACCCTTAGGCCCTTGATTGAGTCACTG
ACCCAATTAGCTGAGAATTGCCTATGGGCCCAGTGAGCACCACTTTGGAGTCACCCGCTC
ATCCCCCCACCAACCCCCAGCTCTTTCAAATAAAGACTAAGAGATGGGCTAGAGAGAGAG
AAAGTACAGGGTTAAGGTGTTTTCCTTAAGTGAAACTGACCCTGGTTTGGTCTCTGGTAC
CACATAGGGTTCCTGAGAACCATCATCCCTCCCCACCAAAAAATAAAAAGATAAATATTT
TATAACATAAGTATGTGTAAATATGTTCAGATTTTTTCATAGCTAAATTGAAAGAAAGTT
ATTATGATCTCTCACCACCACTTATAATGATAATTCAATAATACAGGTCATTAGGGGTAG
AAGGAATTCAGGTTTCTCATACTGATGTTTAATGCAACCCCACTTTGTAGGAAGGTTAGT
GTAAATAATTGGTAAAGTTTTAGTCTATCGTTTACTTTCTTTTCTTTCATTCATCAGAGA
GAAAGCTAAGGAAGGCTAATATAGTAATTGTCTTGCTTTTAGTAGGGTTTAGTAGTTTTA
TCAGTTTTTTGTTTTTTAATGTCTAGGTTAACAAAATTCATAAGTGAAAACTGGATTTAC
TTTAGCTAAGCCAAGTTGTCAGGAGATAATACTATATGTCATTACTATCTTGTTTGGAGA
TTGTTTTCATTTAAGACTTTGGATATATCCATTCTCTTTCAGCCTGTAGAGTTTCATTTG
AAAAATTTAATTGAGCATATTATTAGATTCCTGTGTTTGTAAATCTTTTCTCTGGCTGCT
TTTAGGGGTCTAGCTCTTTCTGTTGTGGGTTTATTTTATTTGAAACTCTTTGAAATTCCT
GAATCAGAGTATGTGTCTTCCTTCTCATAAGTGATAGAAATTGGGGCCAGAGCAGTAGTA
CCGTGGGTTCAGTGCTTACCTTGAACACTGTCAACTCAGGCTCAATCCCTGTAATCCACT
ATGATCTTCTGAACCCCACCAGGAGTGATTCCTGTGTGCAGAGCTGGGAGTAAGTTCTGA
GCACTGCTGAATGGGATTCAAATGAAAAAAATTTTTTTCAGAAATTCTTAGTTATCAGAT
TTTTCACCAAAATTTCCTTTTTTTCGTCTGGAACTCCTATGGTGTGAATGTTCTTCCTCA
TAATAATATCTCAGTAATCTTTGTTTTATTCATTAAAAAAATCTTTTTGGCTCTCTTTGT
TGGATTTTCTTCTTATCTTTGAAGTCACTGATTAGTTTTAACTTCTATTCTGCTGTGAGA
CTCACCATTATGTTTTTTTTTGTTGTTGTTGTTGTTGTTTTTTAACCCAGCTGCTATATT
CTTTTGTGTGTTCATTTCTGTCTGAAGCTTTATATACTTTCCTTCATACTGTCTCAAACT
TATTGAGGGTCTCTTCCATTGGTTTCTTCATTTATTGACCATAAATAGCATTGCTGCTCT
GAAGTCTTCATTGGAGGTAGAAATTTAGAACAGTCTGGTGTATTTGAAAACCTGTCTGAG
CTTTTGTCCCTATCTTCTTATGTGACTGAATTTCTCTATTTTTTCCTTATGCCTAGCTTT
ATGTGAGGGTAAGTGGTAGAGATCCAAATACAAGCTATCCTGAACTTTGATCAAGTACTT
ACGCTCTTGGATTTTAGTCAGTATCTGTGCCTCTGGGATTGTGCAAACTTGAATATCTGC
TGGGGATTTATGTTAAGGTGCTGCTGTTGCGAATTTATAGTTGTAAGCTGACTGCTTCCA
GGTCTCTGATTACTGTCAGCAGGCAATTCTACATTCCAGAGTTCACAGTGCTGGCGTCTG
ACACTGACTTTGGTGTTGCTACCCACAAGTTTGGGGAACAACTGGGGTACTTAATAGTAC
CTGTAATTGGTTAAATATGGGTTGTAGGGCCTGGATTTATTTTGCCTGGTGGAAGCAAAT
GTCTCTTAGTCCATTGCAGCTCTGCCCTGGACTTGGGATCGTAGAATTTGCTTTTGGGTT
GCTCTGAAAAAGTTCGGAATTTTCAGCCTATTTGGCTGCTGACAGTGGGGAATATCTTGC
TTATGTTAGGTATTGCCTCCAACTCAGGTTTTTTAAGAGTAGAGTTTTAAATCTGAGGGC
ACAGATGTTTGGCTCACCCTCCCCCTTTTTTTTTCCAGGCAGAGATGTGTTTTCACTTCT
CTCTGCTCCCCTCCCCTGTCCCTGGGGTCTTCACCCTTAGATGTCAAATTAACCACAGTT
CCTTGTCCCACACCGGTGAATGCTTGAGATGGTCATTAGTTTCTTCTGTGAATTCCCTCA
GCAGGGCCCACGTGGGATTCTGGATATAATTCAGTGTTTGTGTACTCTGTTTGGTGCTCA
GATTCTTCGCTTTTCAGTTAGCCTTCTTCAGTCATTTGTCCTTGTCTTTCTTCACAGCTT
TCTCTTTGACTGATATCCTACTCTTCAGTCTAGTCAGACCATCTTATTATGCAGTAATCT
TATCTGTTACTTCATACTCATTATAATTTTCTGCCAAAATGTTCTCTTAATTGTTTCCAT
TTTTATCATGTTAACCCCAGAGTTTATGTCTTCTGTTAAATTTCAGGATCACATGAATGT
CTATTTTCTTCTCTTTGTACCTCCCTAGCATTCATTTTGCCCATTTAGATACATGTGTGT
AGGTGTGTTACACATGCATCTGTGTATGGGTTCATGCATATGTGCATGTTTGTGTCTATG
TATGTTGATAGCCTCCATTGCTATTTTTAATGTTCTCAATAAAAGTGCTTTCATATGTGA
TATTATATTTCACTTGATATTTAGTAGAGTGGTAATTAAAAACATCAGTCATTGATGATC
ATACTTATTCTTTATTATTATGTGTTATAATAAATTTCATTTTCTAATATTCTCTCAAAT
ATTTGAATATAGTATTTTTTGCTCTGCTTATCTCTTCCAAGGTTTTTTTTACCTTATTTC
TTTTAATTGCTGTTTTAATATTAGCAATAAAATATTAGGTTTAATGAAATATTAATCTTC
GGGGGAAGGTTAATCTGTTAATCTTTGTTTTATTCTTCATCTCTGAGCGTAAGTCCTAAA
ATTTTTGTGAGAGATACCAACTCATAGTTGCAGGGTGGCCTGCAGGGTGGCCTGGATAAA
CATTTTGTGGATAAATCTTATATTGGTATCATAAGCCCTTAATGGTTGTCAAATTCTAAA
GAAGACTTCTCATTTCCTGCATGGAATTTCAAAAGCCTTTGTGCTAGCATCTTCAAATGG
AGTTGGGGAAATGTGCTTCAAGCAGTCAGAAGGCATACATTCACTTGATCACTTTTTTTT
TTCCATTTAGTTATTTATTTTATTGAATCACTATGTGGAAAGTTACAAAGCTTTCAGGCT
TAAGTCTCAGTTATACAATGCTCAAACACCCATCCCTTCCCCATTGCACATATTCCACCA
TCAAGAACTACAGTAAACCTTCCCCCAACTCCCTCAGCCCCCACCCCGCCTGTATAGCTG
ATAAATTTCACTTTACTTTCTTTTTACTTTGATTACATTCAATTTTTCAACAAAAAACTC
ACTATTACTTGATCACTTTTATATCAGAACAGTATCTTCAGCCTTGCCTGTGTCCAGTAG
CCCAAAGTCTTCGTCTTTTACCTTCCTCAGGGCATAAAACTCTGGTTATCAGTCAGTGTA
ATAAAAGTATAGGCGCTAGGATGATATCTAGGGATACAGTTGTTTTCTTCAACAGCTTTC
ATCTACTCTTCCTTATTTCAGCTGCCAGCTCCTCTCTACCCCCATTACCATCTTTTCCAG
AGGTACCTGGGGCTGTTAATTCCCAAGATTTTTGAAAATTCTGCAAAGTTTTATTGGCTC
TTGGCTTTTGCAAATGCCAGCTTAAGATTTTGCTTTCCCATATCTATTAAGTCAGTTACT
ACTTAAACATCTGCTTTTTCAGCTTCCAAATTTTGTCGCTGCTGATTCCTCTCCTGTTCT
TCTTATTCTTGTATTTTGTGCTTTTAAAAAAGTGCTTTCATTGTAGCTCTGTTGACTTTA
TTGAGAATTGGCCAAAAGAGTTGTATATTTCAAGGCCCCACCTCTGCTCAAATGTTCTAA
CATTATTTCTTACTACCAGACTTTCAAATTGAGTATTGGGACAATGAGTTTTAATATATA
CCTGGAATATAATAGGCAGTTTTGTTAAAGTTAATTCTATGATCAGTATATTTTTCATTG
TCACTAATTTTATGTTCATTACCTAACTCTTCTCATTTAATTCTCAAAATTTTTTTTTAA
TTCTCAGAATATCATGAGAGTTACTGTATTTGACAGGGAAATTGAGGCTAAGAAGGTTTT
AGGGACACATAGAGGATCATATTATCTATGTGGACAGGATATCTGATTCCAGAGCCATTA
TACTTAGAACCACTCGATCTTGACCTTACTGCCTTCTTTATAACCAAGCTGAAATTGCTA
CTTATGTTAGAAAGAAGCCTAACTAGACATGGCTAAGTAGAAAGCCAGTCCATCTTTACA
CTTCTAGGGAGTTTCCACCCATGAAGAATCATTTAGTCCCCATTGTCTCCCATTGTTGTT
GAAAATTTGCAGTCAGCTTAAGACACAGAGACAAGGTGGGCAATAAGACCTTAGGTGGGC
AATAGTAGAAGTTGCTGGAATGATTATGCCATATGCCTTTAGGGGAGCTCTGAGGGATGG
CCCTACCAGCTTAGTTTCATGTTATGTCACCATTTTTGAGATCCATGCTGTAGTAGTTTT
TTTTTTTTTCAGTGAACTGTCAAGTGCTGATAATCTATTGTAGTGTAGGATTTAGTAGGG
TGATGTTGATGACATTAAGTAGGTGAATGAGATGTGATGAATCATCCATTTTCTTTTTCT
TTGCGTAAAGCTGAAAGAATTGAAGAATCTGCAGCAGCAATACTTACAGGTTAACCAAGA
GATCACTGATTTGCGTCCACTGAAGACTCAACTTCAGGAGTATCAAGATAAAATAAATAC
ATTTCAGATTTTACAAGAAGAGCTCAGGCAGGAAAACCTCTCCTGGCAGCAAGAGCTACA
TCAGCTCAGGTATGACAACCTCTGCTTTTGATGCCTTTCTTTTCATTCCCTTTTAACACA
TTTATTATGAATTGTAGATTCATAGGAAATTGCTAAAAATGCTAGAGAACTCCTGTGTAG
CTAAATTTCACCTATTTTCTTTCAATAGTAATATCTTACATAATTTAATGCAGTATTGAA
ACAAGGAGACTGTCATTGCTATGACTCAAAGATCTTTAGGTTTCACTGATTTTGTATTAC
TATGTTTATGTATAGTTATGCAACTTTATCATGTGTAGGATGCAAGTAATGACCACTATG
GCTAAGATATAAAGCTGTTCCCTAAATGTAAAAATGACCTTTGCACTAGTGGTCGATAAT
TATTTTCTTCTCTTCCCTCACTCTGAATCCTAACCCCTGAATGTGATTTATAGAATCATA
CAGATAATTTTGAAATGAGCTTTTTCTTTTATACATCAGAATCTCCTTGAGTTCCGTCAT
CACTGTTGTATGTATCAATAGTTAGCACTGTAGTAGCACTGTCATCTTGCTTTCCATCGA
TTTGCTCAAACGGGCACCAGTAATGTCTCCATTGTGAAAGTTGTTACTGTTTTTGGCACA
TCAAATATGGCACGGGTAGCTGGCCAGGCTCTTTTGTGTGGGCGGGTTGCTCTCGGAATT
TTGCCAGGCTCTCCAAGAGGGACGGAGGAATCAAACCCAGGTCAGTCATGTGCAAGGCAA
ACGCTCTACCCACTGTGCTGTCCCTCCAGCCCATATATCAGTAGTACATAGTATACTATT
ATGTATCAGTAGTTAATTATTTTTACAAAGAGTATTCAAAGACATTAATGTAACTTACCT
GATGATGGTCATATATATTTTTTCCTAACTTTTACATATTATAAATTAGGGGCTCTGTGA
CCATTTTCTTTTGGGGAGACAGGGTGGGACACTCCCAGCTTCAAGGCTTACTCCTGGCTC
TATGCTTAGGGGCCACTCCTGCTAGACTTAGGGGACCAAATGATTGCCAGGGATGAAACC
CAAGGGTGCCTGGGATTGAACTTGGGTCTGTTGTGTGCAAGGCAGGCATTTTACCTGCTG
TACTATTTCTCTGGCCCACATGATCATTTCTGTCTAGATTTTTATGTTGACAATGAATTT
TTTTATTTCTCTGATATAATTGCCCTGGAGTACCAGTGCTACACTATATGGTAAAAATAT
ATGTTAAATTTTTTAGGGGGGAGGTTCTTTTTGGGCCATACCCAGCAATGCACAGGGATT
ACTCCTGGCTCATGCACTCAGGAATTATTCCTGGCAGTGCTCGGGGGACCATATGGGATG
CTGGAAACTGAACCCAGGTCGGCCGTGTGCAAGGCAAACACCCTACATGCTGTGCTATGG
CTCCAGCCCCCATATGTTAAATTTTTAAGAAACTCTAAAACTACATTACAGATGACTATC
AGGATCCATGTAGCTACACTATTATAAATATTCATATATAAACACTGATCCATAAATAAT
CTTTTAGTTTGTTTTGTGGCAATACCTGGCAGTGCAGTGCTTTGGAGCCAACTTGTGTCT
TAGTCTCAGGATTCATTCTTAGTGCAAGAATTGATCCTGGGGACCACACATACAAAGCCC
TTAGTGCAATCTCCCTGGCCTGCTATATAAGTATTACTATTATAGATAATGACTTTTATT
TTTTCTTTAGCATACACAAAATATTTCTTCTGTTTTTTCCAGTTGGAGATGGGAAAAAGT
TGAAAACTGCTGTATAAGATTTTTGTCTCTGTGGTTTTCAAATATTTTCTCCCATTTGTA
GCTTTTCTATTCATTTTTCCTGACAAAGTCTTAAATTTTGATAAAATATAACTTATTTAT
TTTATTATTTGGGGAGAAGGGGGATTGGAACTATGCTCAGGGACTACTCTACTCAGCTGT
ACTCAGTGGGTGCTGCAAACAGTGCTCAGGGGACCAGGTGGTACAGGGAATTGAACCAGG
ACCAGTTGCATACAAAGAAAGCATCTTAAACCTTGTACTAGCTTTCTGGTTCCAAGTTTA
GTTTTCTTTCTATTTGACTTTAGTGATTTCTGTTATTCTCTCTTCAAGGTCACTGATTTT
TTTTCCCTACATCCATCTGCAATATGCTGTTGATCCCTATTGAGTTAGCTTTTTCACTTT
GGATATTTCCAGTTTTAAAATTTTCACCCACTTCTTTTATATATCTTACGTTTTTCTTCT
TTGTTGAGATTTTGTTTATTCTTTTGTTTCCATAATGTAATTTGCTTGTTAAAAACATTC
ATTTGATAACTACTTTGCAATTTGTTTATATTTTCTTTATGTCTGTTTCATCTTGGTGTT
ATAATCTTCATTTTCTCAACCAAATTATGATTTCTCTGGTTCTTAGTGTGATGTGTGATT
TTTGGTTTTATTGATGAGCTTCTGAGACTCTAAGACTCAGCTGAACTTAAATCTTTTGCT
TTGGTAGGTTTCCACTGATTTCATAAGAAGGTGTCAATAGGGGAAGAGAACCACAAATAC
TATATTGCCAGATGTAGGGTGAAGTTCACTGGACTTCCCATTCAGCTTTTTTAAATACTC
TTAAGGGAGTAGGGTACTGTCAGCAAAATATGGAGATCTTTGCTCTCTCCTACTTCTCTG
ATAACAGTGAGATACCTGCTGTTAGATGACAGTATGGATCCAAGCTACGTGTGACTTCCA
TTGATATCACTAGGAATGTGGAAAGGAACAGGAACCTCACAAATATTGGGCAGTGATGAA
ATTTTCCACATTCAGTATACCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNAGTACAGGATCAGTGCTTGTCTGCAGGTGGCCCCCCAGATGTGGCCCCAAAA
CAAAACAAAAGAAAACAGAACATAAAACCAGTTGAGCAGCTAGAGAGGTAGTACAGCGGT
TTAAGGACTTGCCTTGCATATAGCTGATCCTGGTTCAATCCCTAGCATTCCATGTAGCAC
TGTCATCCTGTTGTTCATCAATTTGCTAGAGCGGGCACCAGTAATGTCCCCATTGTGAGA
CTTGTTTCTGTTTTTGGCATATCGAATACACCACAGGTAGCTTGCCAGGCCTCTGCCATG
CAGGTGGGATACTCTTGGTAGCTTGCCGGGCTCTCTCAGAGGGACGGAGGAATCAAACCG
GGTCAGCTGCGTGCAAGCAAATGCCTTACAGACTGTGCTATCGCTCCAGTCCTAGCACTC
CATATGGTCCCTTAAACACCATCAGGAGTGACCCCTGAGTACCACCATGTATGGCCCCTA
ATCAAACCAAAAAAACAATGATTTTACTCTGTGGAAATAAAAATTTCTTCTGGTTCATCT
CTGTAGAATCAAAACTCCAGAGAAAAGATTAATTTGCATTCTTTCAGCCTGTTCTTTTCC
CCTCCCAGGTAATAGCTTTCCCACTTTATTGTTTCAATTCATCATGAAGAATTAGAATCT
CAGTGTATCTTCCTTTCATATTCACAGTATACTTACCATTGAAAGTAGGTCCTCCAATGT
GATCAGGTCCACACTAGAAATTACCTCAGTGTCTTTCATGTTCCCTCTATGTCACCTGGA
ACTATAAATATGTGAAGTGTTTGGTTATTAGTATAAACCTAAGAATTGCAAAGCACTAAC
AGAGAGTTGATTCACTGACTTTAGGCTGACTTCTGTATCAGAATAATGTGGAGATTTCCT
GTGTTTGAACCATGAAACATTTGAGATAAATGAGCTTTTCAAAAATGAAAAGCAGGAGTA
TATTGTTCAGATACTGTTGGCCTCTTTTGCTTCAAGCAGACCCACATTTATGCTATAACT
TGTGGTTATTTTCTCTTTCTCTTCTTTGTTTGGATTATTTTCTCAGGTTTCTGTGCTCTC
TTACTGAAGCGATAAGTGAGTTAAAGCTGTCTCTGTGAGACATGTATATCTTTCATGATT
GAGTTTCAGTCATACAATGATCAAACACCCATCCCTCCACCAGTGTACATTTTCCATCAC
CTGTGTCCTCAGTATCCCTCTGGACACCCCCTCCCCCCCAATCCACCCCCTGCCTCTATG
GCAGGCATTTTCCTTTTTTAGTCTCTATTTTTGGCATTATGGTTTGCAGTACAGATACTG
AGAGATTTAGGCCCATTCTTTTATGAGCTTCCTTCTCTACAGTCTCTTTCTTAACACATA
ACCATCTAAAAAAATGACAGTTTGAATCTAATTATGTAGGATTGAGATCTTTCTCGTGCG
TACTGTTATATTCCTTTCCCACTTTTTGTAGCTAAATATCAAAGAAAATGATTTATAAAA
TTCCTGTGTCATTTGTATTTAATGGACTTGTAGCTGATATAGATTTTTATTTTGGTTTCT
AAGATTTAGTTCTACCTTTTTGAAAAATATTTACTATACTCCAGTCACCTCTTAGCAAAA
TGGGATTATTTCATAACAAGTGTACATTAGTTATAAAACATCCTACCCTATTTCTATAGA
GAGAAATTTTATGTAATGCAAGCTTAATATCGGGAAAGAGATATTGGTATGATTAAAAAT
GGGGATGTGAGGACTGGTTCATAGTACAGCTTATAGGGCACTTGTCTTGCATGCAGCCAA
CCCAGGTTTGATCCCCAGCATTACATATGTCCCCCAAGCTCTGCCACGAGTGTTCCCTGA
GTGGAGAGCCAGGAGTAAGCCCTGAATAGTGCTGCGTCTGGCCCAAAAGCCAAACTAAGA
GAGAGAAATGCTCCACAAATTTGATTGCAGTCACAGTATTTGCTTTTTCCAGGCATAGTC
AAGAATATTAAAAATAAGGAAAATAGTAAGGTGGTAGTTTATGCTAAACTAAACAAAGTA
AGCTCTTCTTTTGGCCAGTTTAGGGACAAATAATAGAAGTAGCAGCAGCTAATAGTACTG
GATGATGCAGTGTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAT
CTTTTATTATTTGTGTACTATCTAGAGCATTTACAATGATAGTTTCTCTACACACTGCAT
ATAAGGGGCACAAGAAGAAGTGGTGATTTGTTTCCTCCTCCTTCTGCCACCTCAGATTTA
TCTAAAAGCTCTGGAGAGAGAGTACAGTGGGTGGGGCATTTGCCTTGCATGTGGCCAACC
CAGGTTCAATCCCGAGCACCCAAACGGTCCCTCAAGGAGTGATCCCTGAGCTCAGAGCCA
GGAGTAAGGCCTGAGAACTGCCAAGTGTGGCTCAAAACTAATAAGTAAAAGTAAAAAAGA
AATATCTAAAAGCTCTATGGTCCTGAGAACCCTGGACTGATCTCTAGCATAGAGCCAGGA
GTAAGCCTTGAGTATCATCAGGTGTGGCGCCAAAACAACAGCAACAGAAAGATATCTAAA
AGGTCTGCCGAAGAAATATTTCAGACTAACACTGAAACTAAACTGAAAAGCTACTTTAAT
TGATGTCATCTAATTGTTTATCTTTCTATATTTAGTTCCTTTCTCTGATAAAACAACATC
AGGGACTTGGAAAAAATATTTTTAAGTATCAATAGCTCTATCATAAATTATGAAAATCAC
CTGTACATACAGTTTAATTTAAAATAAATGGAGAAAATACCATTTAAAATTGTTTTATGA
TCAATTTATTAATTCACTATCAAAGTTAAAATTAAAGTTGTAAAATATGCGATCACAGCT
TAGGAAATAAGGGAAGGAGATATTTTTTTAAACGAAGGTAGAAGGGAAAGAGAACTGAGA
ACAAAGGAAGAAAATGATTGTACATGTATTGCTTTAAGTATTAAATCTTTTGTGGACCAG
AAAAGTTTTTTTTCTAGCAATTTCATTGCACTAAGTTTATTTAACTCACTTCTTTTATCA
GTGAATCTATGCATTATGCTGTTGTAGACTTCATATAATGGTCTAGGAATAAGATATTAA
GAATGAACTATTAGGAATAAAAAAAATGAATATAGAACGACTGGAAATAGCTCAGTGGTG
GACAGGAAGCACCTACCTTTGGGGAGGGGGCTAGGTTTTCTTTTTGTGAGAGGTGTATAC
ACACCCGGCTGTGCATAGAACTTACTCCTGGCCCTGTGCTCAAGAATCATTTCTGGCAGG
CTTTGGGGACCATCTGGGATGCTGGGGATTGAAGCATTAGAGCACCTGCTTTGCAGACAT
GAGGCCACAAGTTCAATTCCTAGATCTGTCCTGTGGAAGAGAGATGTAATTCTCAGAAGA
TTACCCTTTGGAAAAGCTGGCACCGTAGCAGAGCCTGTGATATCCAGCAGAACTTGAGCA
AAGGAGTGTTAGCACCACAGCTCACACACGGCGACACCACAACTAAAGCTGTGTGTAAGC
ACGGTCGCCAAATGTGCAGCCTCTGCTCAGCTTAGCAGCAACAAAGGGAAGAAAAAGGGA
CAAAGGAAGTTGAAATGAAACAAAGATGAAGACAACATTCTCAACGGTCATTTCATACAT
GATTTGAGTCTATCTTCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCAACATGCGA
AGCTGGTGCTCTGCTCGGAGCAACACCCCGGTTACTTGAGTTCTTTATTTGAGTGGGTGG
CCTTATATTCATTGATGTTCAGGGCTTACTCCTGGCTCTGCACTCAGGGACCACTCCTGG
CGGGGCTCCAGGGGTTATATGGGTTGCTCGGAATCAAACCCCTTCCCCACTCCCATCGGA
CACATGCAAACCAAGCTCCCTATGCACTGTAGTATTGCTCCAGTCCCATCCCCGGTCCAC
CCTCCCTACCCATCTTTTTCTTTTAAAGAAATGGCCAAGTAACAGTTCTGTTTGAATAAC
AGTGCATTGTCAGGATAGAAAAAAAGTTCTGTCATTACTTCTGCTTGACTGTCTTACTGC
ACAGTTCTGTTTATAATATAATTGCCTTACTTATCTGTTTTTGACTACATCTCTATAGCC
CATGCTACTGTTTTGAATATGAAAGTATTATTCTTCATCTCACAGGTTTATTTTGTGTGT
GTGTTGAGAGTGTGTGAGTGTGTGTGTGCTGTTGTTGTTTTTTTATTTTAGAATGGAGAA
GAGTTTCTGGGGAAATTCATGAGAGGAGAATGAAGGAACAGTACTTCTATGGGCTATCTC
AGACAAAGATCAGCAGCTCATGTCATCTGCAGAATATTATGAGGGAATTAAGAGCTTCTT
CCTCCCATATCGATCCCCTTAAAGTACAATACCAAAGACAGGTAAATAGTTTCAATGTTG
ATTGCTGTTGAAAGGTAAACCAATATCCAGAAAACAGTTAACTTCCTATAAGCTAAGTGC
CCATCTGCCACTATTATGCAAATTATCTTATGACTTCCTATCAGGTGGCTAAGGTTTTTA
GGAGGAATTAAGAATGAACAATATAAAGAGAGAATTGCATCAGTTTTTGTTTCCTGGCAG
ATGTCCCCAGAGATAGCAGCTTCCCTCGATGGGCCACAAAACCTACTATATGAGACAGAA
CTTCTTAGAACCCAACTCAATGACAGCTTAAAGGAAATTCATCAGAAGGAATTAAAAATT
CAGCAACTAAACAGCAAGGTGAGTGTTTCCTATTAGAGTAGTTTTCAATATCTTTTACTG
GAAGAAGCTGAGTAGAATAAGATTAGAATGCATTAAGCTTAGGCTCCAGCCTGGAGGGTA
GAGAAGTTTTACCTTTCTCAGAGCCTGGCTTTTTCATGCATAATGGACACAAGCCACCTT
CCTCCCTCCCTCCCGCCCTTTCTCCCCTCCCCTCCCCTCCCCTCCCTTTCCCTTTCCCTT
TCCCTTTCTTTTTCCCTTTCCCTTTCCCTTTCCCCTTCCCTTTCCCTTTCCCCTTCATCC
CCCAGTGGGGCCGGAAGGTGCATGTCACTATTCTTGGAGGCTGTTCCAGGCTCTCTTCTT
CGGGGTTCTCCTAATGATGTTCTCCTAGTGACCATGCAGCCTCCAGCTTGAAACCTCTGG
CTCCTGTCCCTTGCAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACA
CTTCATTTGGTCACTGGCATTCTGGGAAAAAAGAGTTCTTCATTGAGAATTTGAGCTCTA
AGAAAGACATCCACCTCTAGTGTCATTCATTAACTCATTCATCGAGGAAATAACTAGCAT
TTGCCTCCTATGGTTGTGGCAGTATTCTAGATATTGAAGGTGCAAAAAGACCTCTCATAG
TTTGGTGATCTTAAAGACTCACTATAAATTGCTGCATACATCTACTACATGATTTGGGCA
GATCACTACTCATCTCTTTTTAGTCAGTTGTAAATAGAAACAGAAATCTTTCCTCTTCCT
CTCTCAAATAAGGTATACTTTTCAGTGTGCTTTATGACTGAATGGATCTTCTGAAGTAAG
AGTAATCCTGTTTTTCATTCTGTCTATGCTAACATTTTTGTTATACCATGTGAATTTTTA
GAGGGGTTCCATGCCTGTTTGTGTTCAGGGTTTACTCCTTTATTCTCAAGGGTCTTTTCT
GGTGGGGGTTGTGAGATTATATATGGTGCTAGGAATCGAACTTGGGTCACCCACTTACAA
GGCAAATATGTTACCCACTATACTATGTCTCCACCCCTACAATGTGAATTCCTTATTCTG
AGTTTCTTTTTGCATCAGATGCCCTTCCCATTCAGTTTTTTCTAGAAAACTGTCATGTTT
TCTCTGAATATTGATTCAGCTTTTTTACATAATTATTAACCCTTAAAAGCATGCAGAAGA
GAATACTCAAAATTGAAATGTGTTAGCAAGTGTGCGTTTCTTTCATGTAAGATATGTAGT
CATAAGTAGGTACTTTGGAGAGACATCTCTGTAATTATGAATTTATCTGGCTAATAACAA
AACCTAAACTGTGACAGCCTGTAAGTGAGGAATTAGATTTATAGTTCCAAGGAAACAAAT
TCAAATCTGTCAGTTCATATTTCATTCAATGCAGGAAAAAAATTGTTTTGAGTTTTGGGT
TAAACCCAGTGGTATTCAGCGGTCATTCCTGGCTCTACACTTAGAATCATTCCTGGCATG
CTTGGGGACTATATGGGATTTGGGGTATTGAACCTAGGTTGGTCACATGCAAGGGAAATA
TTCTGTTGCTGCACTATCTCTCCACACCCCCACTTGCCAATTTTTTTTTGACAAAAAACA
TTCACTTAATGAAAAATGAATTGGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGTGTGTTAAATGGAT
GTTTTAAAAATTGAGTACAAATGATAAAGAGTACCATCAAAGAGGTTGATGTACTCAGCC
AGGATATCAGGTGAAATGGAAGAAAGTGAGAACAAAAAGGTGTATATTCACTGAGATAGA
ACAAAGTCTGAGGAAAAAGTCATGACATTAGGAGGAAAATTGAGTCAAGTGAGTGGGAGA
AAGTTAGTGGGGGAAAAATTGAGGAAGTGGGCCAGGGAGATAGTATAGGGTGTGTACCTT
ACGTGTGGCAGACCCTGGATCAATCCGAGGCACCACTGCATGATCTCTCTTGATAGGTTG
GCCTGTAATCATTGGGAGGGGACCCTGAGAAGGAACACTGCTTGGGAAACACCCTTGCCC
CGCTCCCCCAACAAAAAGAAAAAGAAAAAAAGCAGTGAGCAACAATTATGATGAAAACTT
CATAAGTTTTATGGTGAAATTTTAATTTTCTTCAAGAAATAGAAAACTCTAGAAGTGTAG
ACTTAGAGATAAATAAAGCTGGCAGAGCTGTTGCCAGTGGAGGAGAACATTTTCGGTGCT
GGGGGAGACTGAGCTCACATGGAATAATGAGCAGATCCATCCTGCTAGGGAAGAGAAGAT
TCCTAGGTTAGAAGATGAGATTTAAATATGATAATGGGGAGCTAGAAAGGTAGGGTAGGG
CACTTGACTTGCAACAGCCAATCTAGACTCGATTCCCAGCATCCCATATGACCTCCGAGC
ACCACGAGTAATTCCTGAGCATAGAACCAGGAATACCACCTGAGTATTGCCTGGTGTGGC
TGCCAAACAAAAAAGAACCAAAGAGAAAAGGATAGGGGAACATGTAAAAAGAGAACAAGT
GGCTTTGTACGTGGCTACCCAGTTTGATTTCCAGCACCACTCATGGCCCCCTGAGTACCA
CTGAGTGACCCCTGGGCACCAAGCCAGGAATAAGTACTGAGCACCACTGAGTATGACCCA
GTATGTTGCTTTATCAATTATCAATAAAACAAGAGGTGAAAATCTAGGAGAAAATATAAA
GGAATTTTATGTAGATCATTTTATTGGGGCACAAGATATTCACTTCTAAATGTGTACTTA
AGGAAAGTTATAAATGGCTGTATTTTGCTCTGAAAATTCTCATTCTTCAACGAGTGAATT
CTCATTTTCCTCGAATGTATATTAGCATATTGATGTGGCACTATAATCAATGTTAATTTA
GTCACATTCAAGTGTGAACCACCAGTGGTATGCACGAGCATCAATATGTTAAGCACCTTT
ATCGTTAAACAACTGAGTTTACTCATTTTCCAGGGGCCACTAAATATAGATGTTGCTCCA
GGAGCTCCCCAAGAAAAAAATGGAGCTCACAGGAAGAGTGATCCTGAAGATCTGAGGGAG
TCACAGCAAAGGTAAGGGAAGCAGCTCCTAACCTTGGAATGTCCAGAAATCAGTAGTCAT
CAGATTGAATGGGAGATCTGCTGTGGATTTAATATGTCTCTTATCTTATTGGCCACAGTG
AGTTTAAGTGAAGGCATATATAATACAGTTTATATAATGTTTCTAAAGCAAAAAAGCAGT
AGCACCAGTACATATAGCACTGGTCCTACGGAAGTCATATGAATAATACTTAGTTATTCT
CCAAGAGCTTCTAAGGCATTTTCTGTAACTTTATTCAGTCTCTATAGCTGTGTTTTGTAT
ATATTCCAGAATATATTTCAGAGATAGAGTGCTGAGGTTCCTTTTTTTTTTTTCTTTTTG
GGTCACACCCAGAGATGCACGGGGTCACTCCTGGCTCTAAACTCAGGAATTACCCCTGGC
AGTGGTCAGGGGACCATATGGGATGCTGGGACTTGAACCCAGGTCGGCTGCGTGTAAGGC
AAACACCCTACCTGCTGTACTATCACTCCAGCCCCAGAGTTCGAGGTTCTGAGGGCCCTG
GGTTTGGTGCTGGGGTAGGCACCTCAAAACCAAAAAACAACTTATATCTTGTCCTTTCTC
ATGCCCTTTTAAGGTTGTTGCAGTACTTGCTTTAAGAGGCTAACACAGAGGGTAAAATAA
GTCTTCATAAAACCCAGAGAAGATGAACATTCCTCTCAGGATTATGTCTGGAGTCACAGT
GGGAATATATACATATATAAACACATAAAATAAAAATATTTTTTGCATGTCCAGCGGTAC
AGTAGTTAAGACACATGCCTCACCTTTGGTAGCGCCTGGTTTGATTCCTGGTCCCAGTTG
GTTTCCTGAACAACAAGGCCCCCATGCTTCTTGGGGTGGTCCAGTGGCCCAGGAAATCCC
TGGCATCTCAGGGCCCTCACAGTCTGGCACTGACCCTGTTGGTGAGAATAGCTCCTCCAA
TTGAAAAAAATGTTTGTATGAGATTTTGTAAATATATCTACTTTATAGCCTTATCAAAAC
CTTGACTTCTTTGTGTCAGTACCTATGTGCTGCATCTCGTGGTGATATTTGTTTTCCTTT
AATCCGGAAGCTTGACTGAAACCCAGCAGCAGCTGTGTAGCACTAAACAGGAGATGAATG
AATTGAGGAAACTGCTGGAAGAAGAACGAGACCAAAGAGTGGCTGCTGAGGCTGCCCTTT
CCTTGGCTGAGGAGCAGCTCCAGAGGTAAAGGCAAGGGGTGGCAGTGTGCAGTTCTTCCT
TCAGATCCTACTCCCCTACATTTCTTTCTTTTCTTGATTACAAAGTTATTTATCAACACC
CTTCTCTTCATCGGTGCGTGCATTTCCCACCACTAGTATCCCCACTTTCCTTCCCCCCAC
CCCCTGCCCCAACCCCACAGTCTGCATCTAGGGCCTATGGCACGTACTTTCTATCTCTCT
CTCTCTCTGTCTCTCTCTCTGTCTCTATCTCTTTCTGTCTCTCTCTGTCTCTCTCTTTCT
GTCTCTCTCTCTCTCTCTCTGAAAGATGACTGGAGAGCCTCAGCCTCTCAAACCTCTTTG
TCCTTCACAGGTTGGAGCACAGTGAGTGGGAGTCTGCCCGGACTCCTATCATCGGCTCCT
GTGGAACTCAGGAGCAGGCGCCATTAATAGATCTTACAAGCAACAGTTTCCGAAGGGTAA
GAAGGGAAGAGGAGGACAAAAAACGAGCGTATTACTTTCAGACAGGTCTGGCTGTGTTGG
TATAGTGGGTTGAAGAACAGGAATATGAAAACCAGACACTAAGCAGCTAGTGGGTCTAAG
AAAGTAAAACTTAGAGAAATCAGGGTAGAATTTGTCACTGACACTGAGAGAACTTTTTTT
GTGGTTATAAAGGGAAATGGCACATCTATAGAGGAAGAAACTCTGACTTATGCATTTTTG
TTCCAGACTCGGAGAAGTGCTGGATGGAAGCGGATCCTGCGTTCACTCATTCATTCCCGG
ACCGGAGTGCCCATGCTGGCAACCCTCTACTTCCTGATGATTCATGCCCTGCTCATTTTA
TGTATCACGCGCCATCTGTAAACAGTTCTCATCTTTTTGCTGTCTCTCCTCAGAACTTAG
AGTGCCCCGCCTGGAGTAGTAGTTCCCACAGACGAGTCTTCCTGTTCCAGGTCATCTCCA
ACTCTCCGTGCAGAGTGTCTTGCCAACACTAAGGCAGATGCAGGAATCAAACGTTAGAGC
TGCAGAAAATCAGCAAGTCTGCTTTCTTCTTCTATGCAGGAACTGAGGTCTTCTACGTAA
TCTGAAGACGTCATATAGTGGTTTGTTCAGAGTCTGTAGGGACCCAACCTCTGTCTGGTG
AGAGATGCTTAGGGAACGTCTGTCAAGCCAAGAAGATGGTTCCTATAAATCTAATAGTCT
GAAGTCCAGAATCACTTTTTATTGACACTTTTTTAGCCTCATTTACCTTATTTTCTCCTG
TCTCAGGGGAAGGTCACCCTGCCGTGAACAGAGTTCTGGGGAAGGTTCTCTCATGTGATT
GCTGATTAGGTCTCTTGCAGTATACATGGGCGCTGACAAACTCCTGCTGGTATCTCTGTC
CCTGCCTGGTCAGGCATAATTGGAGTCACCTTGTGGCCTTGGACTTTATGTTTAAGCCCC
ACTGCATATACACTGATTGCTTTTGCACCAGGGTATATTTAGTGCTCATGGTTTTTCTCT
CGCTGAGAGGCAGGAAAAAACAGCTATCTATGAATAGGGGTGTTCATATTATTGTTATTC
AGAAGACAAATTACTTAAATCCAGGCCTGAGTCTAAGTCCTGGATTTATTTCCATTTGTG
CCTATTTCTTTCCTTCCTTCCCTTTTCCTGGTGGCTCTTTGTTGTTATTATTGTGTGCCA
TGCCTGCTCTCAACCACCCAAAGAAGAGAAAACTGCGGACTGACTGATAATACTCATTAG
AGTATTTTTGTTCTGTGGTGACCAAATCTTGGTTATAGCAACCCAGGAACTTTCCTGAAT
AATTGTAAAGTAATAAAATTATTTTCAGAATGAAGTAGTGTTGTGTATATACTGTTTGTG
T
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1093, 7399..7551, 8041..8193, 34746..34862, 34865..34870, 36450..36566, 39627..39734, 40739..40852, 41152..41452, 41454..41476, 41479..41492, 41494..41555, 42572..42687, 45475..45589, 46550..46623, 49206..50787, 50792..52433, 52453..52465, 52468..52482, 52484..52504, 52507..52509, 52514..52519, 52522..52545, 52550..54384, 55595..56771, 56774..56794, 56827..56941, 56944..56957, 56959..56985, 56989..57005, 57007..57490, 62830..63008, 82491..82510, 82512..82545, 82547..82551, 82553..82579, 82581..82660, 82860..82997, 85073..85216, 86913..87010, 88090..88224, 88570..88675, 88926..89060
1001..1093, 7399..7551, 8041..8193, 34746..34862, 34865..34870, 36450..36566, 39627..39734, 40739..40852, 41152..41452, 41454..41476, 41479..41492, 41494..41555, 42572..42687, 45475..45589, 46550..46623, 49206..50787, 50792..52433, 52453..52465, 52468..52482, 52484..52504, 52507..52509, 52514..52519, 52522..52545, 52550..54384, 55595..56771, 56774..56794, 56827..56941, 56944..56957, 56959..56985, 56989..57005, 57007..57490, 62830..63008, 82491..82510, 82512..82545, 82547..82551, 82553..82579, 82581..82660, 82860..82997, 85073..85216, 86913..87010, 88090..88224, 88570..88675, 88926..89057
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved