Sorex_araneus Locus ATP5B
snOPY snoRNA Orthological Gene Database
Sorex_araneus ATP5B
Sorex_araneus
ATP5B
GeneScaffold_635
SNORD59, SNORD59
1876..1953, 3194..3263
8107
TGCTTAGGGATCACTCCTGGCAGGGTTCTGGAGACCATGGGGTACTGGGGATCAAACCC
AGGTCAGCTGCATGCAAGGCAAGTACCCTACCAGGTGTGCTATAGCCTCCACTTTTTTTT
TTTTTAAGGTTTTATTTATTTATTTGGGCTTGGGGTCACACTAGAGGTGCTCAGGGCTTA
CTCCTGGCTCTGCACTCATTCCTGGCGGTGCCTGTACAGGTCCATTTGAGGTGCGGGGGA
TCGAACCCGCGACAGCCACGTGCTGTACTCTCTCTCCAGCCCTATATCATTTATTTTTTG
GTACAATTTTGTCTCCTTAAAGTATGAAACGCTTCACTAATTCACATGTCATCGCTGTGC
AGGAGCCATGTTAATCTGTCTTGTTCCAGTTTTCGTGTATGTGCTGCCCAAGCAAGCACT
CGTTATACAGCTGTAAAATGTTAAGTCAGTATTCCCGACCTGCTGAGCCAGCTGCCTGGA
AGCTGAGAAGTCTCACCAGGGAGAAAGAAAAAACTCATTTCGACTTCAGAGAATCGTTCT
GCCGCGGCCAAGGTCACCATCAGAGGAGATTCGCGTTCTTACTATTTTCCCAACCCCCGC
CTCGGAGACTGTCACCTAGCTCAAGGTCCTACCCATGGAGAGGGCCCAAGGACAGCCAAA
GACGGTGCACATGCTCCCCAACAGGAACTCCGCCCCTTTAACACACGCAGTTCCGCCAAG
CATTCTCTCCAACTGACAGCCCTGCTGTCCAATTACGTTTCGAAGCTTTGAGGGTTGACC
CGAACCTGTCAGGAACCAGTAGAAAAAGGAATTCAGATTAGCATCTATCTCGACCAATGG
TTGAGAAGATGAGAAACCATTACCCTATAGGAGTAGTGTTAAGAGTGATGAGCAGTAAAT
TCATCCAATGGGAGTGCTTACTGCAGTTCAGGCCACGCCCCATCTCCGGGGATGTTGGCA
GCACGAACACTGCAGCGATCAGTCTCCACCCGGACTCCGCCATGTTGGGTCTTGTGGGTC
GTGTGGCCGCTGCCTCGGCCTCTGGGGCCTTGCGGGGACTCAGCCCTTCAGCGCCGCTAC
CCCAAGCCCAGCTCTTACTGCGGGTGGCCCCGGCAGCTCTCCAGCCTGGTAAGTGGCTCC
TCTTGCAGCTGCGCCCGCGCCTGCAGCCCCGTGACCTTGAGCCGCGGGAGATCGTTGCTC
GGGCCTACGGGATCGGTGTCGGTGGAAGCACGACCGGGCCGGGGCCCCGCAGCCTATCGG
GCTTGGAGAACAAGAATGGGGCGCCCACGGGGGCTGCCATCGGCCCGGTTTCGCCTCGTT
TGGGAAAAATGGGCATTATGTGGCGGAAAAGCGCGGGCAGATGCATTGACCTTGCTACGA
AATCGGGGCCCCGGGCTTTCGAAATAGCGGGGGGTTCGTGCGCGGGGTGGGAGAATCGTG
TAGGCCCTCCCGCAGGACACGCCTTCCGTGCAAGCGGAAGGAGGCTGGGCCTGCGTCCGA
GCCTCCGCCAATCCTCGGGGGTTTAGACTGGGCTTCCGATGACCTTTAACTGCCCGCACT
GACCCCAGTTCCTTCCACCTCTCTGTTTTGTGCGTGTGTGTATGTGTGTGTGCGTGCACT
AGCCAGAGACTATGCCGCCCAAACATCTCCTTCCCCGAAGGCGGGCACCTCCACTGGGCG
CATCGTGGCGGTCATCGGCGCCGTGGTGGACGTCCAGTTCGATGAAGGACTTCCACCCAT
TCTCAACGCCCTGGAAGTGCAAGGCAGGGACACCAGGCTGGTGTTGGAGGTGGCCCAGCA
CTTGGGTAAGTCGGGTTTGGTTAGGCGTCGGGAAGAGCTTGTGGGTTCCAAGTTAGCTCC
AAAGCCAGGGTGCAACCCTTCTGTGATGATTTTATCCAAAATTGACTTTCGTTCTTCTGA
GCTTGCTGAAGCCATAATAGAGAAACTGAGAAGGAGTCTTGGGGAACTTGGGCCTTTCGT
GCCCTCCGTGCGGGATTAAGAATCACGTTGCCCATGGGGCTCTGTTTATCTGACAGGTGA
GAGCACGGTGAGGACCATTGCCATGGATGGTACAGAAGGGTTGGTTAGAGGCCAGAAAGT
CCTTGATTCTGGTGCCCCAATCAAAATCCCCGTGGGTCCTGAGACCCTGGGCAGGATCAT
GAATGTCATCGGAGAGCCTATTGATGAGAGAGGCCCCATCAAAACCAAGCAGTAAGTATC
TCTCCTGCTGTATCGTGTTGGGGGTGGGGGGGAGAGGTGGGTTTGGCTGCAGCTGGCAGT
GCTTAAGGACGATCGAGTGACTGTATGGGGTTATTCCAGGTGGTGCCCAGGATGAGGTAT
GTGACTTATTTTTCCCAGTTTTATACATGGTGACACTCTTTAGTATAGCAGTTTTCCTTC
AGAGATAAAATGAGATGCTGATGTATCCTGTTAATAGGCCCACATAAAACAGGGTTCAAA
CCTCGTCCTCCAAAGACATTCAAGGGTACTGCACCAGGGATGTAGCCAAAGTACTTGACA
TTTGAAATTCTCCAGATCAACAGAAAATTGGAAGGCCTACAATCAGAGGGAACCCCACTT
GATTGGGCTTGAATTCCAGTTTCTTTGGTTGTGGGGTTTCCAGTGCTTGTAGATCTTAGT
ATGTCCTGTTGATTTAGGGATACTTTCAAATGTGAAGAATTACTGCTAGGGACTCTGAAA
GGAAATCTGTATTGTTGTGTCTTACCAATTTGGTTTCTGAAGAAAGGATTTTTGTTTTGT
TTTTATTTGGGGCCCCACCCAGCTGTGTTTAGGGCTTACTCCTGGCAGTGCTTAGGGGAC
CATATGGGATAGAACCCGGTTTGGCCGTGTGCAAGGCAAGCACCCTCCCCGCTGTACTAT
TTCTCCAGTGCCAGGAAGGGTTTTTTCAATGACACAACTTCACATTTTGACTGAGTAGAG
AGACATTTTCCAACAAGGTGAACAGACATCGATTCTCTCTTTACAGGTTCGCTCCTATTC
ACGCCGAGGCGCCTGAATTCATTGAGATGAGTGTTGAGCAAGAAATTTTGGTTACTGGTA
TCAAGGTCGTGGATCTGCTGGCTCCCTATGCCAAGGGTGGCAAAATTGGTATGTTTGTGG
TGGGCACATATTTTCTAGACCAAATGTGGGGAGAAAGATCATCTCAGGGTATGAGTGGGT
ACTGAGATATTATCCCTCGCTGATGAGTAGCTTCTGACTTTCGTTCTTCTGAGTTTGCTG
AAGCCAGATGCCATTCTGAGAAGGACTATAGGCGGCAAAAGTCTTTTATTTATTTAGGTT
TTTAAGTTGGCTTAAATTTGGGAGGACTTTTTGTGAGGAATATAAGAATTTCTTAAAAAT
TCTCTTTTCAACCTCTCCCAGGACTGTTCGGTGGTGCTGGAGTTGGGAAGACAGTATTGA
TTATGGAGTTAATCAACAACGTTGCCAAGGCCCACGGTGGTTACTCTGTATTTGCTGGTG
TTGGTGAGAGAACCCGTGAGGGCAATGACTTGTACCATGAAATGATTGAATCTGGTGTCA
TCAACTTGAAAGATGCTACCTCCAAGGTAAGCACTGAGCTTACCCATATAGTAGGTTTTG
CCCTTTTTGATGGGGGGAGGGTCGGGTCACACCTGGTGATGCTTATTCCTGGCTCTGCAT
TCAGAAAATGACTCCTAGCGGTGCACAGGGAACCATATGGGATGCTGGGAATCGAACCAG
GGTTGGCCACGTGTGAGGCAAACGCCCTACCTGCTGAACTATGGCTCCAGACCCCACATA
GTAGGTTTTACTAGGTTGTTTTCTTTTCTCTTTAAAATTAGGTTACATTTCCTGACAATT
GTTTTTGATAGATAGTGCCATGACCTGAAGATCAATTTAGGGGAGATGGTTTATTATATC
TTAGAGAACCAGATCAAAATGAAAGACATTTTGTGCCTTTCGTTTTGATTCTTTCCTACA
GGATTTTTTTTTCTCCTAAGCGTGAGAAGTCATCTTTTTTGATTTTTGAACTCTAAAAGG
AAGAAATTTAGGAGCAAAATGACTCCTGAAAAAGTTTTGTTTCCGTTTTGGTTTTTTTGG
CCATACCTAGCATTTCTCAGCTTATTCCTTCCTCTGCTTAGGGATCACTCCTGGTGGTTC
ATGGAATCAGATCCAGGTTGGCCACATGTAATGCAGCACCTGACTTGGCTGTACTCTGAC
CTCTCTAAGAAGGTCGTTTCTTAGACTTGGGGACCTTGTACATGGTTTCCATACTCCTCA
GCTAGGCTGTTGCTATTTGTGTTACTGCAGGTGGCGCTGGTGTACGGTCAGATGAATGAA
CCACCTGGTGCTCGTGCCCGGGTAGCTCTGACGGGACTGACTGTGGCCGAGTACTTCAGA
GACCAGGAAGGTCAAGATGTGTTGCTGTTCATCGATAACATCTTTCGCTTTACCCAGGCT
GGCTCAGAGGTAAGAGAAAGCCTGAGAGAACTGGTTTCATCGACATTTCTTTGGAATGAG
GCAGATGAAGTCAAAGATAAAGAGACTTGAGACATGTTCATAATGTTTTATTTTTAGGTG
TCTGCTTTATTGGGCAGAATCCCTTCTGCTGTGGGTTATCAGCCTACACTGGCCACTGAT
ATGGGTACCATGCAGGAAAGAATCACCACCACCAAGAAGGGATCTATCACCTCTGTCCAG
GTAAGAATTGTTATATGAAGGAAGGCAGGCCTAATTTGTGTGAAGGTAAGTAGAGAGAGG
AAGGTATAAAACTTGGTTCTGTCTATATAGCTCTCAATTTGGTTCATGAGCTTTCTGAAA
AAAATCTGTAAAATTCTAGGAAACACTATAAAGTAAACCCAGGTAAAGTGTGTCATTGTA
GATCACAAAGTTTTTAGCTTACAGGGAGGTGAGCTACATGGAAAACAGCATTAAATATGT
ACTGTTCTGATGAAGTACTACAGTGGTGCTTTTTAAAATTTTTTTAGTTTTTGATTTATG
TTAAAAGTGGGTGACAGTGTTAATGTATAGACAAAAGTAATGTCAGGTTTTTTTAAAAAA
ATACAGCTAGAGGAACTAGATATATATGTGAAGTCAGCAGCTCTTCTGGGTGGTGGAAAG
GCTCTTGAGGTGGTTTTAAAAAAAAAAAATGGGTTCCTGGGACCTTTCTGGTGCAGGGGT
TAAACTCTGGTCTTCTGAATCCGAAGCATTTGCCCTGGTTCCTTCAGGTGGGCTCTTAAG
TGTTGAGAAGTGAGATTGTGAGGGGGAGGGCTAAGGTAGGAATACCTCCGGGTGTTCATG
TTTGCTTTGCTTTATTTAGGCTATTTATGTGCCAGCTGACGACTTGACTGACCCTGCCCC
TGCCACCACCTTCGCCCATTTGGATGCCACCACTGTGCTGTCCCGCGCTATTGCTGAGTT
GGGCATCTACCCAGCTGTGGACCCTCTCGACTCCACCTCTCGTATCATGGACCCCAACAT
TGTTGGCAATGAGCACTATGACGTTGCCCGTGGGGTGCAGAAGATCCTGCAGGTGAGTTC
TGCTAGTAAGATCAGTGACCCTAAAATCACAAAAGGGGATTTGGGCATGAGATGAGGGGA
CAGCTCTTTTCTAGTGACAATTGTGATTTGCTGTGGATGAAGGAAAGATGAGACCAGAGA
TTTCTAGTGAGTGCTAATGAAGTCTCTTGAGTTTTCAGTTAGTCTCTGGAATCTAGTGTT
TTCTCATAGCGACAGGTGAGAAGGAAAACTAGGACATTGATATGAGCTGAGTACACAATT
GACCACGAGTGTGTAACTTCCCCTTCATTAATTTGTACTTGTTTCACTTACGATGTGAGG
TATGGTGGGAAAAGACTTTGTGCAGAGAGCACCTTTACAATTACAAGGGAGTGTTCATTT
TCTGGGATCCAAATTAAGAATTTAGGCTTCTTAAATTGCTCCCTTTCTCTTCCCGTAGGA
CTACAAGTCCCTTCAGGACATCATTGCCATCCTGGGTATGGATGAACTTTCCGAGGAAGA
CAAGTTGACTGTGTCTCGAGCACGGAAAATCCAGCGTTTCTTGTCTCAGCCATTCCAGGT
CGCTGAGGTCTTCACTGGGCATATGGGGAAGCTGGTCCCCCTAAAAGAGACCATCAAAGG
ATTCCAGCAGATTTTGGCAGGTGAGGTATTGAATATCAAGCAGAATATGAAAATGGCAGA
GAAGCCTGAATGCTTGCTCTATGCCCCATTCTGACAGTTACCGAGCAACATGTGAAAGTC
TGCTGAAATTTTTTTTTTTTTTTTTTTTTTTTTGCTTTTTGGTCACACCTGGCGATGCAC
AGGGGTTACTCCTGGCTCTACACTCAGGAATTACTCCTGGCGGTGCTCAGGGGACCATAT
GGGATGCTGGGATTCGAACCCGGGTCGGCCGCGTGCAAGGCAAACGCCCTACCCGCTGTG
CTATCGCTCCAGCCCCAGCTGAAATTTTTTTAATCAAAAAGTACTTGCTATTATTGGGCT
GGAGAAAGAGTATAGCTGATAGGGTGCCTTGGAGGCAGTCAACCCAGCTTCAATCCCCAG
CTCTCCAGGAGTGATCCCTCAGTGCTCAGCCAGGATTAAGCCTGGAATGAATGTTTTTGT
GGTGAACTCAGGGGTTCACATATGAGGAAGACATTCTACCATTGGTCCACATTCCCAGCC
TGAGACTTACATGTTCTGATTCTTAACGGAATGCTTTTAGCTTTACCTAGTCTTCAGAGT
GAATGAGAACATCTTATGAGGAAGACTTGGTGGTTTGTGCTCAGAGCTCAGAAGTTTCAA
ATAATCTGTTGGCAATGTCACACAGCCAACGTAAGAGCAAGAATTTGAACTCTGGTTATG
TGGCTTTTCCTAGTCCGTATGAACAGGTCTAGTAAATTCGATTTCTGAGAGTAAGGAAGA
AAAGATTTAATTCATCACATTCTGACTGACCTCAAGTGGTAAGAAATACACAGTAGGCAG
AAAAACTGACATCCCCTAACAGTTGTTTTTCCCCCCTCTCCCATGTAGGTGAATATGACC
ATCTCCCAGAGCAGGCCTTCTATATGGTGGGACCCATTGAAGAAGCGGTGGCAAAAGCTG
ATAAGCTGGCCGAAGAGCACTCGTGAGGGGGTCCTTTGGCAAAGTAAAACTCTCATCCCC
TGTGCTGTCCTCACCCCTAATCCAAAAGTCTGTTTACTCTGACTAAGGGCATATGAGAAC
CTTGATTGAAAAAGCATTGTGTTCTGTCTGAAGAATATTTAAGGTTTCCAATAAAATTCA
CATCCTCCAGAATCTGCCTTATTCTGAGAAGACAACCAACGCTGGTTTTGTTTATTTTAC
TTTGTTTTGGGGCCACACCTGGTGATGCTTAGGGGTTACTTGTGGCTCTACAAATCTGGA
ATTGCTCCTGACAGTGCTCAGGGGACGGTAGGGGATGCTGGGGATCAAACCCAGGTTGGT
CGTATGTTTGGCAAGTGGCTTACCTGTTGCACTATCTCTCCGTGCCCCTTGTTTGGTTTT
TTAAAGCTTGAAGACATGTAGAAACATGTATGTGGCCTTTTAAAATTTCTTATGGAATTA
GAAAGTCATGATTACGTTTTATAGATACGATGTTCCAACACCAGTTCCTTTGCTTCCATC
CATGTCCCCCAGTTTCCTTCCCCCCTGCTCACCCATAGAGGCATCTTTTTCCCTAAATTT
TAGGCTCTGGTTCACAATGGCAGGGTATCATGTTTCTCTATTGAGTGTTCCCTTCCCTGT
CCACCTCATTGTTGGCAGTGATGAAGGCATATAAGCCTGGTGTTACGCTTGCATATCAGC
ACTTTAAGTTAGTTTTAGTCACAAGAAACCGTAGGACATATATGTTTGAAATGAGGTCAT
TAATAAAACACTTTGTGGGGCCATACTCTGTAGTCATGTTTCACTGGACCCTGGGGGCCA
TGTAGTCCAGGGAATTGGACCCAGGGCTCTGTGTGCAAAGCCTGCACCCCAGCCTAGAAA
GGCCCTTAACAACGGGTGAGGAATTTCCTGTGGATGTGTGACATAAAGACCCTCAACTTC
GGTCTTCCACATAATTTTGTTCAAAGCAATTTGAGTTTCACCTCAGCACACGGGTTTGCG
TAAACAAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1127, 1622..1804, 2036..2210, 2986..3107, 3381..3565, 4290..4448, 4557..4679, 5299..5511, 5938..6139, 7008..7102, 7105..7107
1001..1127, 1622..1804, 2036..2210, 2986..3107, 3381..3565, 4290..4448, 4557..4679, 5299..5511, 5938..6139, 7008..7102, 7105..7107
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved