Sorex_araneus Locus ENSSARG00000005462
snOPY snoRNA Orthological Gene Database
Sorex_araneus ENSSARG00000005462
Sorex_araneus
ENSSARG00000005462
GeneScaffold_3530
SNORA70
20395..20522
31968
ACCCAGCGATGCACAGGGGTTACTCCTGCTCTGCACTCAGGAATTACTCCTGGCAGTGC
TCGGGGGACACTATGGGGTGCTGGGAATCGAATCCGGGTCGACCTCATGCAAGGCAAATA
CCCTCCCTGATGTGCTATGGCTCCAGCCCCTAGTAATTTAATTTTTAATGGTGTTCTAAC
AACCAGCTCACAACATTTCTGAAAAATATTAACAAGCAGCTCTTGAAAATATATACTGAC
TCAACTACTGCTTGAATTGAAGACATTTTGTTTCTGAAAACTAGATTCTAAAGTATCATT
CAGATTAAAAATCACTGTATCACTGTCATCCTGTTGTTTATCGATTTGCTCGAGCGGGCG
CCATTCATCCCTGTTGTATGCTAGTGTAGCCTGATGGCATACTGGGGGCTCTTTCAGTGT
CAGGGGAATGAGGATGGTCAGATTAAAATACTGCTTGTTAAATTTGTTACATGCTGATCA
TCATGCCAAAGAAATTTTCATACATCTTAATTATTATAACTCATGAAATATATCACCATT
TTTTAAGAATGCTTGCGCTGAAGAGACAGTACAAGTGTTTGTCTTATTGTAATTGACCCA
GGGTCCTTCCCTGAGCACAGAGCCAGAAGTTAAGTCCTGAGCACGTCAGATCTGGCCCAA
AACCCCAAAAATTAAAATTTGACAAAAAGACTAATTGGCTCAGAGTCAAATACCTATCAT
ATGGCAAAACAAAGGTTGAGCTCAGTTCCATGCTTTTCTCTAGTCACTGCCGTCTGAAGC
ATACTGCGTAACCACAACAGCGGCAAGAAAAGCGTGCTTAGTTCCTCCCTGTTCCTGAAG
CTCTTTAGCATCCTTCCCGCTCCAGCTTCTCCACGAACCATCATTCTATACCTTTGTAGA
CAAAGGGAGTGTCACTATGGTCATTCTTTAGGAATTACCATGGTAACCAGAGTCCAGTGC
TCCAGCGTGAACATTCCAGAAGAGGACAGGGAGAAGTTTAGATGGACTTTTTCCACATAT
ATCTGTTGGGATACCAAAATTCCTTTCGAAACAAAAAAGTGGTGACAATTGAAGAAACAA
GTAAGGAGATTATAGGATAGAGGGTCAGAAAGCCACTTTCTACCCATTTATTTTCCTTCT
TAGGATTAGGGATTCCTTTCACACAAACACTCACATACCCCAGACTAACAATTTAAACAC
TAATTAAATTATGAGGTAGGGAAAGGAGTCATTCAGTTTTTCTGTTCTGTAATTTAAATT
CTTACTATGATATGTAATTTGTATAACCAGATTGACGTTTTCTTATTTAGCCAGCATTTG
AGTTTTTAAAATTGTTTTAAATTTTTTGCCCCCTCCCTTTTAAATTTTTTGATGTAGACA
AAACAACTGTTGATATAATTCTAGAGTTGAAATTGATTAGATATCAAAGCTCCAATATTA
AATTAATAAGTTTAAAAATAAATTTTTATGTGAAAATTGTTATATCTCACGATGGGGTTA
CTAAGTCTTTGTCTAAGGATTTACTAAAGTTGTTTGTTGCTAATGAAGCCTTCTATGTTA
TTATTTTGCCTGTTGTTTTGGCCTCTATGTTACTTTCTTATCTAATTTGGTGTGCTCCTA
CTTTTTTTCCTTTTAGGTTTTTTTGTTGTTGTTGTTGTGGAGGGGGGTATTTTGGGGCCA
TGCCAGCCTGTATGACTCCTGAGTTCAGGGGTCACTCCTGCCAGTTCTCAGGAGTAGTGC
CAGGATTGCACCTGGATTGTCTGCATGCCTTAACCATCTTTTTCCTTTTGCTTTTGTAAT
GCTGGGGATCTGAACCCAGGACTTCTGTAAGCAAGATAAATGTTGTATTGCTGAGCTACA
TTCTACCCCACACTGCAATTTGATACCAGTTATCTCTCAGTATATAATCAGAGGAAGCCC
ACATACTAATTTCTAATTTCTTTCTTTTTTTTTTTCTTTGGTTTTTGGGTCACACTCGAC
GATGCTCAGGGCTGACTCCTGGCTCTACACTCAGGAATCACTCCTGGCAGTGCTCAGGGG
ACCATATGGGATGCTGGGAATAGAACCCAGGTCGGCCGCGTGCAAGGCAAACACCCTACC
TGCTGTACTATTGCTTCAGCCCTCTAATTTATTTCTAATTTTCTTGACTTAAGTACTTAG
TAAACATCTATTTATTTAGTATACCAGGCATTGTGTGATTCCATTTCATGCTCTCAGTAG
TTTTGTGAATATATCCTCTCAATATTACTGTTTTCTTTTTCTCAGTAAGGAAGGTAAGAC
TTGGAGAGGTTAATTAATTTACCCAGGATCACAGTACTAAGGCCAGAAGTCTTCAAACAT
ATACCATTGTTTATATTTAAATATTTATATGGACAGATCCCACAGGTCTTGCTGTGAGCA
GAAAACTGTATGCATGATTAATGACCAGCTTTTCTATGAAAATATTTTTCATGAAATGTA
TATAATTTTCTTTTCCATTTTACGTTAAAAATAATATAAAATAGTTTAATTTTTTTTTTT
TTTTTTGCTTTTTGGGTCACACCCAGCAATGCACAAGGGTCACTCCCTGGCTCATGCACT
CAGGAATCACCCCTGGCGGTGCTCGGGACCCATATGGGATGCTGGGATTTGAACCGGGTC
AGCCTCGTGCAAGGCAAACGCCCTACCCGCTATGCTATCACTCCAGCCCCAAATTAGTTT
AATTTACTTTAAGTAATGGGCTGGAGCAATAGCACAGCGGTAGGGCATTCACCTTTCACT
CGGCCGGCCGGCCGACCTGTGTTTGATTCCTCCGCCCCTCTCAGAGAGCCTGGTGAGCTA
CTGAGAGTATCGCGCCCGCACAGCAGAGCCTGGCAAGCTACTTGTGGTGTATTGGATATG
CCAAAAACAGTAACAACAAGTCTCACAATGAGAGACGTTACTGGTACCTGCTCGAACAAA
TCGATGAGCAACAGGATGACAGTGACAGTGACTTTAAGTAATATACCAGATGTTTATATT
TTGTTTCATCCATAGACAGTGATATGCTATATGATAGGAAAATCTTTTAAATTCCCCTCC
CCAAACTCTGAATTGAAATGTCAGGTGGGTTCTATTCAATTCCCTAATATCTAGTTCTCA
AATTTTCCAGGAATCCATCCCTCCCTGGTGATAACTTCACCTAATTAAAAGGGGCTAGAG
CATTAGTACAGCAGGCAAAGCGCTTGCTTTGCATACGGCCAACCCAGATTTATTCCTCAG
GTAAATTAATTAACCTCTCCAAGTCTTACCTCCTTACTGAGAAAAAGAAAACAGAATACT
GAGAGGATATATTCACCCCATGTCCAAATTCATCAGTACTGAAATTTCAGGACTAAGCCC
TGAGCTCCACTGCATGTGTCCAAAATGAAAAAAAGAAACAAAAAAAAAAAAGAAAAAAGA
AAAAGAAAAGTTGGCCAGAACAGTAATTTAGTAACTCTGTGGGTCTGCACCTGCAACTGT
CTTCCAAAAGCCCTGGGCAACAGGGGCTGGAAGAACAGTACAGTGGATAGGGCACTTGCC
TTATATGCGGCCAACCCAGGTTCCATCCCTGGCACCCCATAAGGTCCCCCAAGCACCACT
AGAAGTAATTCCTGAATGAAGAAGCAGGAATAACCTCTGAGTACTACCAGGTATCCCCAC
TCCCCCACCAAAAAAAGTTCTGAGCAACAACCCAGACTTTCAACTTCATAGTACTATTGT
GCAGCTAGTAGATACTGGGTGGATTCCAGTGTAGCAACTGGTTAGACTCTCTGATTTTTC
TAATCTCATATGCATAAACATGTCACGAATATCATCATGTGGCCAATTGTACAAATATCA
AACAATAGTTTGATTGTATGCTTAAAATTAAAACTGCTGAGGGATCCAAGTGATGGAACA
ACAGGTAAGGCCCTTGCATTGCACACGACCAACCTGGGTTCAATCCCCAGCATCCTATGT
GGTTCCCCAAGCCCTGCCAGAAGTGATCTCTGAGTGCAGAACCAGGATTAAGCCCGGAGC
ACCACTAGGTAGGCGCTCCAAAAAGATTAAATTGTAAATTGGAGAATCAAAACCTGATAC
ATACCTTACAGTCCTCCGAGAGCTGTATTGTGGATTCACCACCAGGATCTCACCATTCTA
CAAGGAAGTGATCATTGATGTAAAGAGAGGGGTGCGGCAGGGTGATACCATTTCACCGAA
ACTCTTCAGTGCCGCCCTTGAGAACACCATGCGACGACTGGAATGGGAAGGAATGGGAAT
GAAGATAGATGGTTGGTAATTACACCACCTCCACTTCGCTGATGACATCGTTCTCACAAC
GCCAAACATTAGCCAAGCTGCACAAATGCTGACCGACTTTGACCACGAGTGTGGAAAGGT
CGGATTGCAGCTGAATCTCAACAAGACCATGTTCATGAAAAACAAACTGGTCCCTGAAGC
TCCATTTGCTCTCAATGGAACGAACATTTCCGGATGCAGCAGCTATGTGTACCTGGGTCA
AGAAATCAACATGAGGAACAACTTGGTGCCAGAACTGCGCAAGAGGAAGAGAGCTGCGTG
GGATGCATTCAAGAGCGTTGAAGAGGTGGTTAAGAGAACGAAGAACCTCTGACTCTGGGC
ACATCTTTTCGATTCCACCGTTCTTCCTGCACTAACATATGCCTCAGAGACCTGGGCCCT
ACGCAAACAGGAAGAGAATGCTATTAGGGTATCCCAAAGAGGAATCCAAAGAGCTATGCT
GGGAATATCATGTCTCACTCAAGTGAGAGAAGGAATCTGGAGTTCTGACCTCCGTCGACG
GCCAAAAATCAGGGATGCTGTCCCGTATGCCAAGGCATCAAAAATCAGATGGGCTGGTCA
TGTAATGTGATTCAGAGACGACTGCTGGACTAGAGCTGTTACCGACTGGATTCCATGGGA
CGTCAGAAGACCTCGTGGCCGCCCACCAACTAGATGGTCAGATTTCTTCGCCAAATCTCT
GAATGAACGATTTGAGGCTCTTCCTGTTCCTGAAACGAGCAGATATCATTGGGCTGCACT
AGCTCGAGACAGGGACAAATGGAGACGTTACTGGCGACTGCTCTAGCAAATTGAAGATCA
ATGGGACTACAAGTGATACAAGAAGAATGTGTGACCCTAGTTTTTTTACATAGTATCAAT
TCATTTTCTTTCAAAATGTAGCTATTGATGAGTGCTGTGCTATTTATATTCCCTTCAGCC
AGACCTTCTGTAGTTTCTGCTTATGCTTACTTAAAAATGAAGTCAGACATTTGCAAGGCA
AATTTTTAAAAAAGTTATCTTTATGATTCCCCTCAAGTTTTCATGATCTCTTCCGTGTTG
ACACAACAAAAGTGTTTTAAAATTATCTTCTTGGAAGGCTAGAGAGATAGTAGAGCAGGC
TGGGCATTTGCCTGTGCAAGGCCAACCCAGGTTCAATCCTGGCCACCCCTTATGGTCTTT
TGAGCCTGCCAGGAGTGATGCCTGAGCACTGCCATTTGTGGCTCCAAGCCCACGCCCCCT
TTTAAAAATAAATAAATAGGGGCCATGATGATAGTGCAGTAGGTAGCGCACTTGCCTTGC
CACAGCAGAACCAGGTTCAGCCCTCAGCTAAGCTCATTAAATTTTAACACTGACATATTA
TTTATCTAATCATCTACAATCTATATCCCAATTATCTCATTCATGCTTTTTTATTTGGGA
GGAGTATAAGAGTTTATTGGAAAGGAGAAAGGAAAAGGAACTCCCAAGTGAGGAGGAACT
TAATAAAGGACTAAGTTCTCATTAATTCTCTTTAAAGCAACATTTTACCTTTTTTTTCTT
CACACATATATACATATAAAAAAATTCACAATAGAGTTAATTTTATCTGTACCCTTCTAT
GCCTTCTTGGTAATTTCTTGGTAACATTGTCAGAATTCAAGGACTTTTCTTTCTTCCTTC
CTTTCTTTCTTTCTTTCTTTCATTCTTTCTTTCTTTCTTTCNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCTTGGGCCACAA
ATGTCTTAGTCTTGATTTCAAACAAATTCTCTTTTATTTGGTTTTGCTGAGATAAGTCCC
ACACTTTTCAATATGAAAACTCTTGCAAGCTAGACTTACCTTGACACAAAGCCACACTCA
AGACATTGTCCATTGACAGGAGACTCAGAAAAAAATAATAGAAAGGGACAGACGATTTTT
ATTCTGTCTTGAGTCTTTGAGACAAATGACCCCTTCACAAAATCATGACTCTCAAGCTTT
ATTCATTTCTTCAAAGAACTAAAGTTCAAATCTTTTGGTAAAAGCAGAGCAGCATCACAT
GTGTTCTCATTTTCTGGATCCTAATAGAGGATACACTGTTGGTTTTCCCTGCCCTGACCT
GAACGTCCTTTCCATCTCCTAGGTCTCCAGGCATTTCTGGGTCTGTGTGTTTGGTGGCCC
ACTTGTTAGAGGACAGCTGAGGATTGACATTCTTAGATTCCAGCAGGGGGCACTATAACT
CTTCTATTACAGAGTAGCATGTGTAGTACAAGTGAGCTAGGAGTGAACTGACCAAAAGCC
CCTGATTTTCCAAATGGATAGACCTGCTGAAGTTATAACTGTATCGGGAAACAACCTACA
CAATATGGTAGCAGATAATTTTCTCCTGTGAGTTGAAAGTAGAAGGGGCATGTGTTCAAG
CTACTTAGTTAAAATCTACCAAGACCTCCCAAAGTGGGGCCACTACCATGACGTGACTGT
CTTCTCCAGGCTTTCCCCACTGTTCTTCCCAGCGGGACCAGTGGCGGACAAAGCTCGCCT
CCACCACAGGTCCTAGACCTGACCATTGGCCATCGGGCGTGATGCTACACATTTCAGTGA
AGCTTATGGTGGCAGGGTGCTACCTCTGAATCCAGATACTTACATTGTGTCCCCCACCCA
TGTCTCCAGCTCAAGGATTCCAGAGTGACAGACTCCCTTGATAAGAACCCATGAAGTGTA
TGCAGGGGTCTCTTTGGTTTTTCCTGGAAGCCCCGTTTAGACAATTCCAAGAACCAGGTT
AGTGGAATGTGAAGAGCCTGTGCTCTGGAGCCAAACTGCTTGGACTAAACTCACGTCTCA
GCTACAGGCTAGTTAAGCGACCTTGAGCAAATTACTAAAGTTCGAGCTGTTTTTTCACTT
GCAGAATAATAGTGCCTACCTCTTTTTCTTTTTTTTTTTTTTTTTGCTTTATGGGTCACA
CCTGGCAATGCACGGGTTACTCCTTGGCTCTGCACTCAGGAACCATTCCCTGGCAGTGCT
CAGAGAACCATATGGGATGCTGGGAATCGAACCAGGGTTGGNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNATTCAGCCCCAGAGTTTTTTTTTAATATATATATATTCTACCACCTTTTTCCCC
CACTATAGCTGATTGTCTTTTGATTCCCAGTCAGCATGGTATTACCAACTTCAAGACAAC
TACCGATGATGTGTGTTAAGACATTATCATCACTGGGGCTGGAGCGATAGCACAGCGGGT
AGGGCGTTTGCCTTGCACACGGCTGACTCGAGTTGATTCCCAGCATCCCATATGGTCCCC
CGAGCACCGCCAGGAGTAATTCCTGAGTGCAGAGCCAGGAGTAACCCCTGAGCATCGCCG
GATGTGACCCCGCCCCCCAAAAAAAACATTATCATCACTAAGCATCTGGGAAATACCTTA
ATTTGAAAGCCAGAATTTTAGAAACTACTCTGGTAAATCTATTCTAAAAATTCTTCATCC
TCGCTTGCTTGTCATGCCTGTGTTCTCCCTTGAACATGTATCTCACTTGCATGTCTTCGT
GTTTCTTTGCTTACTTCCACTCTGGAGAGGCCCGTGTTCTTCCTCAAATGTGTACTTCTC
CCTTTCTCTCCCCTTAAATCTTTCTAAATAAGTTTCAAATAAAACTCTTGCTCCACAAAC
AAACAACCAACCAAACAAACAAACCTTCATCCTGAAGACAGTGTAGCCAATCAATTCCGA
CAAACAGGGAGAATGAGCAAAATAGTAGATAATTAAGATTTTTTTTTATCACACAGTGGC
CCTGGGAAGTCTAAAATTCTGAGAAATCTGCATCATTAAATTGGATAAGTGGAAGATCCA
CCCAACTACTTTGGGACCACGCCAGTGGTTATTTCAAAGCATATAATGTGTTCTTGTGAC
AACTCTCAGTTTATGACCTAATTTAAAATAAAGCTTTAAAACAGGGTATTTCTTATCTGT
TTATCACCAAAATATATCTATCTGTTTCTATATATTTGTATCTATATATAAAGCATGTAC
ATATAAAGTGTGGTTTCAATGGATTTAATTATAAACCTATTTTCTGCTACCAACCAACAA
AATGATGGATTCATCTACCCTGTCACAGTAGTTTTCTTATAAAAAGTTCATTGTCTCCTC
TCCCCAGAACACGCCCTTTCACAGTAATAACTAGCATGATTCCCACCTGCTCCTCACCAG
CTTTCAGTCTATGTGACTTCAAAAGCTTAGCAGCCTGAGGAAGCCATGGAATACCAAGAA
GATCTTCTAGTTTGCCAAAAACTGAAGAGAAGAATATGCCAAGTGGTGCTTGACTCACGA
GGAAGGCAACCTAAAGGATGATAAAGTTCAGCACAGGTTCAAGCATGTGGTAAGCACTCA
TATTGGAAGCTAGAGCCTACTACTGGGAACAGATATATATATATATANNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNGAACTTGTTCCTTATTGCTTTAACCTGGGAGGAAGTATTAACC
AGCACCCAGATTAATTCCAGGCCACCAGAACTTGACACTGTCACCACTCCAAGTCCTCAA
CTGTGGAGGGAATGATTAAGAACAATATCCACCTCTGGTAGCGTCAATAACTGAGATAGA
GAATGTTTAAGAAACTTTCTTTTGGAATGCTAAAGGGGGGAGGAGGGAGAAAGATAAGAA
TGAAGGGGACTGTGACCAAAGCGATCAATTTTTGGCACCCCCAATATATCCCCCACACCT
CCCAGGGGTGATCCCTGAGCACAGAGTCAGGAGTCAGCCCTTAGGACCGATGGATGTGCC
TCCCCTCCAAAAAAAAATGTGAGGGGGCCTGGGGATGACTCAGTGGTAGAGCCTTGTGAG
ACTATAAGTTCAGACCCTTTAGATCATGTCATCTAAGTGGTCACCTAGGATGTCTGGCAC
CCCAACAGTGCAACCCCTAGCAAGCTCCACAGATAAGCAGAGTAACCAAGTATCAAGCAC
TGCAACCAAGTATCAAGCACTGATGGTGACAAAGAAAAGGGAAGATAATGAATGAATGTG
ACCAAGCAGAAACCAGAGAGGACCTCCAGAACAGAGTGGCAGTCCCAGCCTCTGAGACAA
GTCAGCCATTTCAGGGAACAACGTCCAGAGAGAATGACAACTTTTTTTTTTTTTTTTTGC
TTTTTGGGTCACACCCAGTGATGCTCAGGGGTCACTCCTGGCTCTGCACTCAGGAACCAC
CCCTGGCCGTACTCAGAGGACCATATGGGATGCTGGGTATCGAACCCGGGTCAGCCGCGT
GCAAGGCAAACGCCCTACCTGCCGTGCTATCACTCCAGCCCTGAGAATGACAACTTTTTA
TCTAGTTCCTGAGCAGTTCAGGTTTCTGAGATGCAAGCAAAGTAGCAAAACACAAACTTA
TTTTAACAAATACCCATGCTCAGGGCCAGAGGGGTGGGGAGTAGACCATGCATTAGGGCG
TGGGTTTCATCCTCAGCATCTCATTAAAAACATTACCCAAAAAAAGTTAATAGTAGCCAG
AGATATGTTTTAGTGATACAGACATGCTTAACATAATGGAAGTCCCAAGTTCCTGGCAAG
GCATGTGCCTCCACCCCACTACTCCAGGTGCCACTGGACCCTACCACAAACTATCAGGCC
TGCACTGCCAGGCTAAGCATCACTAGAATTGGCCCTGGACCAATTCACCCCCAAGCACTG
CTGGGTATGGACGTCATAAATTAGACATACCTATATACCTATATACTCTGTACATCTCAG
TGGTAGTGTACCATACTTCAAGAAAAGTTTTCCCTCCCTCCCACAAAAACTTGACTCTGA
CACCACCTGGCTCCCTGGAGCATCGCCAGGAATAGCCCTGAAGTCTCTCAAGAACCACCA
AGGTGGCTCTGGTGATCTCTGGCAGTACCTCTTCATGCCTTCATATTGAATGGATGGTCT
GGTTAGCCAGGTACCAGCCTCGCTCCCTAAACACTGCCTGGGAGGCCCCCAAAATTAAAA
AGAGCAAGCGCATGGGAAGTGCCTGTCTTTGCCAACATGAGGCCTTCACTTCAACCCCAG
GTATCATCCCCGTGCACAGAGCATATTCCTCACAGCTCTGCCCCTGAAAGGGCTGAGAAT
GTTATTCAGCAGCAGGGCACTTGCCTTACATGTATAAGGCTAGGGTCCAATTCCTACCAA
AAAAAAATCTTAAACATTTCAAATGTTTGAAAATTCAAAGTGATAGAGTATGTTGTTTCT
AATAAGTGTTTTTCTTGCTTATTAGGGAGTTATAGATAAGTTTCAAAATGCTACTTAGGG
GGTTGGAGGGATAGCACAGCGGGGAGGGTGTTTCCTTTGCACGCGGCCGATCCAGGTTCA
ATCCCTGGCATCCCATATGGTCCCCTGAGCACTGCTAGGAGTAATTCCCGAGTGCAGAGC
CAGGAGTAGCCCTTTGGCACTGCTGGATGTGACACAAAAAGCAAAAACAAAAAAAAAATC
AAAATGCTATTTAGTTGGCTGGAGCAATAGTACAGTGGGAGGGCGTTTGCCCTGCACGTG
GCCAACCAGGGTTCAATCCCCGGCACCCTATGTGGCTCCCTGGGCACCGCTAGGAGTAAC
CACTGAGCACAGAACCAGGAGTAGCTCCCAGCATATATATACATACATGTATATATATAT
GTATGTGTATATATATATATACATATACACATACACATACATACATATATATATATTGCA
GTCATTACACAGACTGTTATTTCCCACGGAGCCAATGTACACTATCTACAAATAGCAGCC
CCTGTGGGAGTACCTACTGCCTGTTTCTGGCATAGGTTGCCCTCAGGGACCTTGGAGACA
GTCCTTTGTGATGGATATTCATTTCTGCCCTAATGCTGTCCCCAATCTTAGGCTCTGGAC
AGGTGTGGGGAACCATTGGAAAGTACTAGGGTTTGGTGTCCAGTATCCATATTGGACACG
TCATCACATTCATCTACACCAAGCTACAGAGTGAGGAGCGTGTGAACAAGGCTCTATGTT
CAAGTTCAAGTTCCCTGACTGCCTGGAAATCCACATCTCCAAGAAGTGGGACTTTACCAA
GTTAAATGCAGATTGAATCCGAAGATGTGAACAGTGCCTGACCATGGACCTTGGGCAGAT
GGTAGGCACTGACACCGGAGAGCCCGGAGCTGCCTGGTCTGTTTCTAACCTTACACCATA
AATCCTGCTTCCTATCAATTTTTTTTAAATGTAGGAGTACTGCTATTTATTCAGCCATTG
ATTAAGCCGATTGAATTGGGCATGAACTCCCACATTACTTAAAATTTTTTTAAATTGGAT
ATCTGTGAGATAGACCATTACAAAGCTGTTCATAATTGGGTTTCAGTCATACAGTGATCC
AGCACCCATTCCTCTAACAGTGTACATTTCCCGCCACCAATGTCCCCCATCTCGCCCTCA
CCATCCCCCAGCCCCACACCCCCTACCCCAAGCCTCCCTTTATGGGAGGCACTTTCTTTC
TTGCTCTCTTTTCCTTTTTGCATTATGGTTTGCAGTAAAGGTGATAAAAGGTCATGGTGG
GGGCTGGAGCAATAGTACAGCAGGTAGGGCATTTGTCTTGCATTCGGCCAACCCGGGTTC
TATTCCCAGCATCCCATATGGTCCCCTGAGCACTGCCAGGAGGAATTCCTGAGTGCATGA
GCCAGGAGTAATCCCTGTGCATCACTGGGTGTGACCCCCAAAAAAAAAGGTCATNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNGCGAGTTCAAACTAACTGCAGCTTTTTATCTCTTTCAGATTTATTTATGAGCCTCTG
AAGCTTACAGGGTGGCGCTGGAGTTGGTTTGTGGGGGTGACTCTTGGTGCTTTCAAGAGC
ATGGGAAGTGGGGGGAGGTAGCCCATCCCAACTCTGAGAAAGCCTGAAGATTTCAGTCAC
AAAACCCGCGTACTGGGGCTGGAGCGATAGCACAGCGTGTAGGGTATTTGCCTTGCATGC
GGCCGACCCGGATTCAATTCCCAGCATCCCATATGGTCCCCTGAGCACCACCAGGAGTAA
TCCTGAGTGCATAAGCCAGGAGTAACTCCTGTGCATCACCGCCGGGTGTGACACAAAAAG
TAAAAAAAAAAAAAGCATACCAGAATTTTCAACAGGTTATATCTTGATGGACTGGAGCAA
TAGCACAGTGGGTAGGGCATTTGCCTTGCACACGGCTGACCCGGGTTCAATTCCTCCACC
CCTCTTGGAGAGCCCAGCAATTTACCGAGAGTATTCTGCCCACATAGCAGAGCCTGGCAA
ATTATCCGTGGAGTATTCAGTATGCCAAAAACTGTAACAAGTCTCACAATGGAGATGTAA
TTGGTGCCTGCTCAAGCAAATCGATGAACATGGGGACAACAGTTCTACAGTGCTACAGTG
CTTTATCTTGATGAGGTCCGTTCTGAGACTTAAGAGTCAGGCCAAGGGTATGATGCCAAT
TTTGGATTGTGGAAGCAAGTGGCTGCCAGGGGTTCTGCTTGGGTGGGCACCAGGTCAACC
CGCCCCCTTCTGATATACCCTAGTCTGTTCAGCCATGCACAGGTCTGAGATTGTGAGTTT
TTGTCTCTTTCAAGATTTATCTATGGGTCTCTGAAATAAGGCCAATAAATGAGCTTGTAT
ACCTGAGCCAGAGTTTGTTTGTGGGTGTGGCTCCCACATATCTAACTTTTGGCCATCTAA
TTTCTTGGTAAACTTGGTACCAAGTTGTTGGGATCCAGCCAAAGGAACAGCGGCAATTTT
GGGGTACCAGAAAGCCTGAAGGCACCATCAAGCTGCTGATGCACTCGTCCTGCAGGTACA
AGTTGACCTGTTGACGGCACAACCCTCCCCCCACCCAATCAAAATTTTTAAGAGCTGTGG
GGAAGAGAATAATTGTAGGTAAAGAAGAAAAAAAGAAATCCTTGTATATGTGTGGTTGGA
ATGCCAACTGGTATAGCCACTGTGGTAAGCAGTATGAAAGTTTTTCAAAAACTTAAAGTT
AGAACTCATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTAGCTATCTATCAA
CACATTTCGGGGTATATAATATGAAATCCAGATCTCAGAGAGATCTGTACTCAGATATGC
TCAGTGCGACATCATCCACTATTTAATGATCATTATTCACCACAGCATTCTTCACAGTAG
GGCAGAGCGGCAGTACAGGGGGGAAGGAGCTTTCGTGGCAGTGGCAGTGCTCAGGGCTTA
CTCCTGGTAAGGGATCACTCCTGGTGGATCAGGAAGAGTGGTGCTGATATGGGGTGCCAG
GGATTGAACCTGGGCTGGCTTCATCCAAGTCAAATGCCCTACCCACTGTACTATCACTCT
AGACCCCTAAGCATATTTTTAAATGGAAAAGTAAAATAATCTCATGGAAACATATAAAAG
TGGTTGCCAGAGGCTAGAGAAGGAGGAAATGGTAGATAGTAATTATACAAGATGACTCAG
TCCTAGAAAGCTGTACAACATAGTCTATTGTTAACCGAATTATATACTTTAAAACTTACC
TAGGAACAGGAACAGTAGTACAGGAGTTAAGGCACTTGTCTTGCACATAGCTGACCCAGG
TTTGATCCCCAGCACTCTGCATGGTTCCCTAAACCCCACCAGGAGTGATCCCCAGTGCAG
AGCCAGGAGTAAGCCCTAGCACTGCCACTGCCAGGTGCCCCCCCCCAAACAAAAGATTTA
TCTTTCTTAAAGCTACAAAGTATTTCATTATGTGTATATACCACAATTTCTTTTCTTTCT
TTCTCTTCTCTCTTTATTTCTTCTTTTTCTTCTTTATTTTTTTTGGGGGGGGTGAAAAGT
GGTTGGACCAATCAGCAGTGCTCAGGGTTGTTGAGCATTGTATTGTTGGGATTTTAATTG
GGGTCACATCCACTGCAGCTTCATGCAAGGCAATTGTGATCTAGGGACCACACCTAGGAT
GTGGGCAGGTGTGGCCCCTATACCACAACTTTATTCATTCAACTGTTGTTAAGACATTCA
GGTTGTTTCCATATGCTAGCTATTAATGCATATTATCTTTTTCACTGGATGTTTTTAATG
TCTAGGGACTTGATGTTTAGAATTGGAATCTTTAGGTCATATGGGAGCTCTATTCTTTTG
TGTTTGCTGGTGTTTTGTTTTCTGGGCCACATCTGATGATACATTGTTACTTCATACTAT
GCATTTAGGAATCAATCCTGGTGTGCTGGAGTCATAGCACAGGGGGTAGGGCGTTTGCCT
TGCACACAGCTGACCTGAGTTCAATTCCTCTCCGAGAGCCCGGCAAGCTACCAAGAGTAT
CCCGCCCATACAGCAGAGCCTGGCAAGCTCCCTTGCTTATTTGATATGCCAAAAACAGTA
ACAACAAGTCCAACAATGGAGATGTTACTGGTGCCCGCTCAAGCAAATCGATGAACAATG
GGATGACAGTGCTACAGTGCTCTGAGGAACCATATAGGATACAGAGCATTGAATGCAGGT
TGGTCACATGCAAAGCAAGTGCCCTACCCACTGTGCTATCTTTCCAGCCTGAGTTTATTT
TGGAGACACACCATTCATGCTCAGGGCTTACTCCTAGCTCTAAGCTCACAATCACTTCTG
GTGAGCTTGGGGGATCTTGTGGGGTGCATAAGATGGAGCCCAGGTGGGCTGCATGCAAGT
CAAACTCCTAATCTGCTGTACTATTGCTCTGGCTGCTATTCTTGACTTTTTAAGAAATCT
CCTTACTGATTTTCAGAGGCTGAAGTAGGTGATATTCCCACCGTGAATGAGGGTTACTTT
CTCTACACATCTGCACCAACACTGATTGTTTAATCTATTTTGATGTATACATTCTCACTG
GTGTGAGATATCATTGTCACTTTGATTTGCATAGGTAGCACTCACTGAACCAATTTGGAC
CTAGGCTTTTAACTTGGGGAATTTCTTAACTGCAGTTTTAATTTCTTTCTTGTCATTGGC
CTCTTCAGTTTTTCCCATTGTTCCTAGTTCACTAAGAAGCTTGAGTCCATGAATTCATCA
ATTTCTCCTAAACTCCCCAGCTTAGTGAGACAGAAGCCTCTCACGATCTTTTGTATTTCT
GAGGTGTCCATTGTAACCTCCCCTCTCATCTCTCATATGACTTATTTGGGCTTTCCCCCC
TTTAGTGAGTAGCTAAGGGTTTGTTTATTCATTTGAATAGAACAGCTCCTGGTTTCATTG
ACCTTTTGTATGGTTTTTCTTGGTTTATATACCATGGACTTCTGGTTTTGCTTTGTTTGG
ATAGGGGGTAGTCTATTTTGGCTACACCCAGCTGTGCTTAGGTTTACTCCTGGCTCTACA
CTCAGGGGACCATATGTGGTGCCAGGTCACCTTACACACTATATTATTTCTCCAGTCCTG
ATTTATTAAATTTTATTTTGGGGGGTGTTATTTGGGAAGCCACACCCAACAGTGCTCAGG
GTCTATTCCTAGTCTGTGCTGCAGAGGAACTCCCGTCAACACAGTGATCAAATCAGACAG
CCACATGCGACACAAGCGTCTTAACCTCTGTACTGTAGCTCTGACCCTGTCTCGTGTATT
TTCTCCTTCTATTTACTTTGGGATTAATTTGTTGTTATTTTTCCAGTTTGTCATGCTCTG
GTTTGTTTTTTCTCCCCTCTATTTACTTTGGGATTGATTTGCTACTATTTTTCCAGTTTC
TCAGCCTATGAGATTAGATTATTGATTTGAGCTTTTATGTTTGTCTGATGTTCCCTGTAT
TGCTATGAACTTCCCCTCAATTCTGTTTCTTCTGTGCTCCATAGATTCTGATTTTTGTGT
CTGATGTTTGTATATTCATTCACATTTAGAGGATTTTTATTACTTATTTGGGGGGGACAT
GCCCTGCTGTGCTTGGGGCTTACTCCTGACTCTGCACTTAGGGTTCACTCCTAGTGGGGC
TCAAAGGACCATATAGGGTGCAGGAACTGAACCCAGGTCAACTGAGTGAAAGGCAAGTGC
CCAGCCTGCTGTACTATCTCTCCAGCCTCAAGGCAAAGCATCTTAATGATCAGGTTTTCA
TTACAAAATGCCAGAAACTGGATAGTGCATAAACAGTAGAGTACTTCTCAGTTGTGGAAA
TCCAAAATCATGTTGGCAGCATGTCACGTGAGGGCCTTCTACATCACAAACTAGTTTTCA
CTGCATTCTCACATCTCTTTCATAAGAACATAACTTCTTCCATTATTTTTTGGTTGCTTT
GGAGGTACACCTGGATCTGCACTCAGGAATCACTCCTGGCAGGCTTAGGGGATCATATGG
GATACTGGGGATTGAGGTCACTCAGATGCAAGGCAAACACCTTATCCACTGTACTATCAC
TATGGCCCTATAACTTCTTCCATTCTTAAGAAATTAATCACCTCCCCCAAAGCCACACTT
CAAATATAATACCTCTGGCATTAGTTTTTCAACATAAATCTTGGGTCTTTGGGTCATACC
CAGCGGTGCTCAGGGACTATTCATGCTGTGCTTGAGTGACACCTCACAGTTCAGGGGTGC
ATATATTAGCCACAAATTAAACCAGGATGGCTGCGTACAGGGCAAGCACCATTCCTGCTG
CATTATCTCTCCACCCTCAACATAAAAATCTTCGGGGGACACAAACCATTCATACCATAG
CCAAAATAAGGAAGATTGAGTCAGTCTCTACAAAGAGTTTTGGCCTTTACGAAGAAAGTT
TTGTGGGGCTGGAGAGATAAGACAGCGGTTGGGGTGCTTGCCTTGCACAAGGCTGGCTCA
GGTTCTATCCTGGCATCCCTGAGCACTATCAAGAGTGATTTCCTGAGTGCAGAGTCATGA
GTTACCCATAAGAATGAAGTTTGAAATGAAGTCTGGCCAGGGATGTAGCTCAGTGGTAGA
AGACTGGCTTTGCATCTCTGAGGGCTGGGGTTCCATTCCTAATGTGATTTTAAAAAATAC
TAAGTCTGTACTACCCTACTTACCTTTCCAGCCACCCCGTGTCCCTCTCTACTTCACTGG
GCACTTATCAGGTTCCAAATCAATTGCAAGCTCCTTGGGAACCCTCTATTGCTTCGTGTT
GCCTGAAAGCTCTTCCTGATGCCACTGGGTCCGTCCCACAAACTCCTTATCTTCAGTAAC
TTCGCTCAAACATAACTTCCTCTTTGAGATCCACTGAACCCTTGCAAATATGTCAATCCC
AGGAAAGGTGTGTCCATCTAGATAAGAGGTTTTTCTCACTGGCATGAAGTAGGGTTCAGA
ATCTGTCAATATTCTCATCATAACAAGAAAATGAAAAATCCAGGAGGAGCAAAAGCAATG
AGGGAGGCCGAGTGGTGTTCCTTCACAGGTCCCTGGGATTTAGCTCTAAAATCCTGAGAC
TTGGCTCCTGAGATTCTGAAAACTGGATGCAAGATGGGAGGAAAGGTCTCTGTCAGAGCA
GAGAGTAAGGGTATCCCATAGCTCTACTCGCTGCACACTCAGATCAAGTCTGCTCTCATT
TCAGACCAGGAAGAAAAAATACCCACCAGGTTTCCCCCAATTTTCTCAGAAGATGGGAAC
TATCCTGTGCACCAAAATAGCCATAAAAAGTACCAGGAAGCAGTCCGGAAGGTTTTGTTA
AAAACATGTAAGTCTCAAACACACACTCATCAAAACTGAAAACATGAAACCTAAGCTAAC
ACCACTGTTTGGATTGTGCCTGTCAAGTTGACAGGCTGGGACAGTGGAGGTTGGGATGGG
GAGGGAATATGAGAACACTGATGGATGGAAGTTGACACTGGTGTGGGTTAGTGTTGAAAT
ATTATATGTCTAAAACAACTATCAATAACTTTGTAAATTACAGTTCTTTAATGAAAAACA
AAAAAAAAACATGTAAGTCTATGGACCAGGCACCTGGAAGGCCGAGTGAATCTACCTGCA
TCTTCAGGAACAGCTGGGCCGGAACGTGACTTACGTGGAAGGGCACAATCCTTGCATGTG
TGAGGCCTGGTGTTCAGTCCATAGCACTGCATCACCCCCTGAGCACCACTGGGTGTGGCC
CCCGTAACAATGTAGCACTGTAACACTTTCTCCAGTTGTTCATCAATTTGCTCGAGCGGG
CACCAGTAACATATCCATTGTGAGACTAACAAGTCTCTGTTTTTGGCATATCGAATACGC
CACGAGTAGTTTGCCAGGCTCTGCTGTGTGGGCGGGATACTCTCAGTAGCTTGCCAGGCT
CTCTGAGAGGGATGGAGGAATTGAACCCAGGTCAGCCGCGTGCAAGGCAAATGCCCTACC
CGAAAGTCAGAAATAAGATGTGGTATGGTATGACTATAGGCAGGAAAGAACAAAAGCCAA
GATGAGAGTCTGAGAACAGCAAGGAGAACATAAACTTGAATTATGGCGTGACATGACAAA
ATAAAAATTGAATCAGACTTGGAAGATTTGAGTCTTGGTTTTGCCTTTTTTCTAATTGTC
TCCCTAAGAGGCAGCCATATCCTATATTAACCTTATTCATTTGCTGAAAAACAAAACAGA
CACCAAGAATGCCAAGCCTAGGGTCAGAGAGATACTAGAACAGATTAGGCATTTATGCGG
CCTACCTGGGTTTAATCTCTGGCATCTCATATAGTCCTTGAAGCACTGTCAGGAGTGATT
CCTGAGTGCAGCCAGGAGTAATTACCCAAAATCTTAAAAAGAAAAAAAAAAAGGCCAAGT
CTCAATCTTAATTGTTGTAAGGATCAAACTGAAAGTAGACCATTAGGAAAGTACTTTGTG
GACTGTGGGGAGGGGAGAACAAACACTAAAGGCTGGGGTCCCTTTGGGACAGCAGGCAGG
CTGTGTGATTCCCAGCAAGCTTCTGTAACTAGCTTCATGTGCCACAGGAAAGCCAGCAGC
ACACACTCGAATTGCGAACATCAGATAAAATGAGCTTTAGAAAAAGTATCGATGGGGCTG
GAGAGATAGCACAGCGGGAAGGGCGTTTGCCTTGCACGCGGCCGACCCGGTTCAAATCCC
AGCATCCCATATGGTCCCCTGAACACGGCCAGGGGTGATTCCTGAGTGCAGAGCCAGGAG
TAACCCCTGTGCATTGCCAGGTGTGACCCAAAAAGCAAAAAAAAAAAAAAAAAAAGTAAA
GTATCAAAGGGGCTGGAGCGATAGCACAGCAGGTAGGGTGTTTGCCTTGCACGTAGTCGA
CCCATGTTCGATTCCCAGCATCCCATATGGTCCCCTGAGCACCACCAGGGGTAATTTCTG
AGCACAGAGCCAGGAGTGACCCCCGTGCATTGCCGGGTGTGACCCAAAAAGAAAAAAAGG
AAAAAGTATCAAAGACGAACTATGGGCAGGGACAGTAGGCAGAATCTCCAAGGGATCACA
TTGTGCATGATGCCACTTATATAACATTCTTAATGAAAGGAATCATGGAAATGAAGAACA
GATGCTTGGCTACCCGATGGGGGAGATAAAGAGAGGCAATTTCAGCACGGCTGGTACACA
GGCCAACTGCCGTGGAGCACCAGATAGACACCTGTCTGGATCCGGTATCCCCCTCCTGCG
AGATGCTGCTACTGCAGGGAAGGAGGCAAATGTGAATCACTTCTCACTACTGCTTGTGAA
TTTGTAATTATCTTAGAGTTACATTTTAATTGGAAAAAGTACTTTCAGGCATTTTTCAAA
GTGTTCATGAATAAATATCTCTAAATAGTTATCTCTAATTATAAAATATTTTAAGGTTAT
TAGGGCGGGAGAGTACGGCGAATAGGGCCTTGCTGTGCATGCGGCTGACCGGGGCTCCAT
GCTGCCCCCCTATGTGGTCCCCTGGGCCCACCAGGAGAGATCACTGAGTGCAGAGCCTGG
AGTAAGCCCTAAGCACAACTGGGTGTGGCCCAAAAAACAAACAAAAAGGGTGGGGGCTGA
GAACCTTCTCAAGATATTGGATGACTGGCGAGGGGTGTGGCTCAGTAGGAGGGCACTTGT
TTTGCATGAGTGAGGCCCTGGGTTCAATCACCACAAAAATAAAATAAAAAGCAACAGTGG
GGCGGAGGGATAGCACAGCAGACAGGCGCTTGCCCTGCACACGGCTGACTGGTTTCAATC
CCTAGCGTCCAATATGGTCCCCCAACTACTCCAGGAGTGATCCTGAACATTGGTTGTGCC
TCCCAAGCCAAAATAACTATATATAAATAAACTAAATATAAACAAAATAACTAAATATAA
ATAAAAAGCGGGGCTGGAGCGATAACACTGCAGGTAGGGTGTTTGCCTTCCATGCAGCTG
ACCCGGGTTCAATTCCCAGCATCCCGTATGGTCCCCTGAAGACCCACAGGAGTAATTCCT
GAGTGCAGACCCAGGAGTAACCTCTGTGCATTGCCAGGTGTGACCCCCCAAAAGCAATAA
ATAAATAAAGCAATGTATATAACCTGCCCATTCTGCAACCATCTAGTCCCTAACCAGGTC
TTCAGAGTGCCCATGACTGATGCTCAGAACTTCAGCTTCTGGCGGTCTCCGGCTCCAGGA
GTGCTCCCCGAAGAGACCATGCCATGGATCCAGAGCCCCCGCTACTGCCTCAGCAAAAGT
CCAATGACCAGGTCAGGCTGCGAGGGGTGCAGGGGATCCTAAGGAAGGGCTCCCCTCTCC
CATCTCAGAGGCTGTTTCAATCCATTCAAAGATAGAAACAAGGAAGAGGTTTGGATTTTA
CCTGGGGAAGCTGGTAAATTCTTACCCAGAATCTGGGCAGTGGTGGCATTCAAAGTGGTT
AATGATTTGAAGGATGACTTCTGAGCAGCACAGCCAAGAAACACGATTCCCTGTGTGCAT
CTCCCCCAAACTCTCGTCTCAACCCCTAGCGCCCCCCGCCCCAATCTGGCTGAGCCTAAG
ACCTTGTCTCTCTTTTCCAGATTTATGGATCACTCTCTTCTCAATGACAGAACCTTCAGT
CTATACTGAGAAGAACACAGTTGCAGAAAGACAAGATGGAGTCTGGAAGGAGGCAATGAG
GGGGTGTCCGGGTTCCCAGGACTGATGGGGCAGGGACCTTAAGACACAGTAAAGAGATCA
CACTGACGTCAGCTATGTGTACTGGGAGTGGGGCAGGGGGCGAGGAATGATTCCAGCACA
CGCCTGCGAGATCAGATGTGGGAGAAATACTCCATGGGGCACACCAGGAGTGTGGCTGGA
AAGGCCACCACAGGGGGTCCTGGCCTCGTGCACAGCAGGGGTCCAGGAGCACCGAAGGGC
CCTGCAGCAGCCCCAGGCAGAGAGAGGCCAGGAGAGCCTCCAGCCCTAGGAGTGCACCAC
CGAGCACCTGGCACCAAGTACAGACACTGCACACCCAGCCCAGAACCTGGGCTGGGAACA
CTGGGCAGAACAGAGAATTTTACAAAGAGTTTGATTTTATTGATATTTAAATATATTAAA
TATTTCACTGAAATACATGGTACCCCCCACAGTGGTTACATTAGAAAACCCAAGTCCGCT
GGCCCCCATGCACTGACTCCCTCCCCCACTGAGAAGGCGACCTGGGAGCCCGGCAGGGCG
GGGCTGCTGGCACTGTGGTGTGGGGAGCCAGGGCGAGACAGATCCTTCCCGTCTGGCAAG
AAGCAGACAAACAACCAAGGCCGGGGTCTTTCCATCCTGTCTCTACCAGAGACCCTTCAT
CACCTCCTGCTTCCCCCAGCCCCTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1079, 27544..27666, 30466..30610, 30920..30968
1001..1079, 27544..27666, 30466..30610, 30920..30965
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved