Sorex_araneus Locus SPTY2D1
snOPY snoRNA Orthological Gene Database
Sorex_araneus SPTY2D1
Sorex_araneus
SPTY2D1
GeneScaffold_1748
SNORA13
52259..52391
57262
TGGCTCTGCACTCAGGGGTCACTCCTTGCGGGCTCGGAGGACCATATGGGTTCCCGGGG
ATCAAACAGGGTCGGCCGCGTGAAAAGCAAGCGCGCAATTCGCGGTACCGACCCGTGACC
GGGTCTCTTATAAAGACTCCATTATTCATCCACGGAGAAGTTTGAGCTACGTGGAGCTAA
TTATCCAATTGCTGTTGTTGTTTTTTTTAATAAAAAATAGTGAGCCTGCGCCGCTATACA
GGGAATGTGAGCATCCGCGTGCACGAGTTGGAGCAAAGCGTGTCTAAGATGCGCTGAGCG
CCTGCGCAGCTTCCCGAACGCCTGAGAAACCCGTAACTGAAACTCCCTGGCGCGAGATCC
GTCGGTTCTGCAGCTGCGGCGACGTCACCGAGGCCTCGTGCGTCCACTGAGTGACGCCCA
GCGGAGTCAGGCCGGGCGGGTTCAGCCCTCCAGCCAGCCGGGGTGGCTCGCTCCTCCTAG
ACGCATCCCACCGTCAGCAGCAACCTAAAGCGGAAGGCCGCGCCCGCCAGCGGCGCCAGA
AAGCGACTCCGTCCCTTAGCCACGCCCCGCGCTTTGGCAATTCGCGTCCCCATTGGTCCG
TGCATGGCCTTCAGCCCCGCCCCGCTGCGGGGCGGCCGCCAGCCGCCACGTCTGACGTTC
CTACGTGTCTTCGGTGGGGGTGGCGGGGGGGGGGGGGAACCCAAAGCGGAAGTGACGCCA
GGGATTGGCAGGCGAGCGGGCGGCCCCGAGCGCCTGCTGCGGGCCCGGCTCGGGGAAGGA
GGCGGGCGGACGGCATCGGCCGGCGCCGGAAGTGGTCGTGCTGGGGAGGGGGAGAGCCGA
GCGCTCGGTCGGGCGCTGCAGTTGGCTGGAGTCGGGCGCCGCGCTAAGGCGCTGCTGCGC
TCCCCGGCGAGAGAGAGAGCGAGCGAGAGAGCGAGCTAGAGAGAGAGAGAGCGAGTGAGA
GAGCGCGAGCCCGGCCCGGGTCTCCCCGCCGCTCGGCCGCCGTGGACTTCAGGGAGATTC
TCCTGATCGCTTCCAAGGGGCAAGGGGTCAACAACGTGCCGGTAAGGTGCCAGCTGCGAC
GCCGCCGGCGTCCGGAGTGGGGGGCGGGGGGAGACCCCGACCTTCTAAGTTGAGAGGCGC
AGCCGCTGGCGAACTCCCAGGGACCCGGACGCCCCCCGCGCCCCGCCTTGTTTCCAGGTG
TCTCGTGGTTGTGGTTGGGGGGAGCCGGCGTGCAGACGAGGGCAGAGCTGCCCATGTCGC
CACCCCAACGGCGCTCTCTTCTTTTGGGGAGGGCTCGAGGTCTCAAGTTGTGAAGAGCGT
GCGTGCCGGGACGGGGGAACCAGCGCCGAGAGTTTCTCCGCGCGGCAAACTCATCCCAGA
CTCGGAGGAGCTGACCTGGGGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTTTTTTTAAA
TGTGTACACAGTATGTACAGCTGCAACTTTAGTGCTTGGTTCTTTTAACCATCTTTTCTC
CCATCTTTCATTTGGATCGTTATTAGAGCTGTCACAGAAGATTTCAGACTTTAGAGTTCT
TATTTGAGATCTTTATTCTGGGAAGGAAAAAGATTACTAGTAAGCTTGATTGGACTAAAA
TCCAAGGAAGACTGCAATCTAAAATACCTGCTTGTAAAACCACTTAAACTTGACTTTTCC
AGGACTTTATTTTCAAGAGGTATACATAGTATCAGCACAAGAAACAATGATCATTGCCCT
AATGGGACATCTTTTCTATTCTTTCTTTTTGGTTTTGTGGTTTGTGGGGCCATACCTTAG
GGTGCTTAGGACTTACTCCTAACTGTGCTCAAGGGTCACTCCTGGTGGGGCTTGGGGGAC
CATTTGGGGTGCCTGGAATTAAACCTGAGTGTGGGTGTGTACAAGGCACGCACCTTTCCT
GTACAATCCCCCAGCCTCTGTTTGATTGTTTTTTTTTAAAGAGCGTATCTCTATAATATT
ATTTGGGGACTACACTCTGTGATGCTCAGACTTACTTCCAGATCTGCACTTAGGGGTCGC
TCCTAGCAGAGCTTAGGGGATCATGAGGTGCTGGGAACCAAACCTGGGTTGACCATGTGT
AAAAGCAAACACCTTCCCCACTGTAATATCTCTCCAGCTCCCTATAATTTATTCTAAAGC
AATCATGGGCCTAGAAATCATTCAAAGGGCTGAATGAAGCACCTGCTTTGCATGCAGGAG
TTCTGGGTTCAACATCAGGCTCCATGTGATCTCCTGAGTACTCCAGGAGTGACATAAATG
CCCCCTACCCCCACTCCACACACACACAGAGAAAGAAAAGATTGCATCATGCCTAGACAT
ATGAAGTGGTATCTCCCAGTGGAAAACTAAATAACAAATAACTGGTCAAGATGATGCAAC
TAGTCGTTGTCATTAGCAGTTTGTATTTTAATAGATAATTTTGGTATCATTGCACTTAAG
ATTTTTGTCCCTGGGTTTCTCCAAAAGTGAAGGGTTCTCTTGATACGATAAAATGGTAGA
CCTTAGAATATGGATTCTTTTTGTTTTAAGTAACTCAAGTTACCTGTAGTAAAAGTTAAC
ATGAGACAAGTTCCATGTTCTCTTAGTCTGGAAATGACCCCAGACAGGGTCTGCTGGTGT
GACTCTTCATTCAAGAGTAAAAAGGAAGTCTTCTTGTGGTTACTGAATTTATAACAATTT
GGGGTGCTAGACTGGATAGTATAGGAGGTAAGGTACTTGCTTTGCATGTTGCTGACCCAA
TTTGATCTCTGGACTGCATATCACTCTTCAAATCAGGGTGTCGGGGCTGGAATGATAGCA
CAGCGGGTAGGGCGTTTGCCTTGCACGTGTCCAACCCGGTTCAATTCCCAGCACCCCATA
TGGTCCCCTTAGCACTGCCAGGAGTAATTCCTGAGAGCATGAGACAGGAGTAACCCCTGT
GCATCACCAGGTGTGACCCAAAAAGCAAAAATTAAAAAAAAAAAATCAAATCAGGGCACA
GACCCAAGAATAGCCCCTGAGTACCTCCAGTTGTGACCCCAGCAACCCTTCCCTAAACAA
AAGTAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAGCCAGGAGTAAACCTTGAGAATCTCTG
GATATGACCCCTGAAAAACCAAAATAAAACCAAAAAGATCCTTTTCCCAGAAAGAATAGA
TAACTGCCCCGCCCCTCAAATAGGATAATTGCGTTAAAAATTCCTCAAATTTTTAGTCCT
TGGAATTTTTTTTTTCATCCCTAGACACTGGACCCAGGTGAAAGGCATCAGTTGGAAAAT
AGATCTAAAGAGCTCTGATTTCCATCTTTAAGGACACAGGAGACAAACTGAATCAGTTAT
CTAAGCCTAAATGCCGGTCTTCCAGACTATGATCAGAAACAGAGGGACCCAATTACCTCC
ATCCCATATCCATCTTAACTACAGCCCCACCTTCCAAATCTCACTGTTCCTGGCAAACAG
AATCCCATGTCTTCCATCTTTCAAAGTGCTTAACTGGACATAAAATGTGACAACTTGGTA
TGCAATTTCTTTATGTGAAACCAACAACAGAAACTCTTTGTAGCTGGTCAGGTGAGCTTC
AGAGCTGCATTAATTCACCAGGATCATCTTTGTTTACTTCCACCGGTGTCGTCTGGGGGT
TGGGAAAGAAGTAAATCAGATGGATCTTGCCTACACTTGGCTAGACTATGGGGTTGAAAT
AAGTGTTCTCCTTGCCAAGGGCCTATCTATGCACGGGTGATTGTGTCTTCCCCTAAAGCC
TCTGATCCCACTGCCAGAGGGGTTTCACAGTATGGGAACTGTCAGGAGTCAGAGAAAGAC
AAACATCCAAAATTGAACAGGAGACAGGAGAGACATCTGCCACCAGAACCATTTCACAGA
CCAGTATTGCCTTAATGGGAGTGAAGAGTGGGCTGAGTTGGGCTCAAGTATTGTAGGCCC
AGTACACAGAGTCAGGTAACACAAAACTAGTGCCAATGACAGAAAGCTCCGACTTTGGGT
TTGAGATAGCTTTACCTTCTACCTCCAGTTTATTATAAAAAAAATAATAATAAGGAATTT
AAAGGAATAAAGACTTATTGGAGGTGGGGCCTGAGTGACATTACAGCAGGTAAGGCGCTT
GCCTTGCACAGGACGACCCCATATCAATCCCCAGCATCTCATATGGTCCCCCCAACCCAA
GCCTTCCAGGAGTGATCCCTGAGCACAGAGTCCGGCGTAAGTCCTGAGCACTGCTGGATG
TGACCCCCCCAACAAAAAAGAGCAAAAATAAAGACTTTAATTGGTCTTCCATTAAAAGAC
AGTAGGACTCTCCCAACTCTATGTAGATTGTAAATAATAAGTGTTATGCCATATTAACTT
CTTCTCTAAGGAGAAAAACATTTGTTCTTGAAGTTACTAGAGTTGGGTTTTTTTTTAAAA
ATATTTTTATTTATTTATTTATTTATTTATTTTCTTTTTGGGTCACACCCAGCGATGCTC
AGGAGTTATTCCTGGTTCTGCACTCAGGAATCACTCCTGGTGGTGCTCAGGGGACCATAT
AGAATGCCAGGGATCGAACCTGGGTCGGCCGCATGCAAGGCAAACGCCCTTCCTGCTGTG
CTATTGCTCCGGCCCCTAGAGTTGGGTTTTGATAGCTCATTTCTCTGGGGGAAATACATT
TCAAAGCCAGACAAGAGAGTAAAGGCAAAGGTATACTTACCCCTGCAGGGGGATACTTAT
ATCCCTTCCACATTGTTCCGGCAATGAGAATCATCCACAACACAACAATCATGGCAGGGC
TTCTGGCTCAGCTGATGGTTGTGTGCAAGGAGAAATGGGTGGTTGTGAAAGGTGAGGTGT
TCTAGTCCCCGAGTCCTGGGAACTCGGCTGTCTTCATGCCAGACCTGATAGTGGGCGGTC
CAACATGATAGCTCCTGCCTGAAGAGCTGTGTGGTCTAGTCTGAACTTCAGTGACTTGCG
ATGGCCATTTGAGGTGGGGAGGGGGGAGGTGCCAATTATGACATCAGCTCTTGTGACCTT
AAGGACCAGTCTGGGTAAGCAGCAACTATGAGACAGCTGGTGAGGGGTCAAGTATGATAG
GGCTGAAGAGAGGCTTGTTCTCCTATGACGGATTAGGGTCCAGAAGGTACCGCTGCCAAA
TGAGGACTAGCTTTATAGAATCAGATGAAAAAAAAAAAAAAAACACCAAAGGGGCTGGAG
AGATAGCACAGCGGGTAGGGCATTTGCCTTGTATGCGGCTGACCTGGGGTTCAATTCCCA
GCATCCCATATGGTTCCCTGACCACCACCAGAGGTAATTCCTGAGTGCAGAGCCAGGAGT
GACCCCTGTGCATCACTGGGTGTGACCCAAAAAGCAAAAAAATTAATTGGGAGGATTAAT
CCTGGCGAGGCATACTTACCAGCAAAAACTTTAATACTATTCTGAGATTATTCAAATAAG
AAAAATTGTGTACTTTTGTGAAATGGCATGGTTTAAACTTATCAAGCAAAGCCAATCTCA
CTACTTCCTGAGGAGGGACGAGAAGGAAAAGGGGGTCTTTTGTGCATATCACAGCTGGAC
AAACTGGTGTTTTTTGTTGTTGTGTTGTTTTGCTTTTTGGGTCATACCCAGCGATGCTCA
GGGGTTACTCCTGGCTCTGCACTCGGGAATTACTCCTGGCGGTGCTTGGGGGACCATATG
GGATGCCGGGGATTGAACCTGGGTCGGCCGCGTGAAAAGCAAATGCCCTACCTGCTGTGC
TATCGCTCCGGCCCCAACACAGCTGGACAAACTGATTCACAGATTAGTTTCAGTGATTTG
GTCAGGATCACAGAATGTGGCAGTGGTTCACCTAATTAAATATGCAGTGCAGAAGGATAT
CCATATCTCCACCCGAAGTGAAGTCTGTGTTGGTACAATATTCTCATAGAAATTCTGAGG
CAAGTGGAGATTAAAAAAGAAAGAAAGAAAGAAAGAAAAGAAAGAAAGAAAGAAAGAAAG
AAAGAAAGAAAGAAAGAAAGAAGAAGAAAGAAGAAAGAAAGAAGAAAAGGAAGGAAAGAA
AAGGAAAGAAAGAAAAGGAAGAAAGAAAGAAAGAAAGAAAGAAAGAAGAAAGAAAGAAAG
AAAGAAAGAAAGAAAGAAAGGAAAGAAAGAAAAGGAAAGAAAGAAAGAAAGAAAGAAAGA
AAGAAAGGAAAGAAAGAAAGAAAGGAAGAAAGAAGAAAGNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNAATTTAAAAGGGTTGTTGTTGAAAAGCATTGTTGAGGCT
ATATGTTCTAACATGTTCCTGTTGGTGTATCAAGTTGATAGAAAGCTAAGGACAATGCAG
AGATTTTATGTTTATTTTTTATTGATTAGGAGTGGGGGCGAATCTGGAGAGCATGGGAAA
CGGTGTTAGATAAGTTAGATGGGGGCATTTGGGAAAGGTAGAATTTTACCCGAGGTCAGG
CTCATAATAGTATTAACACTATTTACGAGGGGTTTATCTCTCCTCACCCAAACACGTGAC
TTTTGTATCACTAATATTCTCAGAAATTGTCGTTAATAAAGTGAATATGTGAGAAGAGCA
GTTCTGAATATCAGTTGGGATGCAGATACCAGGAACACTGGCTGAAAGGGACACTGCTAG
AGATGTTTCCTAGAGGCAGGCTGGTCCTGTGGAATTTGGAGAGACTATTAAATGCAGAGA
TCTATGCTTGTAACCCAGTTTCACAAATGAGTTGATTTATGGGTAACTGTACCTATCAGC
TAAATTGGCATTGGATAATAGTTAAGTTTGCTGTCACAATAAGTCTTTGTTGATAGGTTC
ATGTTTTGCTTAGTTGTTAAGTTAGCATTTATAAAACACTGTGAAGCTATGTTATAAGAT
GGGCTAGGGAGATGGTTGGTGGTAGAACAAATGTCTTGTATGTTAGAGGTGCTGGGTTCA
ATCCCAGGCACTGCAAAAATCAATCAACCAATTAATTAAAGACATATATTCTAAGTCAGC
AGAGACAGAGAAGGGAATACCTAGTAGAGAATGTTGGGAGGACCCACTCGAGTTGAAAGC
TGCATGCCAAAAGTAGACTATAGACCGAACATAATGGCTACTCAATACCTCTGTTGCAAG
CTACAACACCCAATAGGAGAGAGAACAAAAGGGAATGCCCTGCCGCAGAGGCAGGATGGG
GTGGTGGGGGTTGGGATGGGGTGGTGGGAGGGATACTGGGATCATTGGTGGAGGAGAATG
GGCACTGGTGGAGGGATGTAAACTAAATACAAACATGAAAGTTCATAAGTTTGTAACTTA
CCCCACGGTGATTCACTAATCACTGTCATCCCATTGCTCATCGATTTGCTCGAGCGGGCA
CCAGTAACGTGTCTCATTGAGAGACATTGTTACTGTTTTTGGCATATCCAATACGCACAG
GTAGCTTGCCTCGAGGGCTCGATACTCTTGGTAGTTTGCCGGGCTTTCCGAGAGGGACAG
AGGAATCGAACTCGGGTCGGCCATGTGAAAGGTGACCGCCCAACCGCTGTGCTATCACTC
CAGCCCAGTGATTGACTAATAAAATTTTTTTAAAAAGACATATATTCTATATAAATCCAC
AAATGTAATCCTCACTAAAATAGTAAGATATTGAGATATAGCTGTTACACAAATGAAAAG
TATGAGACTGGAAAGATAGAACAATGGGTAGGGCATTTTCCCTGCATGTGGCAAACCCAG
TTCGATCCTTGACCTCTGATATAGAACCCCAAACACCACTGGGTGTAGTCCATAAAACAA
AACAAAACAAAAAAAACTGACTCAGAGAGGTTAAATTTTCCCAAGATCACATAGCAAGTA
AATTGCAAGTCAGGACATCAACTCAATTCATTTTCAGATCTGTCAAAAGGGACAGTAAAA
GTGCCAGTCTACAAAATTTCCATGTTTTCAGGAAGTCGGGAATGGGCTACCTCACACCCC
ATCTCTCTGTTCTTCTGGAAGCCTGGTGGTCATGCCAAGGAACTGCCTCTGGCGCCATAT
AATCTCATTAACTGACCTTGATCCAGAGACTCATAAATAAATCTCAAAAGAGATCAACAA
GCTGTAGAGCTGCTTTTGGACCTCAAAATCACCATCCAGATAAAAATTTTACTCCAACTG
TATTACCTCATTCAAAATTTTAGAATTCTTAGAGCCATCTCAAACTCTACACCACTGATA
TACCAGAAGTATCACACCACATTGGATGGGATGTAAAGCAGAAGGCAACCAATCTCGATT
ATGAAAATATTAACATGTAAGGATTAACCTGTAACATGTTAATAATCACTTATATAAGGG
CTTAACAGTTCCAGGGTGAGATACATAATCTTCATACACTTTCTTCTAAGGAAATCTTTG
TTGATCATTTTTAGCAAATTATTTTTTATAATTTAGCAAAATATATAATAAGCATTATAA
ATTGTTTAGGGACTGCTTTTGGGGCATTCTTGGGTGGTAATTGGGAAAATTGGAAATAAT
GAGGGTAGGAAAGTGTAATGGCATTGGGATTAGTGTTGGAATATTGAATGTAATAAATCA
TGAACTTTATAAAAATAAAATAATTTTTTTAAAAAAGTTCCAGTTGAATTTATTATAAAG
CCTATGGGAGAAATAGTAATTAGAAACAATCCTTGAAAAGGATACTGATGGGGGCTGGAG
CGATAGCACAGCGGGTAGGGCGTTTGCCTTGCACGCGGCCGACCCGGGTTCGAATCCCAG
CATCCCATATGGTCGCCTGAGCACTGCCAGGAGTAATTCCTGAGTGTAGAACCAGGAGAA
ACCCCTGTGCATCGCCGGGTGTGACCCAAAAAGCAAAAAAAAAAAAAACAAAAAAAAAAA
AAAAAGAAAAGGATACTGATGAGTGATTATTATCAAATCTTTGAACCTGGCTTACTGACA
CTGGCAGTATGCACAGAATTCTTTCTCCAAGTATTTCAATCATTTCCCCTTTTAGAGTGT
ATGTGGTCTTACAAGGGTCAAATGTGCCTCATGGTGGTTGACATGCTGGAGTTTGTCCCT
GTAACTAAAGACCTTTGGCTCACCACTGGGACTGGACACAAATTACGATTTGCATATTCC
TCTCCCATGGGACTCTGTCTGGGGGTGTACCTGCATGCACCCAACCACAGCCAGGTAGGA
ACAGGGTGCGTTTCGGGTCTTATGCGGGTGCAGATATGGGGAGAGCCTCTGGAGACTGAG
TACATGTCAGCTCATCACACCAGCAGTTTCACACGTTACTTGTATCTATGCTCTGGCTTT
CTGCCTGGGGGAGAATGCCCAGGGATCCTGCATGCAAAACATATGCTCCAGCCCTCTGAG
CTGTCTCTCCTGTCCCATATAGGGCAGTGAATTAGTATAGTGACATATATTAATATGTTG
ATGTAATTTGGTTTGGGCTGCAGCACAGCGGTAGGGCGTTTGCCTTGCATGCTGCCACCC
GGGTTCGATTCCTCCACCCTTCTCAGAGAGCCCGGCAAGCTGGTGCCCACTTGAGCAAAT
CGATGAGCAACAGGATGACAGTGATACAGTGATATATTTCCCAGAGGAATATAAACTCTC
TCGAGATATCAAGCTGCTACCAAGTTTTCTGGAAATGGAAGAATCCAGCCCTGACCACCC
ACTCACAGTGACCTGTTGGGGATGGACTGAGCTATCAGGGTGAGCCCACGTAGACTGTAC
TACAGACAGGAACATTTTCCCCCTTCAAGCTGCCTTCAGAAAAATAATTTCAGTATATTG
AAAAGAGCAGTTTTCCTTCTCTCACAGGAACCCGGCTGGTCTTGACATGCAGNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
CAGACCCTGAGGAGGTTGGATCCCTCCCCATGAAGCTCCTCTAATTCCCTCACCTCTCCC
TTAAACTGATTAAAATGTGATCCAGACTATAAAGAAGACCATCACCACTCCCAACCTCCC
TGGTAACCTTCTTAGCAACGGACTTTTACCTGGGAAGAAGCCCCCACATGGGGGTAGGTT
GAAGAGACCCTATAAAAGACACCTTGAACAAAGGAAGTGCGCGCATATGCTGTCTGAGCC
CATGTGCTGCTTGTGCCCACGTGGCCGAGCACATGTAGTGCCCGAGCACATGTAGTGCCC
GAGCACATGTGTCGCCCGCATCTCCCCCCTTGAGATGTGTACTTTCATGCTTTTGTGTCC
AGTGCTAGGATGTGTGTAGAGCTTCCTCCACCCTTGGAGAAGCCCATGTTCTCTCTTGAG
CGCCTTATTCTTACTATTCTCTCTCCCACTTATCTCTTCCTCCTTCCCTCAGAAACCTCT
AAATAAAATCTGTTTACTTCACTGCTTGTCTACTCCTGAAATTCTTTTCCTCGAGTGAGA
AAAGAGCCCAGTAACTCTGGGTCCCGGGTGGTAGAGGCGGTTGGGGAGAAAGTGACCGTC
TTTCTCCTTCTGCTTCACATAAGTCACTCATGGGGCCCACCAACATCAACATGAAGGTCA
TCGAAAGGTCTCACCAATGCCGACATTCCCATTACTACCAGCAACCGCTGGTTTACTTAG
TATGAAATCTGGAAATCAGGCATGCTTTCTTTCCAGCACACATGTATACATTCCATAACA
CAGTAAGTGATGAACCCCATGGGGGATGGGGCATCTGGCAGACAGATATCTCAATCTGAT
GGGAAGCAGTCTGGCAATTGAGGATATCACATGCTCATTTCAGATTAATGGTAAGATTTT
TAACTCTTCCCCATTTGATCAGAAATCCTGATGGAGGGTAAATGAGGGCTGGGATCTATA
GATAGGGTCATTACTTACCATCAACTCTGGAAATGTGCCCATGTACCATGCTAATCTAAC
TAAAAGCATCCAGCCAAGAATGATCATAATAAAAGGTGAAACCACCACGGTGGAACAGAC
TACACAGGAAGGAAGCCAGGTTGAAAGGGGCTGTGTTTGGAAAAAGGAGGAAATAAAAAT
TGGAATAAAATCCATCTGCCTTTAAATTTCTCTCTGATTTAGCCTCTGATTTAGTCCTAA
GTGCTCAGGGAAGAATTACCAAGATCTTGGCAAAGGAGTATGCTCATGAAACTCTAAGGT
GGTACAGGTGTCACATGTCAGCTCCTATCCTTGGCTCCAAGCTAGTTAGTGGAGAAGCTG
GAGTCCAACAGGTATAGAGACATCAGTGACCTACTGGTCTCACTGGCCAGGTCAAAGATA
TCACCCCTACACCTATGGTTTGGCAGCTGGCTAAGGTCCTCGTATATATTATATCACAGA
AGCAATATAACACAAGAACAATGGTCCTCCCATTTCACTAATGAGAATACTGCAGCTTAG
AGTCTAAACCAGCATTCTTTTTTTTTTTTTTTTTTGCTTTTTGGGTCACATCCAGCGATG
CTCAGGGGTCACTCCTGGCTCTGCACTCAGGAATTACCCCTGGCCATGCTCAGGGGACCG
AATGGGATGCCGGGGATCGAACCTGGGTTGGCCGCGTGCAAGGCAAACGCCCTACACGCT
GTGCTATCACTCCAGCCCCTAAACCAGCATTCTTCTACCTTTCTACACAAACAGACCAGA
ATCAATCCACAGACCAATAGCTAAAGACCACTGGTCTAAATGACCTGCACTAAGTGTCAC
AGCTGAATCTCCAGGTCAAGGGCTGGGACCCAGCTGCCTGTTAACAAGATGACCTATTTA
TTTTTTTTATTTCTCATTTGGGGTCACACCCAGCACTGCTCGGGGCATACTCCTGAAGGG
TGTCTGGGGCACCATATGTGGCGCAGGGAATCGAACCTGAGTCAGCTGCATGCAAGGCTA
GCTTTTTACCCTCTGTACCATTGTTCCAGCCCCAAGGTAGACTCTTTAGATTAGAAACAG
ATATTAGGGGACATCCCCTCACACCTGCAGTCTATGAGATCTGTGAATAAAACCTGCTGC
TTTCTAGAAAAACGTTACACCTATTTCAGGCCCTTCCACCCTCCCCTCCATATGGAGAGC
TCTCATCACTTAGTTATTGGGCGGGGGGACCTCATAANNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNGAGTGAACCTATTCCTGACCAGGCGACACTTCATACCACACAC
CCTACCCATACTCCAAGAGTACCACACCACATTTGATGCAGTTCAGAGTAGTAGGCAACC
AATCTTAGATGGAAATACTTTTTTTTTTTTTTACAGATATGTATATAAAAGCACACAAGG
CTCAACCTTTAACAACATGTTAGTGATCTCTTATAGACGGGCTTAATGGCCCCTGGGTGA
AATACAACAATCCTCACCCTCTTTCCTCTAAAGGATACTTTTTTGTAGCATTTTCAATGG
TTTTTTTAATAACAAACAATACAAAATATATTATTTTGGTTCTGCTTTGGGACATGAATT
GAGGTCCAGGTTTGAAACATCCAAAATATGGTGGTGGGAAGGTATTGTGGTGGTGGGATT
GGTGTTTGAATCACAGTCACGATTATCCTGTTGCTCATCAATTTGCTCGAGTGGGCATCA
ATAATGTCTCCATTGTGAGACTTGTTACTGTTTTTGGCATATCGAGTATACCACGGGTAG
CTTGCCAGGCTCTGCCGTGTGGGCAGGATACTCTCAGTAGCTTGCTGGGTGCTCTCAGAG
GGGCGAAGGAATCGAACTCGGGTTGGCGCGTGCAAGGCAAACACCCTCCCTGCTGTGCTA
TCGCTCCAGCACGTAGGTGTTTGAATATTAAATGTACTAAATATTGTGAACTACTTTATA
AAAATATTTAAAAATTAGGGTTCTCCAGAGAAACAGAACCAGTAGGATTTGTTTTAAGGA
ATTGCTCACTTAATTGGCATAGGCAGATCTGAAATCTGGAGGCAGGCTAGCAGACTGAAA
ACTCTAGGAGTTTAATACTATTGTGTCAGGTAGAATTCTTTCTCTGGAGAAATCTGCTTT
TCCTGTGAAAACCTTCATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNAGGAACCTTATACCAGTGCCAGCCACAATGCAAA
TCCAGGCACCCTTACCCCTGCGTACTATATCTGACCTCCCAGTATTTGTTTCGACACAGC
AGCAGACACACGAGCCAGCCTGGTTGAGGAATGTCATCTGCTTAATTAAAATGAAAGAAG
GAAAAATGTTTGAAACGCATTTCTAGCCATGGTTTTAATGAATTTTAACTTTAATTTCAC
CCAAGAGATGACTCATCCTGGTGTGAGTTATTAGGTTTATCATACTTTAATAATATTGAT
ATTAATAATACTGATAAAATAGAACTTATTTCCTTTCAAAGGTCATTGTAATATTATTCT
AGTTTTACTCATCCTGTGATGCAGTTAAACAGAAAACAGAGCCCAAAGAATGCCATCTGT
GCCTGAATAATGTTAGCACTTTTTTGTTTTGTTTTGTTTTGGGGTCTCACCCAACGATGC
TCAGGAGTTAACTCCTGGCTCTGCGCTCAGGAATTACTTCTGGCAATGCTTGGGGAACCA
TATGGAATGCCGGGGATTGAACCCAGGTCAGCCATGTGCAAGGCAAACACCCTACCTGCT
GTACCTCTGGCCAGTTAGCACTTTCTGGGTGATAAGGAAATCTTGTCTAAAATAGTATGT
GTGTGGTCAGGGAGGTGGCTCAGGGGGCTGGAGCACTTGCTTTGCATACAGAAGGCCCTG
GTTCAACCCCTGACACTGAATGGTCCCCTGGATACTGCCGGGAGTGACTGCTGAGCAACA
GAAAGCTGGGAGTGGCCTCTGAATATTGCCAGGTGTGTTGCCAAAAAAAGACTGGGTGGC
AAGTTAATATTCAACAAACATAAGAGCTACTATTAAAACTTACAGGGAATTGAGTTCTAA
TTGCTGGATTTTTAGGGGGGTGTGCTGGGGCAAAAAGGGGCAGAAGTGGGAGTGACACCT
GGTGATGCCCTGGGACTATTTCCAGCACAGTGCTGCGTGGGGGACCAGGCAGAGCCAGGG
ATCTTCCCTTGTTTTCCTGTATCCAAGAGTGCACTCCTCATGTTGAGGTGTCTCTAAAAC
CTCTTTGTAGTTTTTTTAAAATGTATTTTAGGGACTGGAGATAGTACAGCAGGTAAGGCA
CTGCCCTTGCCCACAGCTGACCCAGGTTTGACCCCTGGTACCGCACATGAGATCACCTGA
GCACCTTCAGGTATAGCCCAAAAACAAAACAAAACAAAAAACCCAAAAAATAACGTATTT
TAAGTATGGTTTGTTCCCTAGCCTTTCCATGGGCAAGGTAAAATTTCAGCATTTCATGTT
GTAAGCAAAATGCGTGTGTAGCTAGGAGTATGTATGAGAAAATAATCTAGAGTAGGGAAT
TCAGGGAGAAAATGGTTATGTGTAGTGGTTTGTTTTTTTTTTTTGAAGTTAGATTCTGAA
ATACTTTGCTTTGAAGTTGGCTAATTTTTAAGTCAAGATTTTTTTTTAAGTGTTCTAAAT
ATTTTTCTTTTCTTTCCATAGTACATCTGTCCAGTTACATTTGGGAGAAAAATAGCCTGA
AAATAAGGTTTCTCTGAAATGTTCACAAAGACACTCTGCCTCTAAAAATAGTCATACATA
CTAATACCATAACAACAAGTCTCAAAAATGGAGACAAAAATGGTGCCCGCTCAGGAAATC
TATGAGTAACAGGGCGACGGTGATACAGTGATACATACTAATTCTAGAGTCGCGTATTTT
ATAGCTAAGGTTGAGTGTGCTGACCTGATTACTTCCCTATTGAAGTAATTCAGGGACCTG
TACTGTCAGTGCACATTTAAATCTCTCTATAGCTTGACAAACTGCCTTACACCTCTAACA
AACCTTACCGTTGCCTTTTTGTTCTGCTGTTAGTGAAGGGATAGAACCTAGGTCTCAGTG
TATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGATGAGTGTGTTGTTGTAATTCT
AGAAAAATTGAAATATGTCATTTGTTCCTTTTAGCCTTAGAGGAGAAAAGGAGAAAAGAA
GAACTAGTGAAAAAGCGAATTGAGTTAAAACATGACAAGAAAGCAAGAGCTATGGCTAAG
AGGACAAAGGACAATTTCCATGGTTACAATGGGATTCCTGTGGAGGAAAAGTCAAAGAAG
AGACAGGCAGTAGAAAGCCATCCTAGCCAGGGGACAGATCAGGAATATGAAATGGAAGAA
GTGGATGAATTCTTCGACTACAGTCAGGCAGAATCTGATCAGGAATATGAAGAAGAACAA
GAACCTCCCAAAGTTGAAAACAAACCAAAGGTCCCCCTTAAAAGTGCCCCGCCACTCATG
AACTTCACAGACCTCCTCAGGCTGGCTGAGAAAAAGCAACACGAGCCAGTGGAGATTAAG
GTAGTGAAGAAAATAGAAGAGCGGCCCATGACAGCAGAAGAACTTAGGGAACGAGAATTC
CTTGAACGAAAGCAGAGGAAAAAGAAACCTGAGACAGATGCAAGACTACCTCCAACCAAA
AAGGCCCCCTCTCAGAGAGAAGGTGTGGGCACAAAGCTTAGCAGAGCTTCTGGGGACAAG
CACCCTTCTTCCAAGGGTGGACCCCTTCCTCCTGCTGAGAAGAAACCCAGACTCAACACA
GTCCATGAAAAACCTTCATCCAGATCCATTTCAGGAGAGAGGACCAAAGTAGGTTCTGGC
AGTTGTTCCCAACGTTTACTTCGTGAAGGCCATGACAGAACTGTTTTCAACGGGGCCGGG
AAGCCCCATTCTAGCACCAATTCACCAAGTGTCCCAAAGATGTCTGCTAAAGGGACTCAG
AAATCTGCTACTGAGCACAAAGCCAAAAAGCCTCCACCCCAACCTAGCCATTCCCGACCT
GCGTCCATGGTCACGCCACCCAGTAAGACTAAGAGTCCAGGTGTCAGGCAACCAGGCAGT
GGCTCCAGTTTGGTCCCTGGGCGTCCCAGCACAGGAACCGGTCGGCCCATTGCTAATTCT
GGACCCATGCCCAAACGCCAGAATGGCATCTCTAGTTCAGGTCCTGAGCGACCAGTCATT
GGGACCAAGAGGCCAGCCAGTGATTTCAGTCCTGCTGGACGGACAGTCAGGCCTACACCT
GGCCCTGGACGACCTGCAGGCAGCTCAAGTGGCCCTGGGCGGCCCGTCACTGGCTCAGGT
GGTTCTGGGAAATGTATGGGCAGTTCTGGAGGCCCTGGGCGGCCCATGAGCAGTCCACAT
GATCTTCGGCGACCAGTGAGTGGTACGGCCGGCCCTGGGCGGTCTGTCAGTGGCCCTGGG
CGGTCAGTCAGTGGCTTAGTTACAGCTGGACGGACTGTTGGCATTTCAGGCCCTGGAAGA
CCAATGAACAGCTCAGGACCTGGGCGAACACTTAGTAATTCAGGTCCTGCCCCAAAGCCC
AAGTGCAATGTAGTTTCAGTAACAATTTCTTCTAAGAATATAATTAGCCGGTCCAGCAAT
GGACAGATGAATGGAATGAAGCCTTCACTTGCAGGCTATAGATCTGCCCAAGGTAAAATT
GCCTCTAAGAATATATTTATCAAGAAAATTAGAAATCTTTGTTTTATATAACCAGAAACC
CTGCCACCTCTTATGTACCCTTCAAAGAATTTTTTTGACTTTGAGGTGTACCACTTTGTA
ATTTAACATTATATATGATTATCAACAAAATCTAGTTTTCTTCAGACATTAAACAGTTGA
TCCTCTACCCATTTTCCCTTCCCCTCTTCTGTTTCCCTGAGGAAACTACCATCCTGTTGT
CAGAATCTTAAAGTTTTGAGTTTATTTTTTGTGTTTTGATTTTTTTCTACCCATTTTTTT
TATTGAGGTGAATGTAACGAATAACTGTTAATGACAGTTTCATGGCTACATCACCACACC
TACCACCAGTGTCCCCTTCCCTTCACCAGTGTCCTTAAGTACACACCCATACCCACCCCC
AACTCCCCTGCCCAGTCTATTCTTTTTCTTCCATATATGAATGGAATGATATTGTATGAT
ACGTATGTCTTCATCTGATTTAATTTACTTAATAGAATCCCTTCAAGGCTCATTTATGTC
ATCACAGATTTCAGTGTTAGAATTCTGAGTATTGTCTATACATACTGTCTCTTTTTCTCA
TCTCTTAATGCCTTTAATGGCCTTTTAATAGAATGCTGATGTTTTGTGTATTAGACCTGA
GAGTTTCATGATCAGCAGTTTGGAAAATACTTTAGGAAGTTACTTGCCCAGGACCCTCTG
TGTTTAGCTCAGTGTCTCAATGTACAGTAAACATGGTTTTATAACTTGTGAGACAGGATG
AAAGTCTTGTCTTATATATACTACCATAAATAATTCCTTATATTCCTTACATAATTCCAT
GGATGAATTCATCATAACATTTTTATGAGGACTAAAACCTGTGTTCAGGGATTGGAGAAG
CTTCATAAAGTTATAGTCTTTAGATACATTTATTAAGTACCTACTATGTGCTAGAAACCA
TTCCATATGTCCTTGGTAGCACCTACTAGCTGCCAGCTCATCATTCATTCTTTCATGATA
ATAAGCATTTGTTAAAACTTGTTAGGCTACAACATTGATTTTCAGTCAAAGACAGTTTTG
TTTTGTTTAGCTGCTGGAAATAAAACCAAGCTTGTACTTTCCCACTGAGCCATGTACTTG
GCACTGAAAGACAATTTTGGTTTGATCTTTTTCCCAAAACAATTATTTATTATTACTATT
TTTTTAATCACTGTGAGATAGTTACAAAGTTGTTTGTGATTTTCAGCCATGCTATGTTCA
AAAATGCATCCCTTCACTAGTGTACATTTTCTGCCACCAATGTCCCCATCCTTCCCCTCC
CATCTCGCTCTACGGCACACACATCTCCCTCTCTCCCTCTGCTTCTCCTGCCCCTTCCCC
ATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNTTAAGGACAGTTTTGATCCCCAGCACACATCTGTGTCTGGAATTTTCATATACTT
TTCTTTAACACTTAGTGGTGCTTAAGGTACATTGGGGTACTGGGGATTCAACCTGGGACT
CCAGGCTTTTTCTCGCTGGGTTTTTTGTTTGGGGGCCACACTTGGTGTTCAGGGCTTATT
CCTGGCTTTATGCTCAGATCACTCCTGGTGAGCTTGGGGAACCATAGGGAGTGCTGAGTT
AAACCTGGGCCGGCTAGCACCTTACCTGCTGTATTATCTCTCTGGCCCTCCTGAGCTCGC
TCTCTGGACTTGGAGTTTATGGTTAGTTAGTTTTTTGTTTTTGTTTTTTTTTTTTCAGGC
AATACTACCCAGCAATAATCAGGACATTACTCCTGGCTCTGTGCTTAAGAATCACTCCTC
ATGTGTACCATAGGGGTGTCGGGGATAGAACCAGGGTCAGCCACGTGCAAGACAATCACC
CCACCCACTGTACTATCGCCCTGGCCTTATTTTTGTGTTTGCTTGTTATTTTGTTTTGTT
TTGGGGTCTCACACCTGAAAGTGCTTAGTGCTCCAGAGACCATGGGTAGTTCAATATCAA
ACTGGGGTCAGCTGCATGCAAAGTGAGTGTCCTAACCCCTATACTCTCTATAGCTGTCCT
ACAATACTGAATGTATTGCCCTGCAATATAGAACAGTTTCCGCAAGGCAAAGAAATACAG
CCCGAAATGTCAGCAGTGCTCAAGTTGAGAAACCAAGCGAAGGAGATTAGTTGTGCATAT
TAAAAGCAAGCTAAGGAGATTAGTTGTGCATATTAAAAGCAACTATAAAACAGGGTTTCC
GCCTTTGTGTTGCCCATTTACTTTGGAAGCTAGTGAATGTGGTGTCAAGAAAGGCGTAAA
GTAAGCCCTTGGCAGGGTTTTCCTGCTTGTGACCCTGCTGTCTCAGGCACAGGAACTGCA
CAAGGAATAGGAAAAAAAACAACGGGATTGTAAAGGGCTAAAAAGTGTTGTTACCACGTT
TGTCTATTGTTCAGAGACTGTCTTTTGCAAAGGTTTAGTTTCATTAAAAATTTTTTTCTG
GGGGGTTGGGGGAACACACCTGTAGCTGTGCTCAGGGGTCACTCTTGGTGATGCGGGGGA
TCAAACTGCATATGCACCAGGTTGGCCCTGTGCAAGGCAAGTATCTGTTGCACTATCTTT
TTGGGCCTCCTTTGCCAAGTTTTTAATCTGCCATTTGGTAAGATTACAAAAGTAGAGTGC
TTCAGTGAGTTTTTCCTAAGTCCATGTACTCAGTTTGAAAAGAGATCTAAAATTCAGATT
CTTCCTGCTCTGATGAACTGTTAAAAAAATTAGTTAGGGGCCAGATCGATAGTACAGCAG
GTAGAGTGTTTGCCTTGCATGCAGCCGACCTGGTTTGATCCAGCACAGTTAGGAGTAACC
CCTGAGCATCGGCAGGTATGAACCCTTAAAAAAAAGCCAAAAAAAAAAAAAACCAGATTG
TGGTAATGATAGATGTTGAATTGTTACCTTTATTCTTTTGGTAGAAATTAAGTTTGTGAT
CTTACATCATCTTATATTATTTCAAAGGAAGCTGTATTAGTCTTTTAAATCCAGAAGAAT
GAGAATCACAAGTTTGAAAACATAATAGTTCTAGTAAATCATGAAACAGTAGGAATGGTG
TAGTTATGGCCCTATGCTCTGGGCCAGCTTTTTGGCTCTATTTTTTTGAGGTTAATGAGT
TCTCCAAGTCTGTTTACATAGAACTTTGTTGTGGCACTCTATGTGTATCTGTTTTTTAAA
TGCTTATATAAATCATGGCTTTTCTGGTAGGTCCTCAAAGACTGCCTTTCCCTAGTGGTT
ATAAACGGCAACGAGATTATGAAGAGGATGAAGAGGAGGAGGAATATGACTCTGAAATGG
AAGATTTTATCGAAGATGAAGGAGAACCTCAGGAAGACATATCCAAGCACATTCGAGAAA
TCTTTGGCTATGACCGGAAAAAGTAAGGCTAAATAAGATTTATATAAATGACATTTTATT
TTGCATAATTTATGTTGATAAAGATTACTAGACTACACATTAATGTAGTTCTTTTGTTGT
TTGCTTTCTGGGTCACACCTAGTAGTGCTTAAAGCTTACTCTGCTCTTGGGTCACTCATG
GTAGACTTGGGGGACATTTTCCATGTCAGGGACCAAATCTGGGTCAGCCATAATCAAAGT
GTGTGTCCTTACCTGCTCTGTCATAGCTTCCGTCCCTAAATGTAGTTCTTAATTAAGGAA
TTATTCACTCTGGTGAATATTTTAGATTTAGGTACTTGAATATCAAGATTCTAATCAGAA
TGCTTATGTAATTACTTGCGCAAGGGCCAAAAACCCTTTTAAATTGTCATCCTGCAGGGC
TGGAGAGAGAGTAGAGGGTAGGGAGCTTGCGTTGCTCACAGCTCACCTGGTTTGATCCCT
GGCACCATGTAGCTCCTGAGGGCTCTCCAGGAGTAATCCATGAGCACTGCTGGATGTGAC
CCCAAAACAAAATTGATATCCTTGTAAGAAGGTGGGGTTTTTTGGTAGCAGGGGAGGGAA
ATGTGGGAGGTCTCCATGCAGTGGTCAGAAGATCCCGGGGCTCCAGCAGAGATTTCTGAT
CACCTGGCCTGACAGTTTAATGCAGGAGCTTGAGGGTATGATACAGCTCAAACCCTGTGA
TGGCAGGAATTAAACCCAGGTAAGTGTATACTAAGCATGTGCCCTGGACGCTGTGCTATT
TCCCAGTCCTATTAGATGTATTTATAATGACAGTGAAGCAGCTTGTTGTAGAATATAGAT
TTTGAAGTCCAGTGAACCATGCGTAAGTTGAAAGATAGTTCGATCTGACACCTGTTTTTC
TTTTGGTGTAAAAAGTAGTGACCCTTGGCCCTGAGAGATAGTACACAGGATTAAGGTATT
GCACATGGCCAACCCTGATTTGTTCCCCTGCATAGTGTATGGTCCTGAGCACTACCAGGA
GTGATCCCTGAGCGCAGAGCCAGGAGTAAGGCTTGAGCAACACCAGGTGTGACACCCCCC
ATCAAAAAAAAGAAAGAAAAAGCAAAAAACGCAGAATGTAGATTCTTTAGAAAATATTTA
AAGTTTAACATTTATTTCCTCTTAATAGGTACAAAGATGAAAGTGATTATGCCTTACGTT
ACATGGAAAGTAGTTGGAAAGAGCAGCAGAAGGAAGAAGCAAAGAGGTAAGCTATTGTGC
AGGGCCCTCCAAAGATTCTTCCGTTTACTGCTTCAGTTCCCCCTTTGGGAGCAAAGACTG
AACCACAGAGCTCTGAATTCTAATCCTGCTCACTTTGTAGGGCTTAGACAAATTCCTTAG
TCTTTATAAGTGCTTTCTCATTTGTAAAATAAAATTGTATTTTTTCCTCACGGAGGCATT
AGAGGATGAAGATGAAGTGTGCGAGCTGCCTAGGGCCAGGCTTCACCCCTGTAGAAGACA
GTGAATGCAGGTGGCGTCCCGGGATCCTGCTGTAGCACGGTCCTTTCTTTCCTCATCCTG
AATTCTCTTTCCACATCACACATTGCCCAGTCTTAGACATGTTGCTAAGGGACTGCACAG
GAGAGGATGTGAAATCCTGTGTGATTCCTGTTTTGTCTGCTTGATAAGAAACAAATCATT
TCTGCGTAGTGTCACTGTTGACTACTGTTAAGGCTGTTAACTTAATGAAACAAGTTTGCC
TCAGTCTCAACCCAGAACATTAAGCCTCTTGTCTTCTCTAAGTAAAATGTATGTCTTAGG
AAATTTAATAGAATGTTTACTGAATAAGCATCAGTTTTTGTTTTTTGGGATGGTGATGTT
CAGGGATTACTCCTGGCTCTGCACTCAAGAATCACTCCTGGTGGTGCTTGGGAGCCATAT
AGAATGCCGGGGTTAGAACCTGGGTCAGCTGCGTGCAAGGCAAGTGTCCTGATTGCTGTT
CTATTTATCTGGCCTTAAAACTGTCTCTATTTTGGGGGCTGGATCGATAGCACAGTGGGT
AGGGCGCTTGCCTTGCCGACCCGGGTTCGATTCCCAGCATCCCATATGGTCCCTTGAGCA
GCGCCAGTGGTAATTCCTGAGTGCAGAGCCAGGAGTGACCCCTGTGCATTGCCTGGTGTG
ACCTAAAAAACAAACAAACAAAAAAACCAGCTGTCTCTATTTTTTATTTTATTTTATTTT
TTTTTTGGTTTTTGGGTCACACCCAGTGATGCACAGGGGTCACTCCTGGCTCTGCACTAG
GAATTACCCCTGGCGGTGCTCAGGGGACCGTATGGGATGCTGGGATTAGAACCCAGGTTG
GCCGGGTGCAAGGCAAACGCCCTACCCGCTGTGCTATCGCTCCAGCCCCTGTCTCTGTTT
TTTAAAAAGCAGTTAGAAAGACTATTTTATTACTTTAAATCACATTTTGTGATGAGATCA
TTTTTTTTTTTTAATGTTACTTGTGTTTCCTAGTGAAAAGTATTCCTAGTAGGGGCTTGC
CTTGCATGTGGCTGACCTTGGTTCAATCCCCAGCACCGCATACGCTCCCTGGAGCACTAA
CAGGAGTGTCCCTGAGCATACAGGATTGGCCCCCAAACAAAATTATTACTAGTCTATTTT
CAATGGTAGAACCCTGGGACATTTTGACTGCATCAGCACATTCCATTGAGCACCTGGTTA
AAATTTGATTCTTTTTAAAGAGAGTGGTGATTTCATATGAATTTGCAAATACCTTTTTTC
TTTCGACAGTTTAAGACTTGGTATGCAAGAGGATTTAGAGGAAATGAGACGTGAAGAAGA
AGAAATGAAGCGCCGAAAGGCCAAGAAGCTGAAGAAGCGTTAGATGAGACTTTATTTTAT
GAAATTGTAGAGATACTCTGCTGCAAAGAAGTTCTGCCTCCAGACTGAAGAAGCCCCTTT
ATCATTTTAGGTTTATTCTTCGGTACTCAAGAAGGACACATATTTGCAGGCTGTCATTTG
ACCATAAAGTATTTTTTAAGTACTTTGCAGGGTGAAATCTATAAGGCAGATGACAGAATG
CCCAGTGAATGCCCTTATGAAGTTAATTGTTCGCAGATGCCAGTAATACTGGCAAGCTAT
GCACTCAGTGGGGCCACTCACCAGTTAATCAGTCTTTTGTTCCTTTGCTTCCTTTGAAAG
GGAAGAAAATGAAAGATTCCCATGACTTTCATAATTTTGCTGATGGTAATGAGCAGGGTA
CTTCCCAGCTCCCAAATTATTTTTTTCTTAGGAGTAACAGGCCCTTCCATGAATGTAGGC
AGTAATAAAGTGACCTGTTCTAATCTGTGGACTGGAAACTTGGAAATGTAGGCTTTATAA
TTACATGGACGTCACGTCTGACTTTGAAGAAAAAAAAAGTAGAATAAATTATATTGTATT
CTGTGTTCCTCATGGATTGGATGCTGAGCATTCTTACTGATTTTAGGTGATTAAGCAATT
AAGGATAATTGTCCCATATTAAAATACAAGTTATGTCATTTACTACAAGAATATTCTTTT
CCAAGTTTTCCTTTCAGATTATCCATTTACTGTTGTGTTGACTTTAGTGTAAAATGGACA
AGGTCACTGTGCTGGGTTTTATCTAAAAAATCATTTTTATATTGAAGGAAGAATATTTTA
TTCAAACATTACATTTGGAAGCTTACTAGTTTAAAAAGTGACATGTGAGACTCCCCTCCT
TCCCATTCCCCTTCTCCATTATAAAGATATTTTGGAATACAAAGTGTCCCTGTACCTCTT
GCTGTTAATGACTTTGCATCTTAAATTCCTTAACAATTAATGGCAGAAACCAAAAACTAA
ATTAATGCATATCAAGAGCACCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1060, 47121..47235, 48274..49791, 53250..53421, 54568..54645, 56169..56262
1001..1060, 47121..47235, 48274..49791, 53250..53421, 54568..54645, 56169..56259
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved