Sorex_araneus Locus AFF4
snOPY snoRNA Orthological Gene Database
Sorex_araneus AFF4
Sorex_araneus
AFF4
GeneScaffold_569
SNORA42
53868..53998
67645
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNTCCTGCTGCTATAAATAAGCTGTTTTCTTTGATTT
GATATAAGTAAAACACATCTACTGTCATGATTACAGAAATGATGCCCTCATTTTTCCTTC
TACCCCAAACTTTTTAATTTTTCAATATAATTTTAACTACTGTTACTAACCTAAGTTAAT
TTTAGATTTTATTGCTGAAAGCCTCATTTTGCCATTTATTGAGGTGTTGATTGAAATATT
AATATATTTAGAGCAGAAATGTCGTTTTTTAGGGAATCTAGAGCAACAGCAAAGCTGAGG
TCAAACTGCCATAAGGATGGACACCAAGGAAGCTGTGTTTGGGACAAAAAGAAATCAAGA
TAAGGTAGATGCAAGTAGAGAAAAGCACTGGACCCTGGGGGGAAAGGGTGGTAGGTGGGT
GTGGGTTGTATACCTCTAATAGAAGAGAATAGTTAGACTTCTGAGTAGTTAGATTTTAAA
GAAAAGCCCCAAGGCTTATAGGAAATACTAAGGTTTGGGGATTGAATATTACCTTCCCTC
TGAATGTTTTACCTGACTTTTAGCTAATAGAGCACGTTAAAGATAAGGGTAGGTGTCGCA
AAGGGGTGGATCTTAATATTCTGGGCTAATGTTTCCTGTCTGGATAGTCATTGCTATTAG
CTGATAAAATCATTGCCAAAAACCATCTTCAGCACTAATCTCTGAGATTACTTGGAAGTC
AAAGGGCATCTCTGAAGTATTAAACTAACAAATGAATACAGAAAGGTTACTTTTTAATTA
TCTTTTTTTGATGTAAGGATTGTGTTTCTTTTCATAGCAACATGAACCGTGAAGAGCGGA
ATGTGCTGCGTATGAAAGAACGGGAAAGGCGGAATCAGGAAATTCAGCAGGGCGAAGACG
CCTTCCCTCCTAGCTCTCCTCTCTTTGCTGAGCCATACAAAGTTGTAAGTTGCCCTCTGA
ATGTCTTTTTTTTTTCTCCCTGGTAATGTGACACTTTTGCTTTTAAAATGCTTAAACTTG
AATTTTTAATGTTTAATTTAATTTTGGCACAGTTATAAAATTTGTATTTTTTTATATTAG
AAAAGAGTAACTATGTATCATTTAACATTTTTCTGTTCCTCTAAATAGATTATACTTCTA
TGGGGTAAATATATTTGAATTTTACATTCATGCAGAAAGCACAAATTAAATGTTATGACA
GTTTTCACATAATCCCTGACTCAGGGATCCATTCATGTCTACCCACACTCAGCCCAGCTG
TGCTGGCTTAATAGTACATTGCTCAGGCCTGGTGATGCCGGTAGTGTTTGGCCATGATGC
GTACAATCTCGTGATGAGTACCTTGATCAAGAAATAGTGTTCCTCCAGTCGGGATGGGAG
ATGCATGCCGAAAGTAGATAATAGAACAAACATGATGACCTCTCAGTGTCTGTATTGAAA
GCCATAATGCCATAATGCCCAAAAGTAGAGAGAGAGTATGGGGAATATTGTCTGCTATGG
AGGCAGGGGGAGGGTGGGAAAGAGGGAGTATACCTGGGATATTGGTGGTGGGGAATGTGT
ACTGGTGGAGGGATGGGTGTTTGATCATTGTGAGATTGTAACCCAAACATGAAAACTTGT
AACTATCTCACGGTGATTCAATAAAATTAAAAAAAAAATTAAACACACACACACACAGAC
ACACAAGCTGTCCATTATTGTTAGAAAGAACTTTAACCATTTGGGATTGCACACATCTCT
TCTTCAGATTCAAACTCTACCTCAAAGATACCTTTGCCTATACTCCTCCACCCCAAACAC
AAACCATTTCTCATGCCTGGAAGTAAATTCATACAGCATCCAAAACATAAGATATACTAA
CATGTTCAGTAAATATGTGGCTTAACACAGAGGCCTTGAAATAGAGATCATAAGAGTGTA
GCATGAGCTCAGACATGCTGTAAGAGACTTTACGTCCCCTGACTTCTGAGCTGCACAGGT
CTCCTATGTGCAAGAGAATAAAGAATGATTTTAATGTCTGGAGCACAGAGCAGGGAACTT
TTTAGCCTTTGACACATCACAGTGGTGTGACTGTAAGCTGAATTAAATTGTGGCTTTTTA
GGCCAGAAAGATAGCACAGAGTTAAGGTGCTGGTCTTGCATGCAACTGAACCCAGTTTGA
TCCCAGGTCATGCCCACTGAACAGGTGAGTGTAGAGCCAGGAGAAAGACCTAGGTCGCAC
CTGACATGGTGTAACTTCCTGCATCACTTTCCAAATTATTACTTTTTAAAAAAGTGGAAA
ATATCCCCTTGCTAACAGTACTAGAGCAGACCATGTACCGCCCCCGCTCATCACTGCTGT
CAAGATCCTACTTGACTCGCACGTAATCTATGTGAGAGTAGGAAGAGTTTGGCCTGCCTC
ATGAACACCTCAATCTCCATATGCATAAAAACAAGCCTCCNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNCCACACTCAGTAACGCTCAGGGGATTACTCTGGGTCTGCA
TTCAATAAATACTTTATGGCAGTAGTTGAGGATCGTATGTGATGCCAGTGATAGAACCTG
GGTCATTCATGTTACAGGGAAAGCACCCTCCCCGCTTTCCTAGCTGAGCCCCCTCTAATG
TGGAAATAGATATGCCAGTCAAGGTTTCTTCATTGGGTTGATGTTTGTCCTTGCAAGTGA
CGATATCTATAACAATTCCCAGTCAGAGATATGGTCGCTTGTGCACTTCCAAGGCTATAT
CCTGAGTGCAGAGTCATGCACAACCCCTGTGCATCGCCAGGTGTGACCTTCCCCCCCAAC
CCCCGCCAAAAAAAAAAAAAAAGACAGTTCATATTTCACACTCCAAAAAGCTGCTACTGC
TTGTTATTCTAGTAGTTTCATTCATAAATGAAAGTTGGTTATTTCCCTCTTCCAGGTTCC
TTTATATATATATATTTTAGTGGTCTGTTGAATATTTGTGTTTAAACATGTTTTTCCTTT
TCAGTGCTTTTTCTTTTTTTTTTTTTTTTTGGCTTTTTGGGTCACACCTGTTGATGCACA
GGGGTTGCTCCTGGCTCTGCACTCAGGAATTATCCCTGGCCGTGCTCAGGAGACCATATG
GGATACTGGGAATTGAACCCGGGTTGGCCACGTGCAAGGCAAATGCCCTACCCGCTGTGC
TATTGCTCCAGCCCCTTATGTACTTTTTGGAGGGGCTATAAAAAAATAATAGTTTTTAAA
CTCTAAAATTTTAAACTTAAGATATGAAAATTGTCCGGGGGAGGTATACTGTGATTCTTG
GTGGTGGAATATGTGCACTGGTGAAGGGATGGGTGTTCGAGCATTGAATAACTGAGCCTT
AAACCTGAAAGCTTTGTAGCTTTCCACATGGTGATTCAATAAAAGAATAAATTAATAAAA
AAAAATGAAAATTGTCTTTAGAGAACTTTTAAATATAAAGTTTTAGAAAGTCATTTTGTA
AGTGACTTTATATTTAGTTATAATTTTATTTTATCTTTTGTAGACTAGCAAAGAAGATAA
GCTGTCAAGTCGTATTCAGAGCATGCTTGGAAACTACGATGAAATGAAGGATTTTATAGG
AGACAGATCTATACCAAAGCTTGTTGCAATTCCGAAGCCTACAGTACCACCGACAACAGA
TGAAAAATCGAACCCAAATTTCTTTGATCAGAGACATGGGAGTTCTCATCAGAGTAGTAA
GTGGACTCCAGTAGGACGCTGCACCAAGCACTTCTCAGTCTCAGAAACGNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNGTAGCCGGAAGAAAAGGCCAAACATGGATCAGACACTCCTAATTCACGCTCTTCTA
GGCCCTGGAAAACCCCCAGGCCTGTTTCTTCATTAAGCTCCAGTCATTCCAGGTCTCATG
GGAATGATCACCATAGCAAAGAACATCAGCGTTCCCAAATCACCTCGGGACCCTGATGCA
AACTGGGATTCTCCCTTCCCGTGTACCTTTTTCAAGTGGACAGCATTCAAATCAGTCTTT
CCCACCTTCATTGATGTCAAAGTCCGGTTCAATGTTACAGAAACCCACTGCCTATGTGCG
GCCCATGGACGGACAGGAGTCCATGGAACCAAAGCTGTCTTCTGAGCACTACAGCAGCCA
ACCTCATGGAAACAGTATGACTGAACTAAAGCCCAGCAGCAAAGCACATCTTACCAAATT
GAAAATACCTTCCCAGCCACTGGATGTAAGTCATGCATTTAGAACTTAGAACTTTGTTAC
TCTGAAGCAATTTACCATGAAGTTGTGACTAACCTTAAACTGTTTTTTTTTTTTTTTGCC
TTACCATTAAGGAGTGTAAAGTTTTGTTTTTATTTTGAGGGGGGTGGTGGTAGGTTGGAG
CAGGGGAGGGAGGCTCTTCAGCAGTGCTTGGGGGTCCTAGGGCCACACTGACTGTGGCAG
ATAAGGGTGGGATGAACATGTGAGGTCATGGGATCAAATTCTAGACTTCGTGAGATCATG
GGATCAAACTCTAGACTGCGAACATTCTAAGTCTGTAATATAGCCCTTGAAGCTACCTCT
TTTTTTTTTTTTGCTTTTTGGGTCACACCCGGCAATGCACAGGAGCCACTCCTGGCTCTG
CACTCAGGAACCACTCCTGGCGGTGCTCAGGGGACCATATGGGATGCTGGGATTTGAACT
CGGGTTGGCTGCGTGCAAGGCAAACGCCCCACCCACTATGCTATCGCTCCAGCCCCTGAA
GCTACCTCTTATCTTGCTGAAAAGATTAAAAAAGATGCCTGATTTACTCTCAACTTGATC
CTTTGAGCCATTACTTTTATTCATTTACTTTTTAAACACTTTTAGCAAGTCAGAGATTAA
AGGCATGATCTATTAGTACTTTAGATTTCCTCCTTCTGATTTTATGGAAAAATGTTTAAT
TTTTTTGAAAAATTAACTTCTAGGATCAAAGGGATTACTAGAGCAGCAGTAAGGTCCTTG
CCTTTCATGTGACCAACCCCAGTTTGATCTCCAGCACCACATCAGNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNAGTTTGATCTCCAGCACCACATCAGATCCCTTGATCATAGCATTGGGGAGTAAGTCCT
GAGCACAACTGGATATGGCCCCAAACAAAAGAATAAATAAAATTTAAAACTAACTTATGT
TCTCATAGTGATGCTCGTGAATCATTGTAGACTATGCTTCACTGTGGTAAATGTTGGATT
TTCTCCTGACAGTAGAAACAGTACTAAGTATGGTTTGGATGCCATGCTTTTTTTTTTCTT
GGTTTACATTTAAATGTTTAAGACAGTTGCATAGTAATGGTTTGGAATTTACAGTATTTA
TTACTGTCAGTATATACTATGGCAATATATGATAGTTCAGAATAACTGAAGAAGTGAAAC
AGCTGATACTTTCTTTTTGTTTTGTTTTGGTGCCACTCCCAGTAGTAGTGATCTAGATTT
ACTCCTGGCTCTTTGCTCAGAGATCACTCTTGGCAGGGCTTGGGTGACCGACTATATGTG
GTGCTGGACATTAAACCCTTGTGGGCCATGTGCAAGATAAGTGCCCTACCCACTGTACTA
TCTCTATGGCCCTAATATTTTCTCTTTATAGTTTCTGCAATAAAAAAGTTACTTTTTAAA
TTATTATGGGGTCCATTATCATTAGTGCTTGGGTGCTCAGGAATTGAGGGATGTACATGC
AGTGCCAAGGATCCAACTCAGAGCCACAAGAATATCAACCATTCCTAGTCATGAAAGTAA
AAAAAAAAAAAAAAAAACCCCAAAACTTGTAGAACTAATGTAGCTCTAAGTAATGTAGCT
GAAAATCATAGGTCATAGCTTAAAATGGTGTGTGAGAGGGGTGGTCAGGGATAGATAGAA
TTCTATTTTGAGAACATTTAAAAGTCTTGGGAACTTGGGAAACTTGTTGTTTGTATTATT
TGTCATCTAGTTATTCATTTCAAGAGAACAGTAGAGTAATAATTTGCTGTGTTCAAATAA
CACTGCACTTGACAGTGCTCGGGGTTTGCTCCTGGCTCTGGGCTCAGGAATCACTCCTGG
TGGGACTCAGGACCATATGGGGTGCCAGGAATTGAACACAAGTCAGCTGCATGCAAGGCC
AAGTGCTTTACCCACTGTTCTATCCCTTGGCCCCAAAACCTTATTTTTCCAATTAAAGCA
TAAGGTAAATTAGATGAGAAAGGTATGAAATTCTTCATTTAAAATTTAGTAATTTTTAAA
AACTTTTATTTATTTATTTGGCTTTTTGGTTCACACCCAACAATGCTCAGGGGTTACACC
TGGCTCTGCACTCACGAATTATTCCCAGGGGTACCCAGGGGACCATACAGGATACTGGGG
ATTTAACCTGATCATTTGCATGCAAGGGAAATGCACTACCCCCTGTGCTATTGCTCTGGC
CCAAATAATAAATATTTGAAAGCTTGAAAAATTGTTAAAGAAATTAATCTAATGATTCTA
ATTAGTACTTCAATTTAGAGTGGTGGGTAAGATTATAATGAACTCTTTAGCTATAATACA
TTCCTAATAATGTTAAATTGATAAAACAAATGATCCTTTGCATTTAATAATAAATGCTCC
AAATTTAAGTTGTTTCTTTTTCTATAAAGGCATCTGCTTCTGGTGATGTGAGCTGTGTGG
ATGAAATTCTTAAAGTAAGATTTTTTAAAAAATATTTTGGCTCAAGTTATGATTATATGC
TACCATCTTTTACTTTACATATTTAACAAAGTGTATAAAGTAACAGATTAACATGTGTGA
TTTGATTACATTCATAAAAATAGTTTATTATGCTTATTTTTATATCTAAGTTCTTATTCA
CTCATTTGTTAGTTTTCCCTCAAAGAGCTGGGGTATTTTTATTTCTAAGTTTTTTATTTT
TTTGTTTTTTGTTTTTTGTTTTTTGGGTCACACCCGGCGATGCTCAGGGGTTACTCCTGG
CTTTGCACTCAGGAATTACTCCTGGCGGTGCTCGGGGGACCATATGAAATGCTGGGAATC
GAACTGGGTCAGCCTCGTGCAAGGCAAACGCCCTACCCACTGTGCTATCACTCCAGCCCC
TAAGTTTTTTATTTTTAAATAAAACAAGTTTGTCCTAATAGTTTGCCTTGAAAAGGAGAG
GAAACTAAGTACAACTGTATACTTTTTCAGGTTGAACAGTAGTCCTCGAAAGACTTAAAA
TCTAAATAAGTTTAAGGTGTAAAAAGCTAAAAGTCATGGCAGTGAGTGAGAATTTTGCCT
TGTAATACATCTTGTTGGCAAAATCCTCCGATTAGTAGTACATCTTAAGTGTTTAATGAA
ATATGTTTAAGACTGATACATGACCAAAAAGGACAATTCTCCATTGGAATAGGAAACTGA
TGTCTATTGGAACCAGAGAAAATTCAGTAAATTATCATGAGTGATAGTGATTGCTTTAGT
TCAATAGAGAAATACAATCAGTTTTATATTACTTATAAGTTATTTTCTGTAAGTTCTTGA
GCTTTTGTTTTTTTATAAACTTGCCTTTTACTGTGGGTACTCTAGAAACGTTTGCTGCTT
CTATTCACTCTTATACCTTTCTTTAGCTTGGTGCAGTCTCTTAACTCTGTTACTCTGCTG
TTCTGCTAAACCTTATTTTCTACATGTTTAAGTGTTTTATTTAAGTTTTGTATTCTTCAG
AATTTGGGAACGGGTTACCCTGGCAGTGCTCAAGGGCCTTTGGGTTCTAGCAGTCAAATT
TAATGGCCTCTTGCTTGCCAGACCTATGTAATCTAGCCCTTTGAGTCATCTTCTCAGCCC
CTAAATTACATTTTTTCATTATGGAGATGGTCTTTCTTTCACTTGTTGATTTGATTCATT
GTTTTAATTTCCCATCCCTTCTTCTCAGACTTTTGGAAACCCTTGTGTCTTATTCCATAA
GAATGAGTGCATTTCTGGACTTCTCTCTTATTGTTCTGTCTTTCACTTTCCTCCTTGATT
AGAGCTTTGCTGTTAGATAGCTTTTTAATCTTCTGTCCTCCTGGTTTCCTTTGGGTTTTG
GATTAAATGTTTTTTAAATGTTGGGTCTCTGGGCTTCTCCCTACTTTGTCACACTCAGTA
TATGTCTAAGTAATAACTCAGTCCTTTTGATAGTATACTTCCATTCTCCCTTTTTTTAGT
TGGAAGACTCCTAATTATCTCTCAATTTTTTTGTTTTGGATTTGTACCACACTGGCAGTG
CTAAGGGGCTATTCCTAGCTCAATGCTTGGGGTAGCAAGTGATATCAGGGATCAAACCAG
GCATCAGCACACAGTATATACTTTAGCCCTTCGAGCTATGTCCCAGGCCCCATTTCTTTT
ACTTTTCCTTTTCTTTTTTTCTTTCTTTTTCCCGCTTTGGGCCATACCCACTGGTGCTCA
GGAATCACTCCTGAAGGTGCTCAGGAGGCCATATGTAGTGTCAGGGATTGAACTTGGGTA
TGCCATGTGCAAGGCAGGCACCTTAACCCCCTCCTCTCTCCAGCCCCAAGTCATAAACCT
ACATATAGTCTTGGAAAACATCTACTCCTTTACTTCCATTTCTGCCCTTTGAGCTTTAGT
TAATTGCAGTATGTAGTCTTCATAGAGCCATCTCTCTGCTCATCTGCTTTCTTTATTGCT
GACAGATACTTTTTCTATTACTAGCAGATTTATTCCCTTGTCTTTATAATAATATTTCCT
ACTGAGAAATTTTTAGAGATTTTCTCAGGGCCATAAGAAAAATAATATCCAAACTAATAG
ACCTCCCACTTGGCAGTTTTAACATCACCCACTGCTAACTGATTGCTTAGGTTTCCTTCA
GCCACACATTTCTCTCTTCTTAAGGTAACTGTTATGGAGTGTGTTTCGCCTTCCTCTATA
GTTATATATATAGATACTTTTATTTATATATATAACTATATATATATATATATATATATA
TAAAACTGAACCCCAGCGAGGTCCTTTTTGTATTATCAGTCCATAGTGTTAACTTTTTCC
TTTGAATCTTTTGGTTGCTGTTTATATTAAAAAGTCTAGGGAGCATAGTTTTTCCCCATA
AATTCTAAAATATACGTGATACTTTCTTACATCTATTTCTTTTACATTAACTGTTAATTT
ATTTCATATAACAAGGCTAGGCACATGGCCTTGAGTTGCGTTTTATCTGGTGATAAAATG
TTAAATAGACTTTTAAAGAAGGTAAGAGTATTTTCATATTTGAAGTAAACACTGAAAACC
TTCCTGGAAATAGTCCAGAAAGTTAACGAATTTCTCTTTCCCCTTCCCTGTGTACAATGT
ACAAGGAACTACTTTAGGTCTGTTTTCTCTTCACAGTTCTTTTCCATTTTCTTTCTTTCT
TTTTTTTTTTATTGTGGTTTAGGTAAAAGGTTTACCATAGTGTTGATGTTTATGGTTTTG
CTGTATAAAGTTATTGTATTTTTATAAACACCAAAGTCCAAGACCCTCTACCTCTCTCTA
TCTTGTTATTTCTAGTCTTCCTCTTCCTTCTCCATCCTCTTCAAGTATCTTGATATTTGT
ATTCATACTTTTTCTAAAACTGGAAGAAAAACATTTTTAATCTGAAAGTAATATGTGTTC
ATGAAAAATACTGATTTATTAATTCAGGATGTACTAATTGAGCACTTTATATGTGTCAAA
CACTGGTAATGTGGTGGTAATAATGACATTTGTTATAATTTTTGAGCTGACATTTTATTG
CCCAAAGGTAGCTGCTGTTTATCTTTCAGAGTTTTTTTAAAAATTATATAAACATTATTG
GGACATAGGATGATTTGTGTTTGTCACTTAATATACTGTGGACATCATTTCATACCAGTA
CATTTCTCATTTTACTATCTTCTTGGTATTCCATTACATAGATGGCTGGTAATTAATTAC
TCCTGCTTTGTTTGATAGTGGGTGGTCTTAAGTTTTAAACTGTGAATCCCTATATATCTA
TCTTAGCCTAACTGTGTGGACATACATACGGGGTAAATTACTAAGAGCATATTATCACCT
TTAATTTTTTTGTGTTTTCACAGTTTTACTTCTGATTTTCTTTGAACTGATTGCCAGAAT
CAAAACAGTTCCTCCCTTCTTATCTTATAAGTTTGATACTTCTCTTTTCCTGCTTCTCTA
ACATACATGCATTTTGATACTATCCAAACCTCCACTTGGATGCTCTGCTTAATATTTTAG
AAAGTATTGAATGAAATCTCATATAAGACCTTGCTTGTCTGTCCTCCTCATGTGCATTTT
TTTCCCTCCTTCTTTTTTTCTTTTTAATCTCTCTTCTGATTCTTCCACTGACCAAATGTC
CTGTGAATGGAATTTGTAGCAGACTTCCTGGGATGAAATTTTCTGTCCATCACCGATACT
TTGAATGAAAAACTCTGTGCTTCAGTTTCGTCCTACACAGTGGGTCCTAGGGGTATCGAC
CTTAAGAAGCCTTTACGAGCCCAACCTGAGAACCCCAGATGTCAAACACTTAGCAGTATC
TGAACTATTAGAAGACCACAATACAATGTTAGCTGTTTTCCTTACTGTTAATCTGCTCCT
CTCACTTCCACAAAAACTCTTCGTCAGTAGTATTTTACTATGTGCCTTGTATTTGATTAC
AGGCTTATTTCTGAAACTCTTCCCAGATCTCCTAATTTTAACTCTAAGCTTCTTGAAGCC
AGGGAGTTTATATTATTTATCTTCTTACGTACTCTGTAGTGCCTTGCACACAGTTGTGCT
TGATTAATACTTACGGATTAAATGTATACTTTTGGAGGAGCAATCATAAAACCAGCATTT
ATAATATAAATCTGGTTTTTAGCTGTGTAATTTTTATCCTTGACTTGGTTGAAAACAAAC
TGTAATAATTACATTTCAGGAGATGACGCATTCATGGCCTCCCCCTCTAACGGCTATTCA
TACACCATGCAAAACAGAACCTTCCAAATTTCCTTTTCCAACTAAGGTAAGTAAATAAAA
TGTGTCTTTGATTCTTTAAGAGAAAGCTCTAAATGGCTTGACTAAAATCATATGAATTGA
AAACTGTCTTGCCATTCCCATTTTAGTGGGAGATAATAAGTGAATAAATAGATGATAACT
TCAGATACTAATAACTGTTAAAGAAAGTAAACACAAGATAACAATTGTTAACTTGAATTA
AGAGATACGTTAAAAACTTTAAGGTAGTATGTGGAAGAGATTTAAAATTAGAAGCCATCT
ATATTTGTTGCAAACTCTTACTGGTATTCTAGACCAGGGTTCTAAGCACTTTGTAAACAG
TTGAGATATTTCTTCCCAAAGGACATAGCAATCATACTTAAGTTCTATGGAGAAAAGTTT
CTTAGGCAACATTTGCAAATGCATCTAAAATGAACAAATTTTTTATCATTGACTTATATG
TACACAAATAATACAGAAATAACATTCTCATACTAGTTTGACAAGACCCCCTAATAACTG
TTCCAACTCTGCCTCCTCTGCCTTACCAAATCTGTTTTCACACATACCTTTACAAGTCAT
TTCATATGCAGTCATTTATATTTATGTAGTTACGATGCATCTGTTTTTCATTTGTTTTGT
GCATTCTGTATTTTAATAAGTTATAGCAATATTTCCATATTTTTATATAGTTTGATAGCA
TTATCTGTATCTGTAGTATCAAGATAGGGTTTTTCTTGTATTTGGTTTTGTGATGCCAGA
ATCAAACCCAGAATCTCACACTTGCAAAGCATATACTTTACTGTTGAGCCACATTCCTGG
CCCTGCAGATAGGTTATTTAACTATTTTCCTTTGGTATTACAGTATCCATTTCTGTACAC
ATTTCTCTAGTGCGTCTCTTTATTCATGCTGTCTTATTGGACCTTAAATGTATATGCTTA
ATACTCAAATTTCCCTCCCTGATACTTGTGCCAGTTAGTACTACCTCTTGGATTGCTTAC
TATTCCTCACAGCACCATCATTTAACATTTCAGTTCTTTGATGAGAAATGATAATATATC
TCAGAATGCTAATGAAGCTTTCCATACTTCTCACACATTTATTTTTTGTGCATATGATTT
TGCCTTATTTCCTTTGTCACTTGGATTTTATCTTCCACCAAAAAAAAATTTAGGAGTGTT
TGTTTTGTTATTTTGTTTGAATTTGGATTCTAATAATTTATTCTACATGTTGCTAGTATA
TTTCTTTTTTTTTTTATTTTGCTTTTTGGGTCACATCTAGCAGTGCACAGGGGTCACTCC
TGGCTCTGCACTCAGAAATTACCCCTGGCAGTGCTCAGAAAGTACCCCAGAATCATATGG
GATTCTGGGAATCGAACCCGGGTCGGCTGCGTGCAAGGCAAACGCCCTACCCGCTGTGCT
ATCACTCCAGCCCCCTCTAGTATATTTCTTAATTAGAGTCTTTTTAAGTTTTATGGCTTA
AGGATTTTAATTCTGGTAGTCTTTTTTTTTCCCTTTCAGAGAGTTTATAGATTTCTTTCT
TTTTATAAGATTTTACTTTTTAATGTCTTGTTAAAATCTATTTCTTCCCCAGAGTCTTAC
TATACCCTCTTATTTTTTCTTTTAACATTGATCACAATTTTATTTTTGGTCTGCCCAGTT
TATTTTTTAAATAAAATTTGCTTTACCCCCCTTCCTTTCCTTTTGTTGTTAATATTGGGG
TCTCTCACACACATCTGACTGTCGTACATGTATACTTTTGGCTGTTGCGCTAACAGGGGT
TTGTGCTTTTTTGGTGGCAATACTTCATTCAGGCCAGCAGGTTACATTTGTGGTACTCAG
TGGGGATCCCTATGTTACTCATAAATCTGCTTCCTTTTGTTTTTGTTTTGGGATTACACC
TAGAGGTGCTTAGGGCTTACTCCTGACTCTGCTCAGGGATCACTCCTGGTGGTGCTCAGA
GGACCATATGTAATGCTGCGGAACGAACAGCATTGGCTGTGTAAAAGCTAAATACCTTAT
CCGCTGGTTTCATCTCTCTGATCTTCAAAGGTCACACTTTGATCTGTGGTGCATGTATTT
TTCATTGGGAGCTTAGGGGGGATCACACTCTTTTGATAGCATAGTTGCCAGGCTCAAACA
ACAGAGCTGCCCTACATTATACTATGAGCAGCATATATAGGGTATCAGGATTTGAACTTG
TGACCATATGCTTGCAAGCCCCTATTATTTTTGTGAATGATGCGAGTTAGATAACTGTGC
TTGTGTGTATTTTTTTTTTTTTACTTTTTATTTATTAAAAGAATTGGAGTAGGGAAGGGG
AGATACTATAGCAGTTAGCTAGGCATATACCAGACTAGGTACCTCATAGACACCAGAGCA
TCACCAGTTCTAGCCCTGGGAGCCCCGAGGCATTGCTAGGTGTGATCTTGGAGGTTACCA
GGCACCACCACCTAGGAGTATTTGACTCTGTGGAGCCAGGCAGCACTGCATCCTTGGGCC
CTAGTATTCAGCCACCAGGCTGGTTGGCTAAATATTGCCAGGAATAACCCCTGAACCCCC
TGAGCAGTGCTTGGGAAGCAACCTCCAACAAGGAAATAATTTTCTGGGAGCTACCTCCAG
CAGTGCTTGAGTGAGGGTGGGGATGTCATGTGTTGCTAAGGATTGAACCAAATCTACATG
CAAGGCATGTACTCCAGCCATTTGTGTCATCTCCCTGCTTTGCTATTTTACTTTTTTAAA
TCAACTTTTTTTTTACACATGGAAAGCATACATGTATTTAATTCAGTTTCAAGTTTTGAT
ATTACCTGTGTAACTATCACCCTAATCAAGAATTATGTCTTTCCAGCACCTCCTAAAGTT
CCCTAGTTTCTTTGCAGTCTACCTCACTCTTCCTACCCAGTTACGGATCTGTTTTATGTT
ATAATAAGTTTTTCCTTTTCTAGATGTTCATACAATTGGAATATATGTGGTGTATGTTAC
TTCTTTTATATATATTTGCTCAGCTTATGCTTTTGGAATTCTTCCATGCACTTGAACATA
CTGTACTTTGTTCCCTCTTTTATTTTTTAGTAGCGTACTGTTATATGAAAATACCAAAAT
TTAGTTACCTATTCATAATAATTCATAATAACTTCTATTTCCCTTTTGAGCTCTTAAGAA
AGAAATTATCCTGGGCCAGGAATGTAGTTCAGTGATAGAGCACCTGCCTCGAATATGTCA
GGTCCCAGGTTTACTTTCTGGCACTCACCCATGACAATAGTAGTAATGTATAAAACAATA
TTCACTTATATGTCTTTGTGTGGATTTTTCTTTTCTCTTGGTTCAAATGATAAAAATTAG
AACTTTGGAGTCATTTTTAAAGACTATTTTAAATTTACATACTAAACTGAAAACTTTTTT
TAGTGATTGTACCACACCTCTACCACATCTCTAAAGTTGCCCCACTTCCAACCCCTCAGC
ATTAAGTCTTTGACTACATTTGGTATTTTTAATCTATTCTGTTTGCCATTTAATAGGGCA
TGTCTCATTTGGGTCCATGACTTGGCGTCCCTGATTAGTAAAATGACATTGAACCTCTTT
TTTGGCATTCTTTTTGAAGTGTTAAAGTCTTTCGCTTTTGGGGAGTTTTGTTAGCAGGTT
TGGTTGGTGATTTTAGTTATTTTCTAATGCCTTTAGCTTTGTTATGAAAGTAGTTAAACT
TGCTTCTTAGAAGGAACAGGAAATGTTCAGTTCATGTCCATTTTCTAAAATGGAATTATT
AGTTTTAAGTTTTCTTAAATGTTTAATAAGATTCAGCACTGATACCATCTGGGGCGTAGA
ATTTATTGGAAAGTAGTTATAGATTTAATTTCCTTAGTAAATGTAGAGCTATTTATAAAT
TCTGTTCCTTCTTGTGCCAATTCTGGTAATTGCTCGTTTCATCTAAGTAGTCAAATTTGT
TGATATACTCAGTCTCTTTAATGCTTGTAGAATCTGTAGCGGCACTTATGCCTCCTCCTT
GTTATAGTGATAATTTGAATTTGTTTTCTTTAATTTGTCTAGAAGTTTATTTATTTGGGG
TGGGGGGGCAGTATTTTGGGCTACATTCAGCTGTGCACAGGGCTTACTCCTGGCTCTGCA
CTCAGGGATCATTGCTAGTTGTGTTTGGGGGACCATATAATTTTAATCTACCTGTGAACT
TAGTCCTATACTAATTTCCTCCCCACGTGGAGTTACTTTTTCCTCTCTTACTTTCCAATA
AAATCTATCTGTGCCTTTATTTATTTATGAGGAGGGAGGGAGAAGGGTTTTCAGGCACAA
GAGACCAGGGCCCCTCTTGGCAATTCTTGGCCAACCAGGTCAGTGGATCAATTCAGGACC
CTGAGGATGGGGGGCTTCTGCAGTACTGGGGATTACTCGAGCCACCCAAGTGATGTTCAG
TGGCCTCTCTGGCTGTAACTGGTGATGCTTACAGGACCATGTGGTGCCAGGGATTGAATC
AGAGGGTCTTAAGCAAGGCATGTGCCTTGACCCCCTACTATCTCTCTGACTTCATGTGCC
CGACTATTTAAAGTAGGGGTCTTGATGGGCACTTGTAGACTGAACCAACATTCAAGGCTT
ATGGTCTACTGTTGAGTCATTCACTGGCCCTCAAGAAGGTATTGATTTCTATCTTTTTGA
CCAATATCTAGCATTTACTTTTGAGGTATTTAAGTCATTTCCTTAGCAACTTTGGGGTTT
GACTCTGCCATTTGTTTATTTCCCTGAATTTCATTTGGATTAGAAACTATTTTGTTGGGG
CTGGAAAGATAGCCCAGCAGGTAGAGTGCTTGCCTTGCATGTGATTGACTTGGGTTTGAT
CCCTGGCATCCCATATGGTTCCCTGAGCATCTCTTGGAGTAATTCCTGAGTGTAGAGCCG
GGAGTAAACCCTCAGCACCACTGGGTATGGTCCAATAACTCAATAATATAATTATTTTGA
TTTGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNT
GGAGTAGTCCTTTGATCCCTAGCACTGAGTTCTCTAAGCTCTATGAGTAGTCATCCTGAG
CACCAAGCCTGGAATATAGTCCCTTGGTACCACATTGGGTGACTCCAAAATGAGAAATTA
GAGGGGAAAGAAAGGAAATAATTTATTTGAGAGTACACAGGTTTCACCAGAGGAGTAAAA
CAGAATATACATCTCAGGTTGAGATGTGGGCAAATCTCCAGAGTGGAAAATGCACCATAA
ATTGAACAGAAAGGAGTGTTTGTTTGTTCTCATTATAGTATTCCTCCCACTCCCCCCCCC
CCCCCACACACACACACAAACACACATTTTGTTATTGCAACGATCGGGGGTTATACAAAC
CTGATTGTGTTACTCACTAGGGGCCACATTTGTTACAGTAGACATGTGCTCACTGGGGCT
CATACCTTTATTTATGGTTCTCACAGTTTGCTTGTGGTGCTTGCACATACTTGGTTCAAA
GAAAAAATGAGTTGTTGTGGTTCTGGGAATCCCAGATGGGCAGTGCTGCACCCCAGGGAT
CACGCTTGGGCAATTGTGGAACTAACTCCATTCACTCATTTTGTCTTGTCTGTTTTATAT
GGCATTTGAAGTTATTTCTGAGAACTTTTTTTTTTTTTGGTCATGTTCTGGTGCCACACT
TTATGGGGTTTAGGGGCTACTTTCTGGGTGCAGTGCTCAGGGTCGACAGTGCCTAGAGAG
GACCATGTTGTGTCAGGAAATTGATCCCAGGGTTCCTGCTTGCAAAGTTGTGCTCAGCCC
TTTGAGCCCTCTCTCTGACTTACTGTATATAGTTGTATTTTTTAATGAATCTGTGTATAT
TTCTGAAGGATACTGGCTAATCTTTTTTTGTGTGTGAAATCTTTGCCTGCTTGGGGCCAG
AGCCATAATACAGTGGATAAGGTGTTCACCTTGCATGTTGCTGACCTGGGTTTGATCCCC
AGCATCCCATATCATCACCCAGCACTGCCAGGAGTAATCTCTGGGTATGGCCCGCCCCTT
CCTCTACCTCCACTCCCAAAAGAAAAACTTCACCTGCTTTCGGCACCAGAATAATGGTGG
CTTTATAGAATGAGCTGGGACATAATGCCCTCCTTGTATATTTTATGAATACTTTGTGTG
GAATTTATATTGTTTCTTCCTCAGATGTGTCTTTTTAGAATTAACCAGTGAGTGTATCTC
ACTGTGATTCGATTAAAACAGAATTAAAAAAAAGAATTAGTGAAGTCCCTTGTATGTTAA
ACTTACTTTGTATGGAAATTTTTGTTCTGTTTTGTCAGTACTGGGGATTGAACCCAGGGC
TGTGTGCTCTCCCACTGTGCCATATTCCCCACTCCCCTTATCCCCTTCCCTCGTATCCCT
ACTCTTTAAGTTTTCTTCTCTTTTTCCTCTTGCCTGTGGTGTCTTTTACTTTTGTCCTTA
CCTTTTCTCATTGTTGTTGCTATCTTTAACCAGGGATCACACAGACACTTGACTGCTTGC
ACACTCAGCTACAATATTGTAATAGGAGGATAGCACACTTTTTCTTTTTTGGTTTTGGGC
CACACCTGGCAATGCTCAGGGGTTACTTTCGCTTCTGCACTGAGGAATTACTCCTGGCGG
TGCTCAGAGTCCACATGAGATGCCAAGGATTGAACCTGGCTTGACTGTATCCAAAGCAAA
CACCCTACCTGCTATACTATCTACTCTAGCCCCTTGCACACTTTTGTTGCAGTGTTTGCT
GTGGTTGCATTTTTTAATCATGGTGCTTGTGAATATCCCGTTTGCATTGCTCACCAGGGA
TTGCTATGGTATTAATACATATGCTCACTAGGAGGCCATACTCCTTACCATTGTACTGTG
GTTTTTAGTTGTGATCCTTGCACATACCTGCTGACATACCTGCTGTGGTGGACCAGATAC
TGCATTTTGGTTGCAGTGTCCAAGCACCCAAATAATGGCTGAGCCTGTATTCAGTGCATG
GTGTGTGGGCCAGGAATTGAACTCAAAGTCTCGTTCTTTCTTCTTTTCTTTTGGTATTAA
TTTCCACTATGATCATTAGTACCTTTTTTGGTCTGCTTTCTTTTGACTTAATTTGCTCTT
CTTTTCTAAAAAATCCTTTCATTTGTTTTTGGGCTGTGCTGCACACTGGCAGTATTTGGG
GGCTTACTGGTTCTATATCCACAGGGATCACTCCTAGCAGTGCTTGGGGGACTGAATGTT
GTGCCAGGGATTGAACCTGGGCCAGGCGTATGCAAAAGTGACCTACTTGCTACACTATTT
CCCTGGCCCTTTAAAAAAAATCCTTAAGGACAATATTAAGATCACTGATTGAAGACTTTC
CTTCCTCCTTTTTGCTTTATTGATGGTGCTGAAGTTGGAACCTTGGACTTTACGTATGCC
AAATATATAAGCGAAATACTCTACCCCGGGCTACATCCCTGTCCCCTCATTCTGTAATAT
GTTTGATACTGTTTATTTTTCTCTTAAGTAATATGAGGAGGTGGAGTTGGTGTTACTTGC
ATCACACAACTTCTACATTTTTTATTCAGTTCAAGTAAATTCATATTTCATTGTTTNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNAATTAAAACACATTCTGTGGTCATTTAGAATTTAGCTTTTGAAATTTTCAGGAATAT
TTAATATTTAAAGGCCATCAATAATATTAAGCACATTTTCTTACTTATTTGGTTAGGACT
TTTGGTTATGTTTCAGCCCATTTTTTGTTTCTATCAACTGTGAAAAACAAATGCTTTTTT
ATAATTAGGTTTTGAAATTTTTTTCTTTCTCCTTAGATAGTAACAGAGAGGAAAAAAGCT
TCAAAATGAAAAAGGTATAATTTTGTTTCTGTTTCAGCCTGAACCACCACCAACAAACAA
ATGGCAACTTGATAATTGGTTGAATAAAGTGAACCCACATAAAGTATCACCAGCATCTTC
TGTGGACAGTAATATCCCATCATCTCAAGGTTATAAAAAGGAAGGTCGAGAACAGAGCAC
TGGAAATAGCTACACTGATCCAGGTGGACCTAAAGAAACAAGTTCTACTACTCCCGGACG
AGACTCCAAAACTGTCCAAAAAGGATCAGAAAGTGGGCGTGGGAGGCAAAAGTCTCCTGC
ACAGAGTGACAGCACAACACAGAGGAGAACTGTAGGCAAAAGCAACCCAAAAAGACTGAG
AAGCAACTGTTGAAGAGCCCCGAGGTGGCCTGAAGATAGAGAGTGAAACCCCATCGACAT
GACTGCCACCATGCCCTCCAGCAGACACAAAGCAGCCACCAAAGGCTCAAGGAAGCGCGA
CATAAAAAAGGAGTCCTAATCATCCCCCCGACCTTCAACAGAGAAAAAGAAGTATAAGTC
AACAAGTAAATCTTCCCAGAAATCACGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGGTTTAAAACTGT
CATCTGCTTTTTCACTAATGGGGGGGTGGCAAGAGGACAAAGCCAAACCTGTTGGTGAGT
GGGGGCCTCTTCCAGTACTGTCCTCGGGAGTTGCTCATAGCGATGCCCAGATGACCATCA
GGCAACCACATATAAAGCCTCTCTTCCACACTATTGAATGCTTTCAGCCCTAATTTTTTT
AAGGGTGCTCACAGGCTACACCTGCTGAGTGCTATGGGTTCCTCCTGGTGGTCCTCTGGG
AGCCATGTGGAGCCAGGTATCACCAAACTTGATCTGCATATGCTTTACAGTCCTTGAGCT
TTGTCCCTGACCTTGATTATTATTATTCTGCCTTATAAATTGAATTACATCCCTTAAATT
TTATTGTTGTATTTCATATTTGGGTTATTATAGTCTCTGACAGGACTCGGACTATATGGC
ATGCCAGGTATCAAACCCGGGTCAGTCAGTTGCAAGGCAAGCACCTTACCCACTGTACAT
TTGCTGTCCTCTTTATTTTTAAACAGACATGTTAGTGTCCTGTGGCTGCTCCACTCTGAG
CTCAGGGTTGCTCTTGGTATTACTTAGGACTGATGTGAAGCCAGTGTTTGAATCTAAGCC
TACTGCATACAATGCATGTGCTTATTCTATCAAGCTATCACTTCATTCCCAGGCTTTTTC
TTATCTAACAGTTATTTGGGGTTAGGGGTATAATTAACATATAGACATATTAGTTTCAGA
TATACAGTATTATGGTTTGATAGTGATCACTTCAATAAATTGAATTAATGATCTCTCTGT
CCCCTACATAGTTGCAAAATATTTTCTTTTCCATTGTGAGAAACTTGGAAGGTTTACTTC
TTTAACAACTTTCAAATATGCAGTTCAGTATTGTTCTTTAGGCAACAGTTATTGGCCGCA
AGCCACTCACAGCAAAGCTCAGGAAGGCTAGCTCCCAGCCCTCTTATTTTTAATTTTTTA
TAGAACCTTTGCACTATTTCCTGTACTCGGGGGAAAAATCAGTTTACCATTTCACCAACA
GCACAGCGTTGCTCTTCTCCATATCCTTTCCATGTGTACTATTTTGTGTCTTTTTTTCCT
AGCAGACCAGTGAAGATAATACCTCACTGTGGTTTTGATTCCCGATTCTCCGATGATTAA
TGAATGTTGAGCTGCTTTCCATGTACCTATTGGTCCCCTTTGGAAAGATGTCTGTTCAGT
TCTACTGGTCATTTTTTTTTTCCCGCTTGTTTTTGTTCGGGGGCCAGACCTAACATTTCT
CAGGCTGTTCCTGGCTCTGTACTCAGGAATCATTACTGAGGGTGCTCAGGGAACCATAGG
AGATGCTGGGAATTGAACTTCAGTAAGTGGCATTCAAGGCAAATGCCTCACCCACTCACT
GTACTATGTCTATGGCCCATATTTAGTTTCCTGCCACTGAATTGATTGAATTTATGTTGG
ATATTAGCCTCATCAAAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNATAGGTACCTCAGGGCCTCCTGAATAACCAGTATAGCTCCATGACCCTTG
TACCTGGTGACCTCCCCCACTGGAGAGACCCAAAAGCAAACAAAAATGTTATCTGTATTT
GTTTTTATCCCACCCTCCCCCTCTCCAATCTGATCTTGCTTCTTGCAGAAAACTGTTTTC
CTTAAGATTATACCTATGGCTTTTGATCAAAGGCAAAACAAAAAACAAACAAACGAAAAA
AATCCACACGATTTTGGGGTCATACCTGTCTCTGCAACGACCAAGCAAGTTAAAAGTGCT
TTATTAAAAGTCCATTGACAAAATTGAATGATTAATGAGCTGCAAAACAGCTGAACTTCA
TGGCAGTGAGAACAAAGTGCTGTGGCTCACAATTAAGGCTGTCCTCAGTAGGATATTCCT
TTTAGTCCTTTTAGTTATGGTAAATTACTTGGTACTGTACAATTACTGTTTCAAGTTTGA
GTATTCCTGGCCTCTGGATCATTATTTTTTGGGTGAGGCTGAGAATCAGTGGATAGAGAG
CGTGTCTTCAATTTTAAAATAGAAAAAAATGAGTTATGTGTGTCCATGGAACAGTAACTA
TCTCAAACCCCAAGAGTTGTCTTTCTTTTTTCTCCATCCCTCTCGGAGAGCCTGGCAAGC
TGCTGAGAGTATCCTGTCCGCACTGCAGAGCCTGGCAACCTACCCGTGGCGTGTTTGATA
TGCCAAAAACAGTAACAAGTCTCACAATGGAGATGTTACTGGTGCCCGCTCGAGCAAATA
GATGAACAACGGGATGACAGTGACAGTGACCTGTCTCTGCATTCAGGAATCACTCCTGGC
GGTACTCAGGGGACTGTATGAGGTGCCAGGGATTGAATCTTGGTTGACTGTGTGCAGAAC
AAATGCTCTACTTTCTATTTCTCCGACCCTTGTATTTTATTAGATAATAAAATTTAAATT
ATTTTAGCTTCATTAAGTTTCTCATGCACATTGAGTAACTTGAAGTAGGTGGGGAGGTAT
CACATCTGATTGTTCAGGACTTACTTCTCTGGCTTTGCACTCAGGCATCGAACTTGGGCC
ATCACATGCAAGGCGAATGCCCAACCCCCTGAACTATCTCTCAGGCCCCTTGAGTATTAT
TTTAGCCTAGTATTTTTCCCCACTTTATGTTGCTCATTCCCATTTACCCTGCTTTTTTGG
TTCTTTTTTCTCCTTTACTTAAAAGCAAGTTTCTAGACATAATGCTGAGTACTTGCAGAG
AATACATAAGAAATGTGATTTGCCTTAGTGTACCAAGATTTAGTTGTAGAAATGAAGTGT
TAATAAAGCAAGAAAAATCAGTTACATAGTAATATTTAATTGAGTACAGCTAGTGTACAT
TTGTGTTTTCAGTTATATATATCATAACCTATTCCTCTATTCATAGATTTTTCACAAATT
TTGAAGAAGTTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTACTTTATATTCCACATATGAGA
GCAATCTTTCTGTGTCTATCTCTTTCTTTCTGACTCATTTCACTCAACATGATACTTTCC
ATGTTGGTCCACTTACATGAAAGTTTCATGACTTCATGCTTTCTAACAGCTGCATAATAT
TCCATTGTGTAGATGTACCAAAGTTTTTTTAGCCAGTCATCTGTTCTCGGGCCTTTGGTT
TTTTTCCAGATTCTGGCTATTGTAAACTAGCCAGAATCTGGAAATGAATTGCAGCCAGCT
GCAATGAACATACAGGTGCAGATGTCATTTTGACTATACTTTTTTGCTTCTCCGGGGTAT
ATTCCCAGGAGTGGTATTGCTGGGTCAAATGGGAGCTCGGTTTCTAATTTTTTGAGAAGC
AACCATATTGTTTTCCAAAAGGGCTGAACCAGTCGGCATTTCCACCAGCAGTGTAGGAGG
GTTCCTTTCCCCTAAATACTTTTAAGATCTTTTTGGATTAGAGATAAAGCTTGGTAATTT
TTTTTGGGTGGGGGGGGTTGGAGGGGAAAGGGGAGAGGTAATTGGGCCATTCCTGGCTCT
GAGCTCAGGGATCACGCTCTTGGTCTACTCAGGGGACCATATGGGGTTGCCAGGGAGAGG
ATCAAACCTAGATTGGTCCCATGGATTTTAATAATTGTCCTATATTTTCCTTGACATGTG
TTGCGAATATGATTTTCAGATACTAATCTTAAAATTCAAACTTCTTTCTAATTTAAACTT
AAATTTAAGATACTAATCTTAAAATCTTAAGCATGAACAGCAGGATGAGTTTCGGTATGT
GTATGGCAGGTCTGTCACCATGGGTCTCTCATAGTGCCTCATGTCAGAGCAAGCTGGCCC
CAAACCATTGCCCCCACCCTTGCTAGTGGGCTGCGGTCACTGAATTGGGCCTCATAGTGC
AAAAAAGGAAGCATGAACATGTGACCACACCAGTTACAATACAATCCTAATTCCTGTTTT
AAGTGTTTTGTTGATTTTTTTTCTAGGATGGGGCCACACAGTACTCAGGGATCACTCCTG
GTGGGCTCAGGAAACTATACTGGGTGCTTGGGATCAAACCCTTTCTTGGGTACATGCAAG
TCAAGCACCCTACTCACTGTACTATTTCTCCAACCCGTTTTTTGTTTCCTTTTGTTTTAG
TGTGGGACGGGGAGCAGGGAGGGGTTACCCAGTGTTGCCAGGGTTATTCCCATCATTGCC
TGGAGGTCCGTGTGGTCCCTCGAGGGATCAAACCCAGGATTTCTCTAGGTTTCCACCCTA
GCACTTTGAGCCATCTACCTGACTCTGGAATCATACTATTTTGCTTTTTTTTTTTTTTTT
TTTTCCATTTGGCTGGAGTGGACATTCACCAGGCTTTGCTCAGGGCTCACTTCTGGCTCA
GTACTTCAGAATCATCCTGGTTTGCTTCAGAGTACCATATGGGGTGCTGGGGATCAAACC
CAGGTCTGCTATGTGGGAGGTAGTCTTCTGTACTATGTGTTAGGCCCCTGGAATTGACCC
TTTATTATTATTATGACTATTATTATTTTGAATTTTACACTTTAAAAGAGTAAATTTTAA
GATACACAAATTAGTTGTAATATTTTAAATACCACCCACTACTTCTAAATATTATTAGGC
TGGAGAGATGGCAGTTAAAAGACTAAAAAGTGTATCTCCATATTTAAACTCAGTATATAA
AATAGGAGACTTTTACAAACCTAAGTTTAAGTTTCTGAGTATTGTTTAACTTATGTCTGA
GGCTTATTAGGAGATAAAATGGGGGTGACTAGTGATGGAAACTGAAGTTAAAGAAATAAA
AATCAATCTTAGAAACTGCTGTTTTCTGTTTTTCATTCAGAATGATGATGATAACCGAGC
CAGTGAGAGCAAGAAACCCAAAACAGAGGACAAGAATTTAGCAGGCCNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATACTCATGTCACAGACTGAGGTTTAGA
TACTGGATATGCAATGATGATAAAGCCAGGCAAAATACTTGCTCTTGTAGAATTTACAAT
TTTGTTTTACAGAAGTCATGTGTCCTACTAATCAAATTAGGGAAAACTAACTTGTCTTGA
AAGCAGGATAAAAGGGGGAAGGAGGAATCAATCACCCTTATATGTATAGAGAAATAAAGG
CTTTTTTGGGGGTTTGACAGGTCATCGAAGCAGAGTGTTGCAAAAGAAAAGGATTTGTTG
CCTTCTCCTGCTGCTCCTGTTCCTTCAAAAGATCCAAAAACTGAGCATAGCTCTCGGAAG
AGGACTATTAGTCAGTCTTCTTCTTTGAAGTCAAGTAGTAATAACAGCAACAAGGAGAAT
AGTAGCAGCAGCAAAAGCAGTTCCTCTGCATCAAAGCAGAAGAAGACTGAAGGGAAGACG
TCCGGTAGCTCGAAGGAAACTAAGGTAAGGTATCGGGAGGCTAGATTTTGAAAATCAGTC
TCATTCTTGTCATGTACTCCCCGTGTGCCCTTTTTCCATCCATCTCCTCTGTGTGTGGGG
TGGGTAACTCCCAGCAGTGCTCAAGGGATCATATGTTGCCACATATCAAACTATGGCCTC
CAATTGAGCTATGTCTCTCATCCCTTTCCTTTCTTCACTTTGTATTTTGTTGTTTTCTCC
TCTCCTTTCTTTTCTTGCAGTTGTTGGGTTTTGATGACTAGGGATTGCGCACACTTGGTA
ATGGTACTTGCACGGGGCCACATATGGTCCCCCGAACTCACGAGAGTGATCCCTCTGTGG
GGGAGGCGGGAGGAGGCCCTGAGTAGGGCTGGGTGTGGCCCCTAGAGACAACAGCGACAG
AGAGTGCCAGACCAGTGCCTGCGAACCCGATGATTTACAGTGCATTTTTTGGGCGGATAC
GAGAGACCGGTTCCGTTAGAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCGAGTACTC
GATGGATGAAAACAGGATGACAGTGATACTAAAGTTGAAATTTTGTTTCTTCCCAGCGGT
TCAAGAAATACTTATACTTTTTTGTTTAATCATCTCAAAAATTTAAACATATTCACATAT
TGCTTCTTCCCTCCCCCCCTTGGTTAGGAAAAGACTTCAAATAGCTCCTCAAACTGTCCT
TCATCTACACCAACTTCTGAAGCTTCTAAACCTCGGAGAACAAAGCTTGCCTTTGATGAC
AGGTGAGATAAATATGTTGTGTTTTGTTTTAATGCATTCAAGAAATTGTTCCTGGCTTGC
TCTTTAAGCTTATGTTCTCCCTTGAACATGTGTCTCAAAGAGCAACTCTCTTTAAAACAT
GATAAGGGAATAACAAATGACCAAAGGCTTCAGAATTAGATAGTTTGTCTACAGAACTGA
ACTTACCTGGGGTCACAGGTAAAGAGTGAGTGATGGCTGGAGGGTCCTTGGGATTTTGGT
GGAGGGAAATGGGCACTCTGGTGTGGATGTGGTGTTGGAATGATGTATGAATGAAAATGC
TGTTAACAATATAAATGACAGTACCTCAAAAAAATCAAATCCTTGCCCTCACCGAGCTGG
TAGTCTAGAAAAGAAAACATGTAAATAAACAAATAGCACTTTGTCAACTTGTATATGCTG
TGAAGAAAAAGTAAACTGGGATAAAAGAATAAATAAAAACTTGAAATTTCTCTCAGTGGC
CAGAAAAGTTCATACTTGCCTTATGATTCACAGAATATCATTTTAATTTGAAATATGTCC
ACTAGTTCAGATACTATTCCTTTAACTTTACTCTGTAACTTTCAAGGGGGCTCTGCTCTG
AATGATGTGCCTTTAATTAGGACCATACAGCTGCTGGTATCACTGTTTAAAGTAGATTAA
ATGTGTGAGAGCATTATTGGTTTTTCCTCTATTTTTGATAAAAGTTTGTTTCTGCTATCC
ATTTTATTTTCTCTAAGTCTTTAATACAATTTGGGTGTGTAATAGTATAAAATAGAAAGC
TTGCTTTCTATTTTCCTAAATACTGCCATGTGTTGACCAAAATGATTTATGCTTATAATT
TGAAATGAAGGTCTAGTAGTAACTTATTTTCTGTACTTGAGATTGTGGAAACCAAGGGAT
GCTAATACTATGAAAATATTTACCATTTCTTCTGGTGTAGTGTGTGGTACTGGAATGTAT
TATGCTTGAAGTCCTACCATTTACAATATTGTAAAGCATATGGGGTTGTAAAATATTTAC
CATTTCACTTACAATAAAAATTTACATTGCAGAAATTATTCAGCAGATCATTATTTGCAA
GAAGCAAAAAAGCTAAAGCACAATGCCGATGCATTGGTACGTAAAATTACATTTATGTAT
TTAGTCAGGTTAATATATGCTATTTTTTGTTTGTTGACAGCAGTGTGACTCTCATCACCT
TAATTCTTTTTTTCAGTCTGACAGGTTTGAGAAAGCTGTGTACTATCTTGATGCTGTGGT
ATCTTTCATAGAATGTGGGAATGCGTTAGAGAAAAATGCTCAGGAATCCAAGTCCCCATT
CCCTATGTATTCAGAGACAGCAGATCTCATCAAGTAAGTAGAAAAAACTTGCCACAGTTA
TTTATTTGTCCATCTAGGAAGAGGCTGTCACTTAAGAGGAATACATTCTGAGAAATCATT
AGACAATGTAGTTATTAGAAATTATGCAAATGTCACAGTATAACTACTCTAAACTCAGAT
GATACAGCCTGCTGCACCTCTGGACTGTATGGTTTTACTTATTGAAACCATTGTTACATA
AACAGTCTGTTGCTTACAGAAGTGTTATTAAATGATGCACCTCTTTGTAGTAAAGCAGAA
AAAGTACTTGATTTGTTTTGGCCTTAGATTAGAAGGGATAGACACCACCACCACCTACCC
CCCACCCCCTCTCATCAGCATGACTAAGTAACTCCAGGAGTGTCCCTGAGCTCCCAAGTA
CCTCTAGGGAAGAACCTATTGAAAAATAGGAGGCTGGAGAGATAGTTGATGGGCATGGAT
TACAGCAGGAGCCCAAGGTTCTATCCCCACAATTCATGGTGCCCTTAACACTGACAGGTG
TGGTCCAAGAACACTAGATACTAAAGTGGGCATCTTTGCCCTTACTTAGGTTAGATTCTA
ACATTTTAAAAACTGAATGAAGTAATGAGATGAAATATGTAATATTATGTTTGTTGTTTT
AACTCACAGATACACTATGAAACTAAAGAGTTACTTGGCACCAGACGCTACCGCTGCAGA
TAAAAGACTTACAGTACTTTGGTAAGTGTGTGTAGTGGCCTCTGCTACTTGACAAAGTAC
TACTACCAGATAGGCAATTCCATACTAAGTTGTGCTGTGTTATTATGAAAATTATTTTTG
TATCACCCTTTCATAAATTACTCTTGTATTTTGGGAGTAGATTCTCTGGTACTAAGGTAC
CATGAGGTTCTGGAGATCAAGTTTGGGACTCCAGCATGCAGAGCTTCCTGCCCCTGATAA
ATTTATTACTGATGAATAAAACAAAATAATTCAATCCTGCTGAAAGATTTTAATTGTCAG
TTCTTCATTTCTCTCTTTACTATAGTTTTGGTAGAGTGTAATTGATGTTAGAACCTTCAT
ATTCTTAAGTATGTCACTTTTCTGGGCTCTTTTTCACTTTTCTCTCTTCACACAAATATA
CCTTCCCTTAGGGAGTACATGTTTATCATGCTCAGAATAAACAAGGTAGCCTATTTGCTT
GGTCTTAGGGAGATATTATCAGGTCATTTGTTACTGGTATATATTTAATTTGATCCTGTG
TGGGATCAAGTTTTTGTTCTTACTTATTTTTGTTTTTGGGCCATACCCAGTGGTACTCAG
GTTTTACTCCTGGGGAGATATGGGAAGCCAGGGATCAAGCCCAGGTTGACCACATGTAAA
GCACACTCCCTATATTCTGTACTATCCCTCAGGCCCCAACCCTGAGTTTTAACATCTTGG
AATGCAACTAGAGATGAATTTTTCATGGTTGGTGCTCGCCTTGCATGCAGCCAACCCAGG
TATAATTCCCAGCATGTCATATGGTGACAGGAATGACCTTTAGCATACAGTCAGTAGTTA
GCCCTGAACACAGGTGAGCGTGGCTCAAAAACTTTCCCCCAGGTCATGGTGTTTATAGTC
CTGTGTGAGGAGACAAACACCAATCAAATAATCATAAATGTATATGAATTAATTATAAAT
TGTAAGAAACGTGTATATAATTAAAGAACTAGAAAGTAGGGAGACTTTTTCTTCAGGTAA
AGGGCACATTTACAAGGGTTGATTAGTGGAACAAAACTGAAAACTTTCTTTGATTATTTT
GGGGCCACGCCTAGCAATTCCCAGGGCTTACTCCTGGCTCTTTGGTGGTGGTGCTAGGGG
GACCATATGGAATGCTGGGGATTGAACCCAGGTTGGCCTTATGCAAGGCATGCACCCTAC
CCACTGTTTGATTGCTTAGGTCCCCAAAAAACTGAAAACTTGAAAAATGAGAAGACACTA
GTGAGAAGTCAAAGTGATGGGAGTGGTTAAATAGTGATGATCATGTAGGACCACTATGAA
TGATATTTCATAGAACCATAATGCTCACTGTTGAGGGTGGCTGGAGTCTAGTGCCCTAGT
ACAGCAGTTAGGGCACTTGCCTTGCACGTGGCTGACCCAGGTTTGATCCCTAGCATCACA
TATGGTCACCTAAGCTTGCCAGGAGTAATTTCTGTGTGCAAAGCCAGGAGTAACCCCTTA
ACACCATGAGTGTGTCCCCACAAAATTAATATACATAGTTGAGTTTCCTAATTAAGTGTT
TTGATTCTTTATAATTTGTCCTGGACTCTACTTCTGATTGTTCTTTCTTTTCTTTTCCCA
ATGTTTATTGTTTTGATGACATGTTGGAATCCTAAGAAAATGGTTTCTATTTTTTCAATG
TCAGCAAACAGGCTCATCGTAGGTTTCTTATTTCCAGATGTGCCCTATAGCACGTATACC
GTAATAAAAGCAAATCTTACAGTTTTGACTAAGGGTTGGTAGGGTTGACCTTTCCGCTAT
GGTCTGCTCATGTGAACTAGCTCTGATCTCTTGCATAGTGCAAAAGATGTGCACTGTGCA
GATGTGAGCAGTCTGAACTTGTGGTAAATGAGCTGCTCTTTTCTTTTGGCCAGCCTACGG
TGTCAGTCTTTGCTATACCTGAGGCTATTCAAACTGAAGAAGGAAAATGCTTTGAGGTAC
TCCAAGACACTGACAGAGCACCTGAAGGTAAGTTTGCAAAGAAGAGAGTTGATTGTACAG
AGGACAATCTGTAAAGTTCCTAGCTCTACCCTAGAAGTGTGTTCATCTTTTACCTGCCGC
AGCAGGGGAGAAGCTGCTAGGGGGAACTTTAAAATAAGTGTTTTCACAGAAAGTTTTCAA
ATATACATGGAGCTGATTATAAAATCAGTATTGCCACTTACAGTAGCTCTTTAATTGTGA
AATCTATTATTTTTTTTTATTTTTATTTTTTGGGTCACACCGAGCGATGCACAGGGGTTA
CTCCTGGCTCTGCACTCAGGAATTACTCCTGGCAGTGCTGGGGGACTATATGAAATGCTG
GGAATCGAACCCAGGTTGGCCGTGTGCAAGGCAAACGCCCTACCTGCTGTGCTATCGTTC
CAACCCCTCTATTATTTAAAAGGGTCTTTGTTTTACTTCTAGCCTTCCTTATTATCCTAG
TTTCCTAAGACATCTGTGTTTTTCACAACAGCACCACATTGATTTTCCTTAAATTGATTT
TCCTTAAATCCTGTTCTTGATACTAATTCACTAATTCACTAATTCACTTCACTACTTCAC
TTATTCACTTCACTACTTCACTAATTCACTACTTCACTTACTCACTTCACTACTTCACTA
ATTCACTTAGCTTCCTACCATGAACACAAGTTACTTCTCTCTATCTCTGACTCTTTCTCT
CTCCCTCTCCTCCAGGAAAGTTGCATAGTTCATGTTTAGTTGCTTTTCTACAGTGAGTGG
GACTCACTCCCCTACTTTTTTCTGTTTTGTGTTATTCATTATCTCTCCTTTTAAGTCTTA
GAAAAGAACACTCAGCTAAATCATTCTTTAACACATGTACACATGCACTTTTAGATTTAT
TTATTTATTTATTTATTTATTGGCTTTTTGGGTCACACCTAGCGATGCTCAGGGGTTACT
CCTGGCAGTGCTTGGGGGGACCATATGGGATGCTGGGGATTGAACTCAGGTCGGCGTATG
ACGGCAAACACCCTACCCATTGTACTATCACTCCGGCCCTCACTTTTGATTTTTAAATTT
GTAAGCCTTGTTAAGATTAGATCTGGGCCTCATGATTTTTAAAATAGTACTTCAAACGTA
GTGAGGATTTAAAACATTTTTGCTTCTTTCCCTCCCNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNTACATATTCTTGAGAATTAATCACTTTTCCTCTATGT
ATTTTTTTTACAATTTGAAGATGTGACAAACTTAAATTTTATGTACAGAAATCTGAGATA
TTATAGTACATTAATCCTCTCAAAGTTTGACTTGTGTTTGTTTGGGGTCACTCCCAGATG
TGCTCAGGACTTACTCCTAGCTCTGCACTCATCACTCCTGGCAGGCTCGGGGATTGCTCT
CAGCAGCACTCTGGGTACCAGGTACCAGGGGTTGAGTCTAGGCCTCCTGAAAGCATTTGG
CCTGTTGACGTTACTCCCCCTTACGTGTCTTCTTAACCAAATTTATAGGGGTAAAAATAC
AGATAAAAGAAATATGTCCAAAGAAAAAATAACAAAAAAAAACATATCTACAGTTGTGAC
TCTAGTGATAGGACAATCCTTTGTACATATGAGATCTTGGATTCAGTCTTGGTCAGTGTT
GACCCCCTGACCAACACTGCTGAGAGTGGCTCAAGCACCACTGTAGCCCCCACTACAGCC
ATTTTAAAAATGTACATTTAAATATATAATAAATGTAAATAATAAAAAACAAAGTAGTCA
CTAAATTTTTATTATTGTATACCACATTTGGCAAGTGCTACCAGAGCAGCTCCCAGTCAT
GCTGCAGGGACCAACTGTTGTGCCACGGATCAGAGCCCAGGCCTTACACATGCAGGCATG
ATGTTCTACCACTTGAGCCATACCCCCAGCACCAAATAACCTTTGAAAACTTTGGTTTGA
GTTTCCTTGTTTTTATGGACTTCAAGCATTTTCACACATTTTGGTACTGTTGAAAGTAGT
TTGCCAGATTCCAGTATACATACATATTTCTAATAAATATCATTGATACAAAACTTGAGA
TTATAACAATTAATTGAGAAAAACTATACCTCTTCTGTAAACACTAGATCATTAAACTGA
GGAAAGTGCTGGTAATTGTGGAGGTAAGAATAAATAATTGTGGTATTTAATCTGCTGCCA
TACCTTTTTTTTTAAATCCACCTAATTTTTTTACTATTTTCAAAAATTTCAAAGTAAATA
CCAAATAGATGGCAGGTGTATTGTGCTGGGAATGAAGAGATTCACCTTATAGGTCTTTGA
ACTCCTATCAAGTGCATGACTTTTTCCTGATCTCTTTTTTTGTTGCTACTTATTAAAATA
GAAATTTAGATAAAATTTTTAACTTAGTACTAATGAATAAACACATAGAAGAAAATGTAT
TTCCTGGTAATATCTAATTTAAAAGTATGAGGTTGCTATTTTCTTTAACAATCAGTTACT
TTTAGGGAAAGAAAAGTGTAGAATATCAAGCTTAATGAACTTGCCAACTCTTATTATTGC
ACATTTGAATTTCCGTAAACCTCTGATCTGTATGTAAACAAAAATACTAAATAAATACAA
AAAAATATCATGTATATTTTTCGCTTTATGTTTTTTACTTTAATTATATTCTATAAATAT
TCTTCTATTTTCTCTTCATACAGCAAAGCTGTTGGGATGCCATCCCCTGTTTCTCCAAAG
CTGTCACCAGGTAATTCAGGAAATTATTCTTCTGGAGCCAGTAGTGCTTCAGCAAGTGGT
TCTTCGGTGACCATTCCACAGAGGATCCACCATATGGCAGCCAGCTATGTTCAGGTTACA
TCCAACTTCCTCTATGCCATTGAAATTTGGGACCAAGCTGAACAGCTTTCCAAAGAGCAA
AAAGGTGAGTATTAGATCTCTGAAGTAAATTTGGTTGAAGAATGAGATTGTTAAATGGAG
CTTTTATGATCTGGTTGAATTAATAATAGTTTGCTGATTCTTGCTTAGTATCATACTAAG
TATACTGCCTTTGATTAGGAAATAATTTTTATTATTCTGGTGACACAAGCTAAACTAAAC
ATAGTTCTTGGTAAAAATCAATATATATATAAAATTTTTTTTTATTTTAAAAGAAAAAAT
TACTAGAAGCCAGATAGATAGTATAGTGGATATGGCCTTGTTCATACCCTTCTTCAAACT
CAAATCATCCCAAGAGTAGTGCCATGAGTGATTCCTGAGTACAGAGTCAGGTGTAACCAC
TGAGCCTTGACAGGTGTGGCCCAAAAACCAAAAAAAGAAAAGCTCGTTTTTATTTCAATT
TATTTGTCAAGGTTGTGGGGGGAGGGGTTAAGCCACACCCAAGTGATATTCAGGGGGTTA
CTCCTGGCTGTGTACTCAAGATAGCCGGAATTGAATTCTAGTGAGCTGTATGCAAGTCAG
TGGCAGTACACTGACTCCTGTACTGTTTCTCCAGTTCCAGTTCCCCTCTTTTTTTTTTTT
TTTCTTTTTGGGTTTTTCCTGGCTCTGCACTCAGGAGTTACTCCTGGCAGTTCTTGGGGA
ACCATGTGTCTTGCCAGGGATCAAACTTGGTTGGCCATGTGCAAGGCAAACACCCTACCC
GCTGTACTATCACTCCAGACCTCTCTCCAGACCCCTCTTACTTCCTTTAAGCAAATCGTT
ATTTTGGAGATTTGATTAGCTCAAACTCATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNCCTCATTTAATGAGTTTTTTTGATTTCCTAGAATTCTTTGCTGAACTGGATAA
AGTAATGGGCCCTCTCATCTTTAATGCAAGCATCATGACAGACCTAATTCGCTATACCCG
GCAGGGACTACACTGGCTTCGCCAGGATGCCAAATTGATATCTTGAACTGAACACATTCT
CGTTGCCTCTGATTTTCTCCACAACACTGTGTCACATCACGAAGGAAAACTGCCATAACA
CGCCACCTAGTCAACACTAAGAATGAGGAATGGTTTTCTCCTCCCTAATTCATGCATTGT
TTTTTTAAAAACCCAAAGCCATCATGTCAGTTGACTCCTTCAATATTCCCAATCTGAAGA
ATTATTTAAATGTTTTAAAATATGCAGCACATCAATAAGATGGTTTCAGTTATCTGTAAT
GAGTGAAATTCCAGTTGTAATTCATGACTAATTGAAATTTAATTTATTTTAATTTTTAAA
GTTCCCAGTTTGGGAATAGTTTAAAACTTAGGTTTTTTTCTGCCTATAAATTTACTCTGT
TAAATATTTAGCTAAGTTTAATGTAGACGTTTTTATTTATATACTTTGGGAGCTTTGTTA
CCTTATGTCTTTTGTGGTAGCTCTTCTAAGAGTAAGAGTTGGTTCCTCTAAAATATGGAC
ATATTCTTTCTACACCTACTACCTGATGTTATTTCAAATCTTAACTACAATTTTATTATT
GCAGAATTTTTATTTAGTATTAAAGATATTCTACATGAAATATCACTTAAAAATGAGAAG
ATGGCATTCTACATGGATGTAAAATGCAGTGTCTATTGAAATGTCTAATTTGGTATGCAT
TATTTCAAGAACTGTGAATGTGTTAATAACACTATAGCAATCACAAGGTGACTATAACTT
GCATTTAATGCATTACTTATGAGGGCAGGCAAACTTTCTAGGAGAAGTATGTTGTATGAA
GGGTTTCATATAAGGACAATCTTGAACTTTATGGATTTATTAAAACTATGTTCTTTCTTG
TTGCTGATCACTTGATGGTTAATTGAAACAGAAAGTTACTATTGAACAAAGGATAAGCTA
GCCTGAGGGTGTTGCCTGTGTCTCTTTTACTCATGATGTTNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1123, 3763..3976, 3978..4126, 4866..4873, 4875..4884, 4886..4894, 4897..4902, 4906..4906, 4908..4920, 4922..4938, 4941..5014, 5016..5053, 5055..5304, 8429..8473, 12679..12765, 21184..21220, 21321..21366, 21467..21521, 21622..21659, 21760..21922, 22297..22596, 22599..22619, 22622..22669, 22672..22755, 22759..22824, 22929..23315, 54940..55028, 55340..55583, 56607..56701, 57752..57815, 57916..58052, 58689..58760, 60653..60746, 62227..62270, 64103..64323, 66518..66645
1001..1123, 3763..3976, 3978..4126, 4866..4873, 4875..4884, 4886..4894, 4897..4902, 4906..4906, 4908..4920, 4922..4938, 4941..5014, 5016..5053, 5055..5304, 8429..8473, 12679..12765, 21184..21220, 21321..21366, 21467..21521, 21622..21659, 21760..21922, 22297..22596, 22599..22619, 22622..22669, 22672..22755, 22759..22824, 22929..23315, 54940..55028, 55340..55583, 56607..56701, 57752..57815, 57916..58052, 58689..58760, 60653..60746, 62227..62270, 64103..64323, 66518..66642
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved