Sorex_araneus Locus ENSSARG00000010335
snOPY snoRNA Orthological Gene Database
Sorex_araneus ENSSARG00000010335
Sorex_araneus
ENSSARG00000010335
GeneScaffold_1014
SNORA74
7742..7944
16949
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCCTCTGCCGGCCGG
AGAACGCCGGGCGTCAGAAGCGGCAGCCGGAGAAGTTGCAGAAGCGGCCCAGCGCGGTCG
CTTGGTGCAGGGCTCACAGCCGGGGCCCGCGCTCATGCTGGGACCCGCAGCGAAGAGTCC
CCGGGCCGGCCCGGGCGGGAACGCCTCATTCACTAACCCTGAGAGGGACGGACGGCGCCT
TTTTCCCGGCGCCTCGCGGCACCATCCCCTCTCAGCCGCTGCCTGGCTCCTCTGAAGCTG
CTGATCGCGCCGGCCTCCGGGAGCTCAGGCTCTAGCCAGCCGCCCGTGCGCCTTCCGCCT
CTGGAACCCAATCCGCCTCGGGGAGCGCCGCTTGGAGTCCGCCTTCCTTCACTTTCCCAC
CACCGGAAAGCTGCCGTCAGGTGCGCCTGGTTCCGTGCCGTAACGCTGTCGCAAAGCGGA
AGTGTGGAGCTTAGCGGGCCCCGGCGCCCGGAAGGTCAGCGTGTGAAGGAGCCAGTGGGA
ACGCGGGGGTTCCCGCTGCTTACTCCGGGGCAACGGCCGAGCCGACCACCCCGACCCTGA
GGCGGCGGTGAGGAGCAGGCGGACAAGTTGCTGGCTTCACCATGGAGGGCGGCGGGGGAA
GTGGCAACAAAACCACTGGGGGGTTGGCCGGCTTTTTCGGAGCCGGCGGAGCAGGATATT
CGCACGCGGATCTGGCTGGCGTCCCGCGTAAGTATCGGGCCTCGCCCGCGAGCGTTTCGC
TGTGCGGCTGGCAGCCGCGCAGACGTGCTGATCTATTTTTAGCGGGTGTTCCCACACGTC
GTACCGTGGCGGGGTCAGTGTGACGGTGCGTCCGCCCTTTCAAAAGCAACGATTTTGGGG
AATCATGGAGTTCCCTGAAGCAAGCTGTGGTTGCCCTGCGCTCTGGAACTGTTGCATTGT
CTTTTCCAAGTCAAGCCTCCTGCCTTTCCTTGGCTTCCACGCATGCTTTTGTGGACGAGA
GGGGGGCGATGTGTGTCTTTTGGGGGGGGGGGGTGGCTGGCCTGTTCGACGCTGATGAAG
AAGAGATCCTAGATTTACAGTTCTGCAAGTAAATGCACTTAAGGGAGCCCGCGAATAACT
ACGCCACAGTCGCATGTTTTAGTCGGGACCAAATCCTCAAAAATAAATATGGGGTCGGGG
GCGGAGCGATAGTACAGCGGATAAGACGCTCATTCTGTCCTTCCAGCCCCTTAGACCAAC
ATTTTAAAATCTCACTTGGACAACAATAACTATCTCCTACCTAACTCTTTGCTGCTTGAG
TTCCTTCAATTCACTTTTTACCAAGCAACTCAAGTGATTTTTAGTTGCTGAGCAACTAGT
TTAGTTGCCTGGTGTGGCCAAAAATAAAATCATATAGAAGAGAAAGAAGCTGCTAGAAAA
ATAATTGATGGAGAAGTTAGGCATAGAACAGAACTCGAACGACCAGTTGTAGACAAGAGA
CACGAGATTGTGGGTACAGAAGGGTGAACCCCCTGCCTGAACTCTCTGCTCACCCCTGTG
TTTCAGAGCGTTGTGTTTTTTTTTTTTTTTTTTTTGAAAATTGGTATTCAGCTGAGTGAA
GAGAACGTCGAGTAAGCCCTTTACAAAACTCTTGGCGGAGAAAACCTTGGGTTTCTCTGA
CGTGGGTGGAGAGATAGAGAAACATAGTCATTTAAATTAACGGGCCAGGTGCTATAAAGG
CAGTAAAACAAAATCAGAAGATGATAGGAGTAGGTAAGGAGTTTGTGTTTGATTACATGA
GGAAATGAAAGCTATTTTGATACTCTTTTCTTGGAAAATAGAATCATTTTAGTTGCTCTG
TAGAAAGTGAATTGAAGGAATGCAAACAGCAAAGGTAGGAAATATTGCTACTCTCCAAGT
GCGATTTAAGTTAGTCTAGGGGTGGAGGGATAAAAGAATGTGTTTGGCCCTTTCCTTGCA
TGTGGCTTACCCAGTTGGATCCCTGGCATCTCAATTATTCCTGGCATTCCCCAAGCACTG
CTGGGAATAATTTGTGATGACTGAGTAAGTAGTAACTCCTGAGTAATGCTGGGTTTACCC
CTCCACTCCCACCCCCAAAAATGTTGGTCTAAAATAGTAGGAATGGGGCCGGAGCAACAC
TACAGCGCCTTGCACACGGCCTACCTGGATTTGATCTCTAACCTCTCATATGGTCCCCAG
AGCACCTCCAGAAGAGATTTCTGCTGAGTGCAGAGCCAGGAGTAAACGCTGAGCGTTGCT
CAGTGTGCCCCAAAAAGCAAAAAAAAAAAAGCCATAGTGTGTATGCCTTGTGAATAGTCA
GCTGACATACGGAAAGATCCAAAGATTTAATTTAAAATGTGAAGTTTATTTTCGTCCATA
CTGTTTTCTGTCTTCAAAGTTATTAGGGGGATTGGGAGAGATAATACAGTGAGTAAGACA
CTTGCATGAAGCTGTCCAGATTAAATCCCCAAAAGACCCACCCCTCCACCCCTGAAAAAG
CATTAGAACTGAACCTTGGTGCTTTTTTTCTTTTGTCCTGGCTTCCTTTCATATGGTGAT
GACCCAAGTTTCATCCATCCTGTCATGTTTGGAACTCATGTGATTTATTGGCAGCACTAA
GATCTAAGCAGCTGCCTTACAACATTTATAGTTTATACATGGACCAAAGAGATTGCTCAA
GGGGCTAGAGCACATGCCTTGTTTTCTCTCCGGTGCTCCTTGCACTGCCCAGCGCAATTG
GATGCAGCCCTGGTGCTCCCCAGGCACTTTTGGGTATATAACTCGGGTTCCCCGCTGCTC
TGGATTCTCAGGCCTGAGCACCAGACAGAGGTCTGCATCACCTGGAGTTTGGTTTCCACA
CCCCAGAAAGTACTGTAGGGGAGGACTCCTCAAACATTAAAACTCAGCAATAAACCAAGC
ACTGTTTTCCTCTGGGCTTCATCTGTCTCTATCAATCTTATTTTGAAAATTTGTGTAATT
GTAGCGTTTTGTAAAATAGAAAAGCTTTATAATTTATTTGGGCTTATTTTTGCTTTTTGA
TCCATGTCTCTCAGTACCTGCTGAGTATGAGAGCCTGAAGAACCCCAGGAGGAGGCAATC
CCCAAAGTATCACAAGTGGAGAATGAGCTTAGAAAAAAGAAAATTTCTGTCAGGGAGCCT
GTAAATCAGTATTGCAAAACAATAGCCGCTTTACACAAAATGAAATCACTTTACATTTTT
GGTGTAATATGTTACTTTGTTCTTTCTCTAGTAACTGGGTATGAACCCCTTGTCTCCTTA
TTTAAATGTGGATCCCAGATATCTTTATACAGGTAAGGTCAAGACTATTTCATGATTTTA
CTAGTCTGGGTGGTTTATCTTAATTGTAAAAAAAAAAAAAGCAGTANNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGAGAAAAAAAATACTGGTTCACAGTT
TCGATTAAACCAATATCTTACAAGATGCCTTCTCCCTTAACCAACGTTGTGGGTGCCCCT
CCCACGACCTCCACCCCTCTTTTTTTTATTGAAGAGAACGTAAAAAGAGAGGCGCCCCTC
TCTTTCTTTTGTTTTTGGTGGCCCTCCCCGCCCCACCAGTATTTTAGAGATATTTGGCCC
TCCTTAACATCCTGCCTTATGTTGTTCACTCATTTTTAATGACTGTTTTGTCTTTATACA
CAGTAAAATGATACAGAAATAGGAGCTGCAGAATGAAAGCTATTTTCTAGACTAGTACTT
CATCAGCTGTTACTTCTCATGGCTTTCAATTTGCCTTTTTTAGAGCATATTCTCTAGTCT
GTCTTGTACTATTGTTTCATTTTTATCATTAACTAAGGCAAATTATAATCAGGTTTACAG
AAATAATATTTTGAACAAGAATTCCTCCTGAGAATTAATTTCTAATGAACATAGCTATAT
ATTTTGTGTATTTCATTACATTTTAGGTGTTACTATTGCATAAAGTTTTGCTCTTGTTGA
TTTAATAGTTGGATTTTAGTTAAAAATTTTATTTTTTGTAGGAAGCTGCTTTGAAATTTT
TAAAAACACTTTGCAAGTACTGTGTATTGAGGGGAGCTCAGCTTTATTTTATTATTATCC
CATTAGGATACAGATGAATTCATTTTACCAACTGGAGCTAATAAGACCAGGGGAAGATTT
GAGCTGGCCTTTTTTACTATTGGAGGATGTTGTATGACAGGTGGGTGTAATAATTTTTCT
CTTAAGTGTCTTCAACTAGCCAAAAGCAACTAGAATATTGTTTTCTTAAAAAATAATTCT
ATTTTTCAAAAGACTTTTTATTAAGTAAAAAATATGGATTAGGGATTAGGTTTTTAATGT
CAAACTCTATTAGTAGGATGAACTATTATTATGATTTTAGGGGCTGCATTTGGGGCAATC
AATGGTCTACGGCTAGGATTGAAGGAAACCCAGAATATGGCCTGGTCCAAACCAAGAAAT
GTCCAGTAAGTCTCATGTAATCATGTGATGTTGTATTGTGTGGTAATGTAGTGATATAAT
GTAGTAATGTCCTTATGTTCTTGGCTTTATGAACACAATCCTTAAGTTACAGATGGTTAC
ATTTTAGTTTGTTTCCTGGTTAGTTTTTGCCTGCCTGCCTGCCTTCCTTCCATGATAGTA
AATAAACATGTCAGAGAAATTTCTAGATATCAGTGATACTGTAATTTGACCTGAACACTT
GTTAACTCTATAGCTGAAATAAAATGAAAACCTTAAGCGTTTTTAAATGAAACTACTAAA
ACCTAGAGGTAGTTCAGAAAGAAATAAAACAGTCCTCTCTCAGGTCTTGAAAAATTGAAG
GTTGCAGAGAAGTGAAAAGATTGAGAACCCCAGAAAGTATCTTCATCCTGCTTGAGAAAC
ACACATGATTAGTTCCCTCTGGTACTCTACAAATAATATATTGTTTCATTTTGCATGTTT
TTATGCTTGCTGTCAGTGGGATCACAGTGTGTTCTCTATTGATTCATGGATTTGTTTGAT
AGATTTGTTGTGTTTTTTATTCTCTCTCCACTTTTCCTCCTTTGTTATTGTTGATGATGT
TGCAGTAACTGGAGGTTCTATACACACCTGGCTGTGATGCTTGTTCATTTTCATTTTTAT
TTATTTTTGGGGGGGTGGTCACACTTGGCAGTGCACAGGGGTTACTCTGGCTCTGCACTC
AGGAATCACCCTCAGAGGACCATATGGGATGCTGGGAATCGAACCCAGGTCGGCCACGTG
CAAGGCAAATGCCCTATCCCCCTGTACTATTGCTCCAGCCCCGATGCTTGTACATTTTTA
TCTGGTGCTCATATCAGGTGTGGTGCTTGTGGAGGGGTTACTGTAAAGCTTGCTAAAGGT
AGCACTTCCTGGCCATGTTGCCTATTTGTTGTTCTTCTCCCTGGGTTTCATACCTTCATA
CCTGCCTGCACTATAGTGGGAAGTTGCTTGCAGTGCCAGGGCTAAACAGCACAGTTGCCA
GAAATGACTTGTAGGACATTGTAACTTTTTGCTTGCAAGAAGGGTTCTCTGAACTACTAT
CTGGCCTCTTTTGCATTTGTTTTAGACCTGTTTTTCTTTTATAGTGTTCAGCCAGTAGGT
GGCAACAGATCTGCTAGAATTAGAACTGTCAAGGTTTTCATATTCTTTATAATCATAGCT
TTTTACTAAACAACCTTTTAGAAGTGATACAGATTTGTGTAGCATACAATATTTGTTTAA
CCGGTTTCTTTACACATAGTAAATAAATTCTTTTACTATTTTGTTATGATGATTCTATAA
TTTCCAGCAGTAGTCAGCTGTCCGGACAAAATCATTCCTGTGATGGTGTTACTCTGCTGG
GAGAGTAATGTCTTGCCTTTTTTTCCTGTTGCCTCTGTCACTGTTCTGGTGGCTGCTGGC
ACTGGTACAAGGCAGAACTGTGCTTCCTCGAGAGTGTGCTAAGCATTCACTTCGGCTGCT
CAGTGCTAGTCTGGGAGCAAACATGGTGTACTTTCTTCGGTATTTTACTTTGACAGATTT
TTTTCTTTTTTTTAATTACCATTCTGCTTTATATTCTGTACTAATTCTTCCATTAATTAT
ACTTAATATTCTAAGTATATCCCCCTCCAAGAAAAATTTACTTATAACATAGTTATAGTT
CTCAGATATAATGGCATATTTTTCTTATTTCTTAATCTCCTTTATAAAAATACTTTCCAG
ACTGTCATTCGGAGCCCTGTGTTTGATATGCTTTATGCGTTTAATAGTAAGAATCTTCCT
TACTTTATCCCAAATGAAGGCTTTTAAATTAATCTTCATTCATACTCATATCTGTAGTAA
AATCTAAAATTATGAGGGGGTATAAGCTAAGTTTTAAAGTTAAAGAAAACTTTGGGTGTT
AGTATTATTATTTTTTAATAGCTGCTGTTATAATTGTTTAACAAATGAGTCTGATTACAA
ACTATTTCTCTTTCTGTCCTGGGTAGGATTTTGAATATGGTGACTAGGCAAGGGGCTCTT
TGGGCTAATACTCTAGGCTCTCTGGGTAAGTAGCCCTCTTATATGATAATAAATTAGTAA
TACAAAGAAATGTACACACATCATTAACAGTTTTCTCAACCAAAATTCTGGTTCTTGGAT
ATTTTAAAGTATCTTTTACATGGGTCTCGCGAGTAGTTAGAGATACTGGGTTGGACAAGA
CCGTGGGACTGCATAGTGAGATGATACCTAATGTCAATACCATTTACAAGTGTATACTTT
GTCATTCTTTAGGTGGAGGTCACACTTGGCAATGCACAGTGGTGATTCTGGCTCTGCACT
CAGGAATTACTCCTGGTAGTGCTCAGCGGACTATTTGGGGATGCTGGAAGTCGAACTGGG
TGGGCAGCATGCAAGGCAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCTTGAAGATATGAAGCA
TGTAGCATTGTAAGTAATCGGTGTATTTAGTAGTACTTAGGACTTAATTAGCTCTTTTGG
TTTGTCATAATTCATAATAAACTTAGGCCCTAACATACGTGGTTTTCTTTGTAATTTGCT
TGAAAACCTGAAAATCTTCTTAATTGTGCAAAGGGAAGATGTCAGCATCACATTAAAAAG
ATAGGAAAAGTGTGTGTAATTTACTGTGGTTCTAACTTTTTTATGGTAGTATATTTTTAC
ACTATGAAGCCAAATTCAAATTTAATAGCACAGTAAATTTGCTGCTCCCATATGCTGCTC
AGATGTGTCTTACCCATGCCCCACCCATCCCCCCACCCCAGCTTCCTTTATTCCTCTTTG
ATTGCTTATGTACACAGAGAGCAGAGATTCCGAAATTTACTGGTGTCTTACCCCTTTTAT
AGGAAAAAAAAAATCACTCATGCTCATCCCATTTCCATGTAATATGAACAAACAGCATTT
TCCTAAATGTGCCCAAAGCCACTGCCACCATCCTGGATCTTTTCAGTTAGTTTGAAACAG
GAGAACAAGCATAGAGTAAATAAGCTGAAATAGGAAAGAAGACCCTTTATAGAAGTATTG
GAAACAGAAAGGTAATAAGATTTAAGTATGATAATGCTAAGAAGTTAAATGTGGGTATAA
TTTTTAAAAGTGGTGAGAAGTACTAATGCATTCATAGCTGGTAGGAATCTTCATAGGGAT
AGAAAAAGAGTGATTTGTGGGAAATCTTGTTAAAATTAAATAATACTATCATTACTGTAT
TTGCATTTGCAAGAACTTCATCTCACAATTTTTGAAGTTGTATTTTTCTTAAAATTCAAG
TATACAGGTTTTGGTTTCTGTTTTTAAATTCAAAGTACAATTCTTTATAACATAGGAAAA
TTAAAAATCTTCTTCTTGGGATTCCTTGGTGATACTTTGCATAAATAGCTACTATTAGTG
TTTCCTCTGAGTCTTTTCCAAACTTTTTCTGCATGTCCAGAGACATACATTAATTGCCTT
CATATACTAGTGAATATAGTTTTTCCTATTTTTGTTTTAAGCACATACATAATATTCATT
ATACGGAAAGTTATTTTCTTGATCCATCTCTTCTTGGTGTGCATTTTATTTATTGCTGGG
CTTTTGCTATTACAGCGTTCTCACTGATCATTATATCTCTTAATACAAATGGTGTTGTTT
GTGGGATATAGATTCTAAATGTAGTTGCCATGCAGACTTTCAGTGTTTTTTAAGTTACTG
AGTAGTCTGGGCCAGAGTGATAGTACAGTAGGTAGGGCATTTGCCTTGCATATGATCAAC
TCTGGTTCAATCCTTGGCACCCCATATAGTCCCCTAAGCACTATCAGGAGTGATCTTTGT
GCCCAGAGTTGTGAGTAAGTCCTGAGTACTGCTGGGTGTGGCCTAAAAGCAAACAAATTA
CTGATTAATTTCATTTTTTTCTGTAGCTTTGCTCTATAGCGCATTTGGTGTTGTCATTGA
GAAAACACGGGGTGCAGAAGATGATCTCAATACAGTAGCAGCTGGAACCATGACAGGCAT
GTTATATAAATCTACTGGTAGGTATTATTCAATGGAAAGCTATCTGTTTTATATTATTTC
ATTATTTTTCCAACTTTTATTGAGACACTGATTTATACTGCGGTCATGTCTTTTATTGTT
TTAATGGAAAGTTTCAAGATCTGATCTTACAACAACTTTCAAATGTACACTATTGTATTT
TTGTCACTATATTACATCCTTGTTAAGTTAGCTCTTAAATAGTGAATTGCATATTTGTTG
TTCTGAGTTTTTTTAAATTTATTTTAATGGTATTTTTCTTTTGGTTGGAGGAGGGGGTCC
CACATCATGCTCAATGGAGCTGAGAGCCACTCGTGGTGATGCAGTCCTACTGTGCTAGGA
GGTTCAGTGCTTGGCAGCGATGCATTTCCTCTAGGCACCACAGGCCACTATCGTGATGGT
TAGGGACTTCTAGGGCTATACTCTGGGAGCCTAAATGGTCATGTAGTCCTGGGGATCAAC
CTCAGGGCCTTGCACATGCTGAGCAGGAGTTCTGGCTTTTTGAATTATCAGCTATATCCC
CATTTCCTTTTATTGTTGTTGTTTGTTTTTTAAAATAATTTTTTTCCTGGCTCATTCCCT
TTGTTATTGTGATGATGGTGGGTCACACATGTTTTGTTGTGCTTTTCAGAGCCACAAGCC
TAGTTTCTATATTCTCATACTGGGTCAAAGTCACTAGGGAAACCTTTCACTTTAGTTGCA
GTGTGCTCACTAGGGGTCGTACTTGGTTGTGGCATTCACACATAATTCAGATTATAGAAT
TTTCTGGGATTCACATTCTTTAAGTCATCTTACCTGGCAGAGGTGCTTATATATTTTTAT
TCTTGCTGAGGTTCAAGCACTTCCGTTGCAGTGTTCATACATCTGGCTACAGTGGGCTGT
GGATCACACAGTTTGATGCCAGGGATCACAGGCAAGAGTTGACAGGACTAAGCTATCTCT
GTGGGCAGCACTGAAAATTGAACTCCTCGCCTCGTGCTTGCAGGACAGAAACTTGCCACT
GAGCCAGCCATTCTCCTGCCTCTGAATTACAATCTATTTTACAACTGTCAAAAGAAAACT
TACTATTCTCTGAAACCTTGTGGTGGTCTGTGGTTGTTTTTTTTTTCCAATCTTCAAAAA
CTATACACAATGTAAAATCAGCCCTATGAACCTTTTTTTTTTCATTTATTCCAAGTTCTA
AGTCCCCCCCACCATATTTTAAATGTAGAGTTCAGTAATACTAAGTATATATTAACTATA
TTCGTGTTGTGAAATCTCTACATCTTTTTCTCCTCTTAGAAAAGTGAAACTCTTTCACCC
ATTATAAGTTCCCTTTTCCCCCTTCTTTTAGCACCGGACAATACCGTTCTACTGGGTTTT
TTGTTTGTTTTGTCTTTCGATTTGACTCCTTAAGTACTAGATACAAGTGAAATCATAAAA
TTTTGGTTTCTTTTGTGTTTGGGGGTTTTTCTGAGGTGATGGTGACTGACATGTTAAACA
TATCCTAGTGTATCCTCATTTAGTTAATTCATGTTGTAGCAAATGTCTGAATTTGTTTTT
TTAAATGGTTTTGTGGTTACACCTGGTGGTACTCTAGCTGTGAGCTATCTTCCCATCATA
ATTTTTTTAGACTGAATAATACTTTATTATAATACTACTACTTTATAATAATAATAATCT
TGTATGATAATGAAACAAGGAGAGGAAAATGACCTAGTCACCTTGATTTCTTTTATGGCC
TCTCATTTTAGCAGTTGTGAAGTGTACCATGTATTACCTAAGTTGAGGTTTTTATTGCAA
ACCCCTTGAACTTCTTTAAGTGTTTTCATGGACTATTTTAAAAACCTTAGACTTTTACAA
ACCTCCAATCTTATGTACTGTTTTGGGGGTTCGGAGGACAGAAGAGAGTTGAGCCAATAT
ACTTAAATATACTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNATGCTAGAAAATATTTCTATTTTTCAAAGAAGA
AACTGCAGGCCACAGATGGCTCAGTGCATGCCCTACATGTGTAAAGGCTTTGGATCCCAT
CCCTGCACTGAATAGGTGGGGGTTGAGGGGAGAGGATACAAGTCAAGCAATTGCTTAAGT
TGATTGAATTTTTTGTTGATGACCCGTTTCGTTAAAAGGTAAAACTTTATTAGGGTTCAT
GTCCCATAGGTGAAGAGGTGTATTTAATATAAACATCAGAAGGCTGCAGCACAGTCCCTC
TGCTCACAGCCACTGCAGCTACAGGGGACAACCAATCCAGTACCATGAGAAAGCACCCCA
AGTTTTACCTAGATACACCCAGAAAAGGCTTCTGGGGCTTGAAGGTGGGGGGGCAGAGTG
CATCTTCCAGTTTCCAGGACGTCCTAGTAGTTTTCATGGGACTCCCTAAGACCCCAAGCC
CCAAAGAAACCCCTTGTTCCTGTCTCCCTAAGGGACCAGTTTGGTGTTCATTTCTGCTCA
GTTCCTCCCTCTCTTGTCCCTCAGCTCCTGATGGCAGCATCCTTCATGTGTCCTGTTATT
TCCAGAGTCCTCTCCAAACCCCAGAGCTTATCCAGCGCCCCGCCCCCCTTGAATTTTAGT
GCAATTATGGGTAAATTTTTCCTAGGGAACAATAATATGCAACTGCTGTTCCCAGTTTTA
AAGCCTTGTATTCGCAGTTTCATTGTTAACTCCCATTACAGAGGCTTGATATTAGATAAC
TCAAAAGTAGTGTGAAAATCCTTCCAAACCAGTAAAGTAGAAGCCATGTTCTTAGGGCAC
ATAAATCAAAGGACCACCTAGAAGGAATAGTTTGTAGGTATTTCTGAGGTTGCCTTCAAA
ATCCGGTGAATCTGTAACTGGCTTTGTCTTAAAGTCCTTAGGGAGGAATAAGTCTGAAGT
TGAAATGTTTGGTCCTAGAAAATAGTGTCTGTAAAATTACCTGCCCTTCATTAATCTCAG
TGGTGAGGATAACTGAAAGTTTTGCAGACTGCTTGATAGAACCTCATATTACTCAAGTTT
AGATCTTTTAATCGAACCACAGTGATGTCATTGCAGATGTTAGCATTTATTCATTCTATT
CCACTTAAGTTTTCCCATTTGGGGGGGGGGGGTATTTGTTCTCATCAGTTTGTTTTTAGC
TCCTACCACTTTGTATTAGCTTACTGGTCAAAGACAGAAGACTGTTTTAAATGGATAAAA
CTTAAATTGTCTTTTGGGTTTTCTTGTTTTTTTTTTTTATTTGGGGCCACACCTATCTGG
TGTTTAGGGTTTACTCCTAAACAGGAAGGATGAGAACCATATCGAGTTTCAAGAATTGAA
CCTGAGTCGACCATCTACAAGGCAAATGCTCTACCTGTTACACCATCTCTCTGACCCAAT
ACTTAAATTTTAAAATACTTAAATTTTACTTAAACTTAAATTTAAATACTTTAAATTGTT
TAATTAGATTAAATGTAATTTTATAATTTTTTTCAGTCACATTGAACTGACATCTTTAGT
ATGAGTTTAGTATAAATATGAGTTAAAACTAGGAAAGAAATTATGTGGAACTTCCAGGAG
CTATATTGTTTACTTTGATAAAAATTTTTCAGTGTTTCTGATCCCTCTTCCACATACCTG
ATAGTTGTATATAGATTTCTGCAGCTTCTTTTTCACTGTTTTAGAGGTAATTGGGTATTT
GCCATCAGAATGTAAGCAAGTCAGCTATCAGAAGTCACCAGACTAGAGACTCCTGGAGGG
AGTGACCCTTCGATCCTAATCAACCCAAGCCATCTGGCAGGACCTTCATTACAGAAATGG
TAGATCTGAAGTGTTGTCACTAAATTTCACAGAAATACTGGCTCGTAGCTAAAGGGCTTT
TAATAGTCACTGGACCACACCTCTGTTCCACTTTTGCCCTCCTAACAAAAGACTTGGAAC
AAGTATGCAATAGATAAGAGTCTGGATTACCTAATGTTTGTGGTTCCTGTTCTTAATTGG
TTTGAGGAGCATTTTCAGATAATTCCCCAATAGCATTTCAAAAAAAAATATACTAAGTTT
TTTTCACATGATAAATGGCTTATTTATTGTGAAGCAAAAACAGTTCAAAGTCTACTCCTT
AAGTACCTAGTTGCTTATTAGTTAAAGATTTTCTGCACATCAGTGTAGGAATGGAGCCAG
GGAGTTGGTAATTTGTAATTAGCACCGAACTCAGACTTGGTATTAATAGCTTATGTTATC
ACTATACCTCAGTTAGTGTTTGGAATATCTGTTCAGAGTCCAAGAGCTGTTAATACTATT
TCCAAAGAAGGTATCACCTTGTTTACATTATAATAGAGTCCATTAACAGAGCTGGTTAAA
TTCTAAACTACGTAACCAACAGAAATTATTGATCTGGTAGGGATTTCAGTAAGAAAATGT
AGGGCCCATGGATAGCTTAGAATGGCTGAGTTCCATGCCAGTAGTGAATTTCCCTTAGCC
TCCACTATTGTAAGGTGTAAGGCTCTGAGTCCTCTCTTAGGGAGGCCCCTTTAAAAGAAA
AATGTATCAGGCATTGTAGGAATAAATCAAAAAGAAAAAAAATGATTTTAGGTACAAATT
GTGAAATTAAAAGTGAAAAATGAGTTAAAATCAAGTATATTTGATTTAGTAGTTTCTCAA
ATTTGTGTCTTTTAAAACATTGAGATGTTTTTGGCCTCCTAACAAAAGACTTGGAACAAG
TATGCCATAGATAAGAGTCTGGGTTACCTAATGTTTGTGGTTCCTGTTCTTAATTGGTTT
GAAGATCATTTTCAGATAATTTCCCAATAGCATTTTTAAAAAATATTTTTTGAAATATTT
ATGGACATTTTTTCATATTTATGGACATGAATGCTGAGTTTTGCGAAATTTACTTAACTG
TTTGGTGCTAAATATACAAAACAAGGCTGTTTTCACATTCCTTTTCTCTCCCAGGTGGAA
TTCGAGGAGTAGCACGAGGCGGTCTAGCAGGACTAACACTTACCAGCCTCTATGCACTAT
ATAATAACTGGGAACACATGAAAGGTTCCTTGCTCCAGCAGTCTCTCTGAAGATTTTGCC
AACTCTTGGATGGAGGACACTTTAGTCATTCACGTCAACTTCTAAGTCAGTCTGGAATTA
ACTCTTTTATGTATAATTCGTTTGAAAAAAAAAAAACCGGAAATTCTGATTTGCTACAAT
GAAGATCATGGATAGCTGACCAGGACTGGCATTCCTTACAGCCATTGAGTTGAAACCAAA
ACACTCTAGTGGCTGAGTAATGTGGTTCTCTTCTCCTTTGGAGAAAATGTTTTACCTATT
CTGTCTTCTGTTCCCTGGAGCTGGAAAACCACTTACTCACAAAATTCAGGTCATGCTTGT
TACGGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTATTTCCTCTTC
ATTGGGATATTAGAAAAACGTGCAGTAGGCATTTAAGGTTTTATAAATAAGCCTTCAGGT
AAAGCTAAATGAAGAGGGGGCTGAGAGTGCCTTGCATACAGCTGATCCCAGGTTTGATCC
CTGGCATCCCCTATTTTCCCCCAGCACCAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1106, 3631..3637, 3639..3680, 3682..3691, 6066..6159, 6340..6424, 8426..8484, 10526..10636, 15834..15949
1001..1106, 3631..3637, 3639..3680, 3682..3691, 6066..6159, 6340..6424, 8426..8484, 10526..10636, 15834..15946
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved