Sorex_araneus Locus PTCD3
snOPY snoRNA Orthological Gene Database
Sorex_araneus PTCD3
Sorex_araneus
PTCD3
GeneScaffold_500
SNORD94
24392..24528
26992
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGACAAAGATGCCT
CCTGTGTGAAAACATATGCTCACTTCTTACAGCAGTCTCAACCCAAAACACTTCCCTTTT
AACTCAATAAAAAGATCCTTGAGTGAGCTGCCTATTTTTTGAAATTTATTTATTAATTTT
TTGCTTTTTGGGTCACACCTGAGATGCACAGGGGTTACTCCTGACTCTGCACTCAGTAAT
TACTCCTGGTGGTGCTCGGGGGACCATATGGGATGCTGGGAATCGAACCCAGGTCAGCCG
CATGCAAGGCAAATGGCCTATCCGCTGTACTATTGCTCCAGCCCCCTAACTGCCTGTTTT
TTAAATTTGTTTTTCTTTTTTGAACTGCCTATTTAGCATAAAAGTTCTTGTAGAAATGTT
TTAATTGGGTGTATTTAAACACAAAAAAAATAGGTCTTCCCTGAGTGACCTGAAGATTCT
GGTATATTTATTTAAGAAAAAAATTTTGGGACATTGCCTGTAAAAATATCCCCTTTAGAG
GCTATTGAGGAATCTGAATGGCAGTCTTTTAAGACTATTGCATGAGTGTCACTACAGACC
TAATGGACTTTTATGAGCCCCTCCACTCTGAGAGGAGAACCCATTGTTTGTTTTGTATGA
AAAGTCCTGACAAGGGTTAACTTGTGGTTTTTATTCTTAGGGATAAAGTGGCTGTTCTTC
AGGCTCTTGCATCCACAGTAAACAGGGTAAGTAAAGAATTCTGCGGTTTTGCATCTAGAA
TAGCTAATAACAAATGTGTTTATTATTCACACCTCTTTGTTATGCAGAATTAAATGTCTG
TGAATCCAGAACAGTTTTCTTAAATATTGTCTTAAGTCAAACAACTTTCATGTGACAAGA
GTCTTAAAAGTTTTTGAAGTGGTCTTGTTAGGATGATAAAGTCTGGATTTAGTTTCCTGT
TAGAAACTCTTGAAATTCTATATACCTACTATACCTGTGTTACTTACAAACTTAATATTC
TGAAGAGTGAGCTCATGCGATGTGTGTTCCCGGGGGATAGTTTGTACTGTCACGCAGGGT
TATCTTCAGATCAGCTGTGGGAAATTGTGTCCAGGCCACGCTAAGAATATGGAACGTGAG
TTTTAAAAGCCAAATATTTTTGTTCCATTGCCAGGCAGCTAGCTCTGTTAGCTTTGGATA
CCTTTCAGTGTGAGCATTGTAAATTTTTTTTTTTTGNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNTTTTAGTGTTTTTTTATTTGTATATGTATATATAGAAAGGCTTA
TATATTATACATTAGCATGTATATTCTAAATATAATTAAACAATTAAAAGTAACAATTTT
TAATTATCACTAAAATTTGCACGGTCCTCATTGAAAATCTCACTGAGGCTTGCACACAGA
TGGCCCAGGCAATCCCTGGCACCCCTGTGGTCCCCTGAGTACCATCAGGAGTGATTGCTG
AGTGCACAGCCAGGAGTAAGCCCTGAAGCAACCCCTGTGTGGCCCTAAGGCCTAAAAACC
AAAACAACCTCCCTGCCCCTCCCAAAAAATGTCACTGAAGAGACTCTTCTCCACAGGATG
TCACAGCAGTCCCATACGCCTTTCAGGATGATCCTTATCTCATACCAACATCTGCATCGG
AATCTGTAAGTATTTTTTAATAACTTACATTGCTCAGTTTTATTTTGCTCGTGTGGACAC
AAGAGTGCCTATGTATGTTAGAAAAACCTTTGAAAAATAGGTGCTTGTATTTTTGGTAGA
TTTTCTGAAATTAACCAGGAAGTTTTAGAGTTGGTCTGTGGAGAGGGTTAGGGTTAGATT
TTTAACACTTAACTTTCCTTCACATTGTAGCAACCACAGAATTTAAATTGTTTTTCTGTA
TCTTAAACTGTATAGAATATAACCTGATGGTGGGGAGATCCCTCCCAAATGTGGGGGAGG
ACACAACCCCAAAACAATAAATGGCCCCTCATGCTGACATGAAAAAAAGAAAAAAGTAAC
CTGAAGTCATCTCACCCATCACAATGGGGAGATGATTATATTATTTGTATAAGGAGTCCA
TGGTATTATACATTCTTTTTTCTTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNCCCGGATCCATACCCGTCCCATGGCAGGACCTCTCTTTATAGGGTATTA
GGCACTACAGCAACCGAAGTCTGAGTCAAGTAATTATGATGGGTGCCCATGAGTAGGTAC
ATTCCAGTCAGTCAACTCCCAGATACTAGTAGTCTAACATTAATGGTCTTTCTGTGTTTA
AGCAATAGCACAGCAGGTAGGGCGTTTGCCTTTCACGCCGCCAACCTGGGTTCAATTCCT
CCATCCCTCACGGAGAGCCCGGCAAGCTACCGAGAGTATCTCGCCCGCATGACAGTGCCT
GGAAAGCTACCCGTGGCATATTTGATATACCAAAAACAGTAATGAGTCTCACAATGGAGA
TGTTACTGGTGCACGCTTGAGCAAATCAGTGAACAATGGGATGACAGTGACAGTGCTCCA
GTGCTGTGTTTAAGCAAACAATGTTGCTCTGTGGTAAAATATAAAGAGGCTATAAGGAAA
ATAGAAAAGCAAGTAATTCACTGTAAATGCAAAGACCAGGGTTACCAATAAGTTTGACTC
ATAAGTAACCAGCCCTGACTTGGGGAATTTTGACAGTGAGAGGCAAAGCACAGTTGAAAA
GTTAGAGATAAACTCAGGGTTAGGGATCAGGGTTAGGGATTGTTGCAAGAGCACAGAGAG
CTTTTCTGGGAGGAGGAGAAAGGGAAGTTCACTGAGGAAGCCTGAAACACGTAGGGTTAA
TGTTTAACACGGTAGTGCTTAGAACTTTGTGAAATGTAGTTGGCCATGTTTGGTCCCCAC
GCCCCCACCTTGGTCTATTTTCCCCCGGTTCACATTTATGTGCTTGTTGTGTCTAGGGCG
AAAAACAATGCTGAAAGAATCTTTGCTCTAATGCCAGAGAAAAATGCACATTCCTATTGC
ACCATGATCCGAGGAATGGTGAAGGTAACTTGTTGGGACTTTATTTGGTTTTTCTTTTTG
AATACTTAATTAATTTTAAGAATTAAGAATTATTAAGAACTAAGAATTAAAGAATACTTT
CTTTTTTCGTTCCACTAAGTCAGGGTTTCTTAGCCTGAGAAGCATTCATATTTGAAGCCA
GTCATTTGTTGTGGGGGCTTCCCAGCGCCTCGTCAAAATGTTCTGATTCCCCCAGACCCA
CTGCCAGACTTGACCCTCACCACCCCAATTGTGACAACTAAAAATGTCCCCAGAATGTCA
CCTAAAGCTGCAGTTGGCCCCAGTCAGAAATATTAGATCAGCTTCATGAGACCAGGATGC
TGTTTTGTTCACAGCTATTTTCTCAAACCCTAGAGCATTAGATTTTCGGGTGTTGTTTTT
TTTTTTTTTTCAACAAATACATTTATTGATTGCTTAATCTTTTTTTTTTTTAATCTTTCC
CTTTTCTAGCACCGAGCTTATACGCAGGCGTTAGACTTGTACACTGCATTATTAAACAAC
AGACTCCATGGTGAGTATATCTGGAGAACTCCCTTCCCTCCTGCTTTCATTTCTTTTGAG
CCTATGAACTCTTTGAATCTTGCTTTAGTCACTGGCTTGCATGCATCTGCTTTCCTGTGG
GATTACTAAATGAAGGAGGACTAAAAGAAATGCAGAGAGAGATGGACACATGTGAGAAGA
GCTCACAAACCACATTTTATATGAGAGGACCACTGAGGATCAGTCAATGCAAATTTGTTA
AAGTAGATTCTCTTCAGCTGATGTTACACTTTCAATGCATGATCGAGCACACGTGTGACA
ATGAAGATTGAGCAAGTGATAGTGTACTGTAGATATTNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAT
CCTCCAGTTCCATCTGAGTTGCTGTCAATTGCATAAGCCTGTTGGATGTTTCTTGCAGCT
ATGTAGTATTCCATTGCGTGTCTGCCACACTGTGTGATCCCCTCGTGTGTCATCAGACAC
CCAGATTTGTTCTGTAACCTAGTTGCTTGCTAAGTGCTGCCGTGAAGAATGGTGTGCATG
TGCTCTTTGGAATTTTGTCCCTTTTTTTTATTATTTTTTATTTTATTTTATTAAATCACC
GTGTGGAAGATTACAATGCTTTCGGGCTTAGGTCTCAGTTATACAATGCTGAAACAACCA
TCCCTTCACCAGTGCCCATATACCACCACCAAAAAAAAAAAAACCCACACAGTACACCTC
CCATCCCGCCCCCCCACCCCCTACCTTGTAACTGATAAGTTTCATTTTACATTCTGTTTA
CTTTTGTTACATTCAATATTTCAACACAAACCTCACTATTGTTGTTAGGAGTACCCCACT
AGATTCAGACCTACTGTGAAGACAAATAAGGTCGCGAGGCCGCTACTGCGGCCGCGTGGT
TTTGAATTTCTGTACTTTAACAAGAAGTCCAGGGAGATTTCTTCCAGATATTAGATAATT
GCAGGCTTGAAAACCCAATCTGTGGTCGTCTTATTATGGCGGCCACCGCGCCCTTCATCC
CCGGAGAGAAAGAGGCGAGAGAGAGAAATACCTTTCCCCTCCTGGGCGGGCACGGGGCCA
AGGCTTAGTTCTCAGGCTGGAGACATTCTGCGAGGAGTTGCCCACGCCGAAAGAGGTTTT
GCTGGGTTCACGCTTGTGCAGCCCCCCGGGATCACATCTCAGCGGTGGGAGGGAATTTTG
TCCTTTTTGGCAGAAGGACAGAAAAGGAAACCAAGAAACAGAATTGCTGTATCCTGGCAG
CTGTATTCTTTTCTGAGAAATCTCTCAATTCTGTCATTTAAATAACTCCTTATTCCAAGA
TGCGAAAAGAAAAAAATCTCTTCTTTTGGTGTGTTTTTTTTTTCTTTTTGGGTCACACTT
GGCAGTGCACAGGGGTTACTGCTGGCTCTGCACTCAGGAATTACTCCTTGCAGTGCTTGG
GGGACCACCTGGGATGCTGGGAATTGAACCCTGGTCGGCCGTGTGCAAGGCAAACGCCTT
ACCTGCTGTGCTATCACCACAGCCTCAGAAAATATTTCATGACCTGAAGAATACACGTAG
ACCTTAGTGAGATCTAGGTTGCTTTGTTCTTTGATTTCTCGTAATTATAAAACTAATGTA
CTTACTGAAGTAAATTTTACTGGGTAAGCTTTGAAAAATTGAATTGGTTGGGTTGGAGAA
TCACAGCAGTAGGAATGTGCTTTTTCATTTAAAAAAGAAGAAAAAGATAGGAGATGTGAC
TCAGGTGTACAGCCCACGTCTTCCCTACCTGAGGCTCTGGGTTTGTGCGCCAGCACGGTG
TTTCCCCTGACGTCCTGGCCCCCAACATCACTGGCCTCTGAGCAGCTCCGCAGCCAACAA
TAAAATCCGTGATTGCAAATGGCGGGGAAATAGTACATGGCTTAAGGCACCTGTGTTTTA
TGCAGCCAACCACGGCTCAGTCCCCAGAACCACTTATGGTCCTCTCAGCAGTGCCAGCAG
TGATCCTTGTGGGCAGGACCAGGAATAGCCGTTGCACACTGCTGGGTGTGGTCCCCTGCA
CCTTCCTGAAAATTAAAAAGCAAAGTATCGTTCTAGTCTGTCCTTGTGTTGACATCTGAA
GACCTGCTAGGGCTCAGGGGTAGCTGGACCTTCTCTAAAATGCAATGTCTTTGGCCTACT
GACTAACACAGTTTAGGGAAACATTTATTAATCTGCTTTATTGAGACTTAGTTGTGGTGG
GGGAGGGGCACACCCAACATTGCATGAGAGACCTCTTGGAGCCACTTATTTTTTCTCTCA
AGCCTTTATTGAAGAGCAGTGTTCCATAACCTCCTTTATATATAGTCCTTTAATACTGTC
ACTATATTTAAAGTCATATTCTTTTGCAGTATATATGTTATCTTACTGAGCAGATTAATC
CACTAGATGTTAATAATAATCTCTATGTGGATTAAACAGGAGCTGCTGAAACAAATGGCT
GCACAGAATGTAAAACCAAATCTACAGACTTTTAATACCATTCTGAAGTGTCTACGAAGA
TTTTATGCATTTGGAAAATCGCCAGCCTTACAGACCTTTCGGGAGATGAAAGCCATCGGG
ATAGGTGAGGGGGTGCCTGGGGTCAGGCCACCAGGGGTTCTGGGTGAGAGCAGCTTCTCT
AGTGTGCTGTGATTGCATCTTTCTCCCATTTGGCAGACCTCCTGTTTGATGTTTCTTTGT
GTTCTCTAAGGCTGCTCATAGTGTTCTCTTAGTGGTGTCAGTGCTTTTATGGACTGCACC
TTAATTCTTGGGCAGATTACTGACTTCCAAGTTAGATCATTTTAAATCCTGTGATGTTTT
CTAGCATAATTATGAATTTGAATCCAATATTAAATTTGAATATACCTCGATATTCTATAT
GCTTTCATTTGTTAAGGTTATTTTGGGACTCGGTTCACTTTGATCCACTTTAGTGTTTGT
AAAGTGTTTTGTTATTTTTGTTTTGGTCCACACCCTGCTGTGCTCAGGGGCTTATTCCAA
CTCTGTGCTCAGGAGTCACTCCTGGCAGTACTCAGGATCTTGTGGGAATCAAATCCAGAC
CTCGTATATTGGACTATCTGGTCAGCCTTGCTTTGGTATTCTGAAATGGACATCAGGGCC
ATAGAGATTGCTTAGGGGGTTGAGTGCATGTTTTGCAAGCAGTGGCTAGATTTACTACAG
CGCACTGCAGGAAGTGACTTCTGAGCACAGAACTGGTTGTGAAGAGGGAAAAAAAGAGTC
ATATTACAGATAGATTAGTTAAGACATTTCAGTAACTAAATATAATTTAATCATTTTGAT
TCTTAAACCCAGTGAGCCTGTGGTTTCCTTATTCAAAGGAAAGAAGAGCCTAGTCTTTCC
TCTCAGTACTAGTGTCACTGTGTTCTCAGTTCACTGGGCCCCTATTCTGGAGAGCAGTGT
TGGACTTGTAGCATTTCTTCTTTTAATTTTCTAATCTTCCTGGTCATTTCAGAACCCTCG
CTTGCAACATATCACTACCTTATTCAGCTGTTTTATCAACAGGGTATGTATGAGATTATG
TTACATTGATACATGTTGAACCAGTTTCAAAAAAGAACGTCCCTTTAAATTCATATGACC
AGTTCTAGATCACCTTTGCATATGAATTAAGAATAGCTAATTTACCAATTGTTTCCGTTT
TGAGCAAAATACTATGAGAGCACTGACTGCATTGTTTTTTTTTTTTATTATTTGTTTGTT
TTTTTGTGGTGGAAATGAGCTGACTGGGAGGGGAGGCAAATCTCTAAATGTCTTCATACT
GTTAGAAGTGGTCAGAAGGCACAGGAGTTTGCAGTTTCTTTGTTCTCCAGAGCTATGTAC
AGTAGTACCTGGCTGTGCATGACTGTTAGGTCAAGTGTAAAACACCTTCATCCCAGTAGT
GCCCAGCGTCTACTAAAGTCACTGAGGCAGAGGAGTGGCCTTTCCTTTCCTATCACTGTC
ATGGCAGCTGTGACCTTGTTTGGAATCCCCATGGGAGAGCCTTGCCGAAAGGGTTGGGAA
ACCTGGAGAACACGAGAACACAGACCTGTGGCTTGGACACTGCCCTGTGACATGTTTGTT
CTCTAGTTGCTTCCTGCCCTCCACTGCGCCCGGTCCTGGGTAGAGGAAGAAGCAGAGAGA
CTCTATGCCATGTCTTGGGACTGGCACCAGAAATAAGCATAGAGTAAAGGCCATTTGTCT
TGTTTTGCAGAAAGTCCTTCAACAGGCGCCCCCCGCGTCATCTATGAAATCATGGAAGAA
TGACGGGAAAGAAATTCTCCCCAAAGGATGTGGATGATGGTAAGTACAGAAATAGCTTGT
GGAGGCCGGAGCACTGGTATAGTGGCTAGGGCGCTTGCCTTGCACTGGCTGCCTGGGGTC
CCATCCCCGGCACCCATATGGTCCCTCGAGCCCCTCCAGGAGTTATCCCTGAGCATAGAG
CCAGGAGTAAGTAAGCCCTGAGCACTACCAGTGTGACTCAAAACCAAAACATATATAGCT
TATGTAGTCACAGGAAGAACCTGCTTTCTGTGCAAGTTACTAGACACCTTGTGTTGAGGA
CAGGGTTCGATCTTTCGGTAGATGCTTTGCAGTACACTTCCTGTTGAGCTTTTAATTCCT
TTAGGTTTTTTTTCTTACACAACATTAATTCTATGACCAGGACTGTTATTGATGTTACTA
ACCCCAAAATACATCTTAACTTCGGTAACCAGACTCTTGTGAACTTTGATTTTCAGATAT
GTTTTTTCAGTCAGCCATGAAAGCTGTAAGTATCATTTCTTCGCTTTTGTTTTCCTTTCT
CCTTTGATCCATTTCCTATCGCTATCCTTATGCATTTTCTACGGCTGGGTGGTGTATCTG
GGAAGCGGGGTGCTCCCTCATTTTTTCACTCCATTATTTTGTTCATGTCTTTCATATTTC
TAAAATTGCTAAATCATCTACCATCCCTTCCTTACCTACTCTGTAATTGTGTATTTATTT
TCATATCTGTTCACATAAGGCATTTATATTTATCTAATAGGGCAGCCCCCAGCTGTGCTC
AGGGCATAGTTTTGGCTCTGCTCAGGGGCCACTTCTGCAGGCTCAGGGGAGCATATATGA
GTCTCAGACTAGGGTCAGCTGCAAGCAGGACAAGCACCTCAGTCTTTATTCTCTGTTAGT
AAATTTTAAGGTTGATGAGTGGCTTTTTTAAGTTTGGTGTTTCAATTTATCATGCTTCTC
AGGGGAAAAAAATTAAAGCAGTTTCTGAATTGATAAGCATAGCCCATTCCCTCAGCTTTA
TAATCTAGTTGGTGTCTTTCAGATTTTTTCTTAGTCTTAACACACATACCCAGGCACATT
TTGTGTTGTGCTGACACCGTGTAGCTGCATAGGTGGGTGGTACTAGGACTCACGGAGCCC
TGCTCCTGCAGAGAAGTTGCGGGGTGGGTTTGCGAGGGCACTGATGCTGAACCTGCAGAG
CGACCCTTCCGCATTCTGTGAAATGCTTCTTGTCGAAGGGATTCTAAATGTCTGTGATCA
CCGGATCAGAATTCTGTGTTAAATTTCACAGAATATGGGGTTTGTTCTTTTCCTAAGTGT
TTTATGGTTCATTTGCTCTTAACCAGTACTAGCACTGAATCAGTATAAATAACTCCACGT
TTGTTTATATAATGAGCCACTATTTGGATAAGGATTTTAGTGATACTTATTTTGCTGTTT
GCAAATTTTCAGTGCTCATCTCTGAAAGATCTAGAGCTTGCTTATCAAGTACATGACCTT
TTAAACACTGGAGAAAACTGGAAATTCATCGGATCTGACAATCGACGTAATTTCTACTAG
TGAGTGTGTTGGAAGTCTCTCCTATACTGTTGGGCTACCTTTTGGCACCCATGCTAGGTG
GGGCAGGCACCTTTCCTAGCCCTTCTGTCTTCTTACTCAGGCAGTGTGCCACTGACCTCG
TGATTGGGCACTTTGAAAATCAAGCAGTGGTAAGAATGCAGGCTGACCTTTCTGGTATAT
TCTTTAAAGCTTTTTCTCCTTATATATTTGAATCCACATATCTTTACCTTTTATGCTCTT
GTGTATTTTTGGATTTTTAGCAAGGCACATCTCTGAAACTTTCATCATAGCCTTTTTAGT
GGAGGATGCTATCTCCCCAGCAGTGTTTGAGAAGGGGCTTGACAACACTTGGCCCTATTT
TGTGGACCTGATGGTTTATTACTTGGGCCAATAGTGCTCAGGGTTGAACTCATGGCCTCC
TCACCAGCCCTTTGTTCCTCTCTGGCCACAGTCTCATTTGTTTTAAAGATAAGATACTGC
AACCCAAAGACTTCTTAAAACAGGTTTGCTCGAAGATGACATATCAAAACAAGAGTTGAG
GGAGATAGAAGGAGATGTTGTGTGCTGATAGTTCATGTTCAGATCCTTACTTCACATTGT
ATGTTTTTTACAAAGAAAATGGTATCCCTAGTCTGCTGAGAGTATGCTGAGGCAGTCTGA
ATGATTGTTGAAAGTAAGATTTTCATTGGCAAGCAGAAAACACAGTTAGTATACCCATGT
ATCACTGTCATCCCTTTGCTCATCTATTTGCTTGAGTGGGCACCATTGTGAGACTTGTTA
CTGTATTTGGCATATTGAATATGCTATGGGTAGCTTGCCAGGCTCTGCCGTGCGGGCGGG
ATACTCTCAGTAGCTTGCAGGGCTCTCTGAGAGGGACGGAGGAATCGAACCCAGGTTGAC
TGTGTGCAAGGCAAACGCCCTATCTGCTGTGCTATCGCTCCAGCCCAAAGGTGCTGAGCA
TACCCATGTAACTCAGAATTATTGCAACTTTGAAATTACAAGAAGGCAATAAATGTTTAT
TCATTCATTTTATTTTGGGACGACACTTGGCAGTGCTGGAGGCTGCTCTTGGCATGTGCT
GTGGGCAGGGGTCGAGGGAGTGTATCACTCCCAGTGGTTCTGAAGGTGCCATAATGTGCC
AGGGATTGAGTCCTGTCCAGCAAATACATGTTAACCTTTTGAGCCATCTCAGCCCTGTTC
CTCTATTATGTAGTGTTTTAAACAAACTCTTTCTTTCTGTTGCAGTTCTAAATTTTTCAA
TTTGATTTGTCTCATGGAAAAAATAGATGTCACCTTGAAGTGGTATAAAAACCTGGTACC
TTCAGTAAGATCATTTGTTAACTTGTCACTTACTGTGGATGTATTTCGGTGTGGGGCGGT
GCTAATTATTGCTTTCAAACTACATTTCTGTCTCTCTTAACTAGGTGTTCTTTCCTCATT
GCCAAGCACTGATAGATCTGCTTCAAGCACTGGATGTGGCTAATCGGCTGGAGGTGATTC
CTCAGATCTGGAAAGGTTAGTGTTAAGCTTATGTGTCTAGGCTTATACATCACTGTATTT
CATTTTGATTAACAAACATGCTGTCAATGTTAGAAATAAATTTTTGATTTTTGTAGCTTA
CTTGAGTATGTTAGCTTGGATAGGAATTAAGAGATAGGACATTTGTACTCTGTCACTGAG
CTCCATCCCTCGCCCTACAGACTTTCATTGTTAACTGAATTGAAGGCATTAGTTAAGTTA
GCTCCAAGGTGCTCTTGCATATCTTGCTCATCTTGCCTATCAGATTTTATGAGCTAAAAC
AATCCAGTAAGTTCCTTTATGACAGGGGTGAACTTGGAACTGTCTTGCAACATGACAAAG
GGGAGGTGAATGCTATGTAGCACACCCAAATCTGAATGTAGATGTCCCAACCCCAGAGTT
CCTGCTGGTGCTGTGCACCGTGTTGAACTGCTGAACAGTGATTCTTAATGTTTGTGAGAA
ACAGCTCTGTATGAACTATGTAAATAGGCTGCACAAAATGTTATATCTGTTCCATCAGGT
TAATGGTTGTCAGTTTCTGTCTAATTCAAAAATTAAGTCTTGCCAATGTAGTCAGTGACT
GAGTATAGAGTGGGACTAGGAGCTACTGGCATGGCTTGCTGCTCTTCTGTTCTAACCATG
AGTCACCCTGTCTTTCTAGAATAGTACTGGAGTTTATCAAATTAGCATCTCAGTTTCACC
CGCCCAAAAACATAGGTGACATTTAACAGTGAACCAATTGTGCCAGAAGGGTTTATGACA
GTGATCACTTTTTCACGTTGGTATTTATTTGTTTCAAGATTGTAAAGAATACGGTCACAC
CTACCGCAATGACCCTGAAAGAGGAGATTTTGACACTTATGGCAAGGGATCATCATGTGC
CAGAGGTAGGACTGAATCCCTGAGCTTCAGATACACACTGCCTAGTATAAACTCATGCTG
ACAGCCTTTTCAGTCCTCGTGGAGAATTCTGACACAGGTCCAACTTACTGTGTATCTAAA
AGAATTCTGTTCTGAAAGTTAATTCTCACTCCTCTAGTTCAAAGTAGACAATCAGTTGTG
ACATGTTAGTCACTTGTGGGATTTTCTTGTTTTTGTTTTCATATCTAAAATGAAAATCTG
TGAGGCCAGAATGATAGTAATTCCGGTAGAGCGTTTGTCTTGCACATGGCCAGCCTGGTT
TTGATATCCTGGCATCACATATGGTCCCCCCCAAGCTTGCCTTGGGTAATCCCTCAGCAC
AAACCTATCACTGTGTGTGGCCTAAAAACCTATAAAAATAAAGTGAAAACTCGTAATTGG
ATTATATGTGGAAAATTCAGCTCATCAGATTACACATGCAGAGCGCCTTTTTTTTTTCTT
TCTGTGTTTCCATGTGTGCTGTCCCATGTGCTCAAATGGCAAATGGTAAAATACGTCACA
CGATGGTCATGTGGAATCTCCTGAAGTCGTGAAGCGAGTGAGTTTGGCAGTTCTGCTGAT
TCTCCGTCTCTCAGCTTCAGGCGGCATTCGCTGACTGTGCTGCTGACATCAAAGCTACAT
ACGAGAGCCAGGATGCCAAACAGACTCCTGATTGGCCTGCCAACCCTCTCAACTGTATAG
TCCTCCTCCTCCTACGGGCCGGGAGAACCCAGGAAGCCTGGTGAGTACAATACACAAATA
TCACTACAAATGTTTGTATGTGGACCTCAGAAAACACTGAACCTGGTTAGTAGAGGTTCT
CTAATTGGACTGTGTGATGTCTTATATATCTGGAGACAAACGAGGATGTTTACCGAGTCC
AATGAGAAATTCCAAATGTAGTAAGTCTTTGCTTACCAGGAATGAGTAGTTGAAAAACAA
AAGCAGATCATTAAATGCTGTCATTTCATTTAGCTTTGACAAGAATGTTTATCTCCATGG
AGAGTATCATGCTAAGTGAAATGAGTTAGAAAGAGAGGGACAGACATAGAGGGACTGCAT
TCATTTGTGGAGTATAGAATAACATCACATGAGGCTGACATCTAAGGACCGTAGATACAA
GGGCCAAGGGGATTGCCCCATAGCTGGAAGACTGCTTCATGAGCGGAGGGGAGAAGGCAG
ATGGAATAGAGAAGGGATCACTAAGAAAATGATGGCTGGAGGAACCAGTTGGGATGGGAG
ATGCATGTTGAAAGTAGATAATGGACCAAACATGATGATCTCTCAGTGTCTGTGTTGTAA
GCTATAATGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNTCTCATGCATTAGAAATAATGTTACTCCAGAGATAAG
TCGAGTCGAAGAAGAACATTCATTCATTGGGCTTATTTTCTTTCCGTTTTTGTTTTTGGG
CCACACCCAGATGTGGTTGGGCGCTATTCTTGGCTATACTCAGTGGACCCTGTGATTCAA
GGATGGACTATGGGTCTCTGCATGCAAAACTGTGCTTGGCTCATTGAACTATGCCTCTTT
CTGTGTGTGGAACTTCCTCTGGTCAACGTTTTCTTTGGTGTTGGCAAGGATTGTTTTTTA
CTTTTCTCATCGGCATAATGAGTCCAAAGGAAAAGCAGATGTAGAAGAAACGGCGTGGTT
AATTGGGCTTTCCATTTCTTACCTTTCTGTTGTCTCAGGTAGTCACTTAATTCACTTAAA
CTAAATAAACCAAAAATACCTGCTCTTGAGGGCCAGAGGACAGTTTTCCTGGCTGGAGTG
CATGCTCTGCATCCAGGAGCCCGGGTTTGACCTCATGTCTTCAATGGTCCCCAGAGCACT
GCTGGGTGAGGCTCCAGAACAAGTATTCTTCCAAGCATGTACTAAACATGGCCTCGACTA
GAACCTTTCTGGTTTGTTGGCACTTACTTCACATACTAATTTTTACATGGGTGTTACTTG
AGCACAAGGAAATAATTTACTTTGAGAGGCCAGAGAGATCGTATAGCAGGCAGGGCACTT
GCCTTGCATGTGGCTGATCTGCATTCATTCCTAACAGCCCATAGGCACTCCTGAGCATTG
CAGGTATGACTCACAAACCAAATATAAATTGAAAACTTATTTTGAATATGATCATGAGTA
CAAAATGCAGCTATTCACAGCCTTAGGGTAAAGTTGATGGATGCTTCACTACTTCAGCTC
TTAGGATCCTGAGCCATCCATGTGACCTGCTATGATGATGGCGAAAGAAACATGTGGTGC
GAGACTTTGGTTGGCGCACACCCGTTATGAATCAGGCTGTGATGATTGGCGCAGGGGTAC
GGACCTCAGCTGAATCATGGGAGCTGAATGTATGTGTTTTGCCTTTGTCCTGCATGTGGC
AGGTTGATGGCAGGCACTTACATGAGACTGATGCCTTAATCTGAGCCTGCTCTTCATAAT
GTAGTGTTAGTTTACAACTCCTGAGTTACATGAGCGTGCGGCTCATTGACTTGCATCCTT
CTCTTCCAGCCACCATGAGTAAAGAGAAAACAGGCCATTCTCAGCAACAAATGAAACTTA
GTTTGTGAGACTTCATGAGCTGTGTAGGGTGGGAGGTGTTGGCACACCAGGGGAAACTGA
GCCAAGTCAAGGGTGAGTGGCAGGGTGGCTCACAGATTGACAATCTTTCTGCTATTTTAC
CTTCAACAGGAAGATGTTGGGACTTTTCAGGAAGCATAATAAGATTCCTAGGTAAGTTGA
AGTTAAGCCTGTTTGGGCACATTGTGGAATCAGCAGAGGTCACTCTTGTGAAGTGACTGG
AGTTACTTCACAAATCTCAACTCTGGGAACTGGGTGTCCTCCACAGGCAGGTGAACGGAA
AAGCACCCACCACTGGAAGCCTGGCTCCTTAAACCAGGGAGTGTGAGTCCATCATACAGA
TTTTGTTTTAGGGAACCCAGAGAGAGTACAGGGGCTCAGGCTTTTGTTTTGGGTCACACT
AACTGCAGTTTGATCCCCAGCAACACATATGATGCCCCAGACATAACTTGGGGTGATTCC
TGAGCACAGAAGAGGAATAACCCTTGAGTACTGCTGGGGTGTGGCCAGAAATCCCCCAAA
TACATTTAGTTCATCATAGAAGTTTGATTTATATATCCGACTTACCTGGAGTCAAAGTTT
GCCAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNGATGAAGACATACAGAACTGCTGTCATATCTCTTTGGTCTTTAGTTAGCCTTGTAT
CACATTACTTCTAAAGCTACTACGGAGAATTTTTGACTGAACTTGTGTTTCAACAAGTTT
TAACAACAAATTTATTGTTTTAAATAGATTTTTGCACTTAAACTATGCAAAGATTAGTTG
TGTTGAAGAATCTTCCTGATACTCTCCCTTTAATAGAAATGATGTGCTGAAAGAACTCAT
GGATAGTGCCAAAGTTTCCAACAGTCCTGCACAGGCCATTGAGATTGTGAAGCTGGCACA
GGCGTTCAGCTTACCTGTCTGTGAGAGCCTCACTCAGAGAGCGATGACTGACTTCGAACT
CAGCCAGGAGCAAAAGTAAGTGGGTCTGTGCCCCCACCAAGAAAGATAAAAATGAGGGGC
TGAAGCGATAGCACAGCGGGTAGGGCGTTTGCTTTGCACGTGGCCAACCCGGGTTCGAAT
CCCAGCATCCCATATGGTCCCCTGAGCACCGCCAGGGGTAATTCCTGAGTGCAGAGCCAG
AAGTAACCCCTGTGCATTGCCAGGTGTGACCCAAAAAGAAAAAAAAAAAGATAAAAATGA
AGCCGCAGCTGGAAAGATAGTACATTGGGTTGGGCGCCTGCCTTGCATGCGGCGAACTGG
GTCAACTCCGAGCACCTCCAAGAAAAATTTCTGAGTGCGGAGCCAGGGGAGTAATCCCTG
AGCACTGCTGGGGTTACTCAGATTGCTACGTTAAAATCTAAAGAAGTAGATAGCTAGAAG
ATGCTATCTGCCCATTTAGGTATCTTCCTGGGAGAGGACAGGGTTAGTTAACAGTTGTTT
CGTCGTAGGAGTTGGGGGTGTCTGTGGAATTGATTGCTAGAACGTTTTCATCTGTAGAGT
TCATAGCTGCAATGGAATTGTAGGTAAACCTTTGAATAACTCTGTTTATAGAGAGGCTCT
GGGAAACCCAAGTGCACTGAGCAGTGACAGCGAGAGTGACAGTGACAGCGACATTGGTGA
AAGCAAATGAAAATGAGATGAGAAGCAGCACTGGCTGGCACAGTTGTTGAGGACTACACT
GTTAATACTGAATCATGATATCAAAGAAAAGAGACGTCAGACTTGGTGTACTGGGAACTG
ACAGAAGTCTTACGGAATTCCTGACTGGATACTGGCTGTCCATTCTGGCTGTGCCGTTAT
TCATGCTATTCATGTGGAACATTCCAGCCCTTCTCATTTCCACACACTGAGGTGCGCTGA
TTCTGGTGTCACTATAAACTCTGCACTTGTGACAACAGCACACTGTCATCGATAGCCTTT
GGCTGGGGCTGTGATGCTGGGAACGTCGGCTTCAGAAGAGGTGGTAATCAAAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1045, 1976..2044, 2586..2690, 2791..2914, 3015..3130, 3231..3292, 12296..12383, 12849..12909, 13157..13161, 13164..13178, 13181..13183, 13186..13188, 13191..13214, 13237..13254, 16059..16203, 17092..17142, 17830..17879, 17882..17922, 18268..18271, 18361..18384, 19332..19438, 20685..20763, 20864..20954, 21758..21791, 21793..21844, 22454..22599, 24789..24830, 25836..25992
1001..1045, 1976..2044, 2586..2690, 2791..2914, 3015..3130, 3231..3292, 12296..12383, 12849..12909, 13157..13161, 13164..13178, 13181..13183, 13186..13188, 13191..13214, 13237..13254, 16059..16203, 17092..17142, 17830..17879, 17882..17922, 18268..18271, 18361..18384, 19332..19438, 20685..20763, 20864..20954, 21758..21791, 21793..21844, 22454..22599, 24789..24830, 25836..25992
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved