Sorex_araneus Locus DKC1
snOPY snoRNA Orthological Gene Database
Sorex_araneus DKC1
Sorex_araneus
DKC1
GeneScaffold_4693
SNORA56
8733..8861
10624
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCT
TTCGCGCGGGATCTCAGGGGCGGCGCTTTGCTTTTCCAGTCTCTGTCGTGCCGAAGAAGC
ACAAGAAGAAGAAGGAGCGGAAGTCTGTAGCTGAAGAAGACGTTGCCGTGAGTAGCGATA
GGCTTCGCTTGCGCCGGAAAGCAGAGTCCTTAGGGGCCCTCGCCACTGCTGGACCCTCCG
GGCCGCGATTGGTGTTCCCCCGCCACCTGGTTCCCGTCACCTTCCCGGGAACCGGGTTCA
TTTTTGTCCCTTGGAGCCCTAGTACAGACTCGTAGAGTGCCCTTTTTCTATCTAAAGAGA
GTTCTGTGGTCGTGATGGACTTACTCCCAATGAACTGGGCCACTAATACAGTGTGTTTTT
CTCCCGTGGAAGGAAATACAACTTGCTGAAGATTTTCTTATCAAGCCCGAATCCAAAGTG
GCTCAGTTGGACACGTCTCACTGGCCTCTGTTGCTAAAGGTAGGTCTTAACGGTGAGGGT
CTGTTTGTGGCCTTTTTGGTTTTTGCAAATAGTTGATAAGTGCTGGGGTGAGCATCCTTG
CTGTGGAAATGAATGATTTGTGGCCCATCAAAAAGCAGGCTTCTTCCAGGCCTCAGAAAT
TAGGGGTTGAGTTTCGCGGATCACCCCTGCTGAGTACCATTTGTTCAAGTTCAGAATTTA
ATCACCTTCCAGGCAGTGCAGCAGTGTGGCCCGCTCTTGGGTCAGGACCGCTTCAGTCCT
CCAGAGCTTAGTCTTTGAAGCCACGTTAATTAGGGTGAGCCCCGATGTGATGTGTGGCCA
ACCTTTTTTAAACACTGGGGCTGTTTGCTCAGAACAACTTCTCCCAGGATTGCAAACTGA
GGGCTGTAAGAGGCAGTTTGATTCAGGAGAGCATTTTATCCACAGACTATAGCAGATTCT
CAGGAAATCGTTGATGCTTTATTGGATTGAGAAACGCTAATTGGGTTGAGATTGAAAGTT
CACAGGTGACTGACATCCTGGGAGGCTGGTTACAAAAGGTTTTGGCAGAGTAAGTTGCTG
GAATATCCATGTACAACATCACAGTGAGCGGATGCTATGAGTCTGAGCATGAGATTTGCT
TGCGGGTGTCAGCGCTGTTGAGTGGGGTCTGCCATTGAGATAGCAGCTGGCTTTGGAGTT
AGGCCCCCCGGGCACCAGGTAAGCAAGGTCTTGGTGGTGTGGAATTCAGGTCTCTTGGTG
GAATAGTTCAAGGGATTTACTGTGCTGAGTACTGTGGAATCAAGTGAGCTAGCTGTTTTG
AAGATTGCACTTCTAGTTGAGTAGAGAGCCTGGGAAAGGAAGGGCAGGAAGGTGCTAAGA
TGAGAGAAGAGCAGAGAAAGGAACATGACTTGTCCCTATTTCTCTGTGCAATTGTATTTT
GTTCTAAGAAATCAAAACTGTTCCATACTCATAACATGCCCGGTGTTAACCCAGTTGGTT
CTACAGGAGTCCAGAAAGTCTCGGGTGGTGATTAGGTTGGTCTTGTGACTTGTAAGCTGG
GGCCTTTTTCCAGCATGTCATGGCAGCGAAACGTGGGAAGGGATGTCAGTTTACAGACCC
AGATGCTAACCATGTTATTGCTGATGGCACTGCTGTGTTTGACATGTTAATGGCTTATGA
CGTTTCTCCTGTGTTGTGATTGTTTTCTAGAACTTTGATAAGCTAAATATAAGAACAACG
CACTATACCCCTCTTCCCTGTGGTTCAAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTCCTGGGTGGAAATAG
TTCAAGGGAATTTACCTGTGCTGAGTCCCTGTGAATCAAGTGAAGCTAGCTGGTTTGAAG
AATGCACTTTCTAGTTGAGTAGAGAGCCTGGAAAAGGAAAGGGCAGAAGGTGCTAAGATG
GAGAGAAGAGCAGAGAAAAGGAACATGACTTGTCCCTATTTTCTCTGTGCAAATTGTATT
TTGTTCTAAGAAATCAAAACTGTTCCATACTCATAACATGCCCGGTGTTAACCCAGTTGG
TTCTACAGGAGTCCAGAAAGTCTCGGGTGGTGATTAGGTTGGTCTTGTGACTTGTAAGCT
GGGGCCTTTTTCCAGCATGTCATGGCAGCGAAACGTGGGAAGGGATGTCAGTTTACAGAC
CCAGATGCTAACCATGTTATTGCTGATGGCACTGCTGTGTTTGACATGTTAATGGCTTAT
GACGTTTCTCCTGTGTTGTGATTGTTTTCTAGAACTTTGATAAGCTAAATATAAGAACAA
CGCACTATACCCCTCTTCCCTGTGGTTCAAACCCTCTGAAGAGGGAGATTGGGGACTACA
TCAGGTAAGAAGCATATGGGGAGCGCGGGCCTTTCAAACCCTCTCCATCTGTGCTGATTT
CTGTTGGCTTGGGGACTACACCCAGTGGTGCTCAGGGCTTATTTCTAGCTCTACACTCGG
GCTCCATGCTCACTCCTGGTGGGCTACCTGAGGCCCTGTGTGGTGTCAGTGATAAAACCA
GCTCAGTTGCATGCAAGTCAGGTACCTTTCCTTTTCTGCAGCCCCTCAGCATTTCGGTAG
CACTGTCCTAGATGTGTAACTTGCACCACTATGAACACTGTCCTGGGCTTCAGATTGCTT
TTTGATTCGTGGGTGAGCCAGCAGTGCAAATCATTTCTTCTCCATTCTAGAACAGGTTTC
ATTAATCTCGACAAGCCCTCCAATCCCTCTTCCCATGAGGTGGTAGCCTGGATTCGACGG
ATACTTCGGGTAGAAAAGACTGGACACAGTGGTACTCTGGATCCCAAGGTGACCGGCTGT
TTAATTGTGTGCATAGAACGAGCCACTCGCTTAGTGAAGTCACAGCAGAGTGCAGGTATG
TGGAATGTCCTTTCTTTCCTGTTTTCTTTACCTTTTGCATTTGATTTTAGTGATTTCTCC
CTGGCACGGGAGTGGAATTCCTGGTCGGGGTTACTCTTGGTTCAGTGTGCCTTCTACCCT
GCCAGATTACCGGCCACCCTCCTCTTGGCATGCTGAGGGCAAGACACGTAGCTCGCATGG
CTGACTGCTATTGCTAGCACTGCCGTGCCAAGTCCTGCCCAAGTCCCCGTGGTAGGCTCC
TCATGCTCCCTACCTGGCCTCATGTACATTTGAGAGGTGTGTCTTCATTCCTTGCTCACA
GCACCCCCATGAAATCTGTGTGAGTGGCAATGTTACCAGAACGTGAGGTGTACTCATTGG
TCTGCTTTCCTGCTGCCCGAGCTGGGCATGATGGGAAGGAGCAGCTGTGGGAGAGAAAAC
AGAAAACTCAGCGGCGTGCCTGACTACTCTTGATCCNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAGGGTAAGTGCTGCTGCAGGGAGAAT
GCCTTTGAGGGCATAAAAGAGTTAGGGCCATTTTCAGAACCATTCTGTGTCTCTCTTGTG
GCCTTCTACTCTGCAGATGGTCCCTTTGATGCGCATGAGAGGCCAGGCCTTGAGAATCTT
GGCTTTGCTTTCAGACTCTGGAAACTCTGACAGGTGCCTTATTCCAGCGCCCCCCACTTA
TAGCTGCAGTCAAGAGGCAACTCCGGGTACGCACCATCTATGAGAGTAAGATGCTCGAGT
ATGACCCGGAGAGGCGATTAGGTGGGTCTTTGGGGCTCAGTGTGGGTGTGGCACAGGGGG
AGCTCTGGTTTTCTTGGCCAGGGATGTGGCTGCACTGGAAAGTACATGTAGTGTTCCTCT
GTCTCAGGGATCTTCTGGGTGAGCTGTGAGGCCGGCACCTACATTCGCACACTGTGTGTG
CACCTGGGGTTGTTGCTTGGCGTCGGTGGTCAGATGCAGGAGCTTAGGAGGGTCCGCTCC
GGAGTCATGAATGAAAAGGTAGGCGGGCAGGGGCAGTGCTGAGGGGAACAAGGGAGCACC
CAGCACTCACTTTTGCCCTTGCTGGGCTTACACAGCTTCATGGCCTGCTACAGGCATGAA
CCAGAGTCTGGACTTACTTGTTCTGGTAATTAAACTTTGGGATGGTAACACATGGGCTGG
AGGAGATGATCAGGTAGAAGGTATTTCTCTATTCACTTACCTCCAGGCCTACAAAAATGC
CAGTTTAGATTGAAACAGATGAACTGTGGGGTGCAGAGGAGGGCAGATGTGGGTCTGAGG
AGACTCAAAACTGGCACGCTCAAACAAGCAGACAAGATGCCACTTGGTTGAGCAGTGGCT
GGGCAGTTTTGAGAAGGGGCACTGCTTGACACTCATCGGTGACTTTCCAGGACCACATGG
TGACCATGCATGATGTGCTCGATGCACAGTGGCTGTACGACAACCACAAGGACGAGAGCT
ACCTGCGGCGAGTCATTTTCCCCTTGGAGAAACTGCTGACGTCGCATAAGCGGCTGGTCA
TGAAGGATAGCGCGGTACAACGGGGCACCGGGTTTCTCGTGGAAGGTGGAAGTGTTTAAA
ACTTGCTTCTGTCAAACCTGAGCATACTACAGTGTTGCCCTTGGTAGAGGGACACTGGCA
CTGGTGATAGGGGTGGTATACGAAGCTGTGATTGACAGTATTTTAAGTCATCAGAGGCTT
GGGAAAGTCAGGAAGATAATAAACATTCCTTTGAAAATTGGTCTCAGTGCCGGGGAGAAT
ATGGGGTCTCAGGCACAGGCCTGGAGTCCAGTTGGATTCTGGCGCCTCATGCTCCCCCAA
AGTACTGCAGAGTGTGGCCCAGCCTCTCTGGAAAGAGAAGGTTTGTCCCATTGTCTAAGC
GAACTTCACTAAGACTCCTATAAACATGGCGCCTGAATTTCCCAGGGGTTCTGTGTTTGC
TGGACGTGCCATAAATGGTGGGTGGCTCCAGCCTTCTGGGCCTTTTGCCCACGGCCCTGA
TGCCCCTTTGTGCCATGAGGGGGTTGGCAGGCCTTATGGGGGTGCCATCTCTGCAGGTGA
ACGCCATCTGCTATGGAGCCAAGATCATGCTTCCAGGTGTTCTTCGCTATGAGGATGGCA
TCGAGGTCAATCAGGAGATCGTGGTCATTACCACCAAGGGGGAGGCCATCTGCATGGGTG
AGAGTCTCCGGCCTCCCTATGAGCCCCAGAGTGCATTCCATTCCCTGTGCAGCTGAGCCC
TGAGCCTGAGGTGGGGCGTCTGGTGAGGTGGTTCTTTCCTCTGGCTGCTGCCCCCGAGAG
AATTGGGGCCTGGGACTAGGGATCCACCTTGGGGCTGAGATTCACTGAGAGGTGCTGGCC
TGTGGCTGTGCTGCATGCCTATAATGCTGAACCGGCTTTGGGGGACTTCGTTGTTGGGGC
TTCTAAGTGCTGCTCCCCACAGTGCTAGGGTCTCATGGGGGCACATGCACTGCATGGGGG
TCGGGTGTGGGTCAGGTGGTGGATGGCCTCAGTCACTGTACAGTTGCCCCTGCCCCTCAC
TTGGTAAGTTTGGGGGCTTTTAGAGGCTTAATCCCCGCGACAAGCAATTCCTCTGCAGGC
ACGTTCTTGGCAGAAGCAGCCTCAGCTTTAAAGCTGGGGTGCTACATACATATGGGTCGG
GGCTTCACTTTGGGGGTGCAGCCTGCCTCCACAGCCATTCTCTGAACTTCCATCTACAGC
CATTGCACTCATGACCACGGCAGTGATATCTACCTGTGACCATGGCGTCGTGGCCAAGAT
CAAGCGAGTGATCATGGAGAGAGACACTTACTCTCGGAAGTGGGGCTTAGGGCCAAAGGT
TAGTGGGTCGGGTGTGTGTTGTGGGCTTTCATTTCCAGACATGTGCATGTGAGCTGTGCC
TGTGTGGGGCGGGGTGTGTTGGGGGTGTGGACTCGCTTGAGGGATGTGNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTGTGCCTGTGTGGGGCGGGGTGTGTTGGGG
GTGTGGACCCGCTTGAGGGATGTGCGCACCTGTGGGTGGTTGCCAGGGCTGTGCTGCCTG
GCCCTGCTCTCTGTGTGTGTCTGTGTGTGTGCGCGCACGCGCCTGCGGTTGCCAGGGCTA
TGCCACCTGGCCCCACTGGGATGTATGCTGCAGAGGCTGAGTTGTGGAGGCTCCACACAG
GAGCAAGCCCCCTTGAGGCGCCGCCCTGTGCGTCAACACTGCTCTTACCTTGGGACCTTA
CTGCCAGGCGAGTCAGAAGAAGCTTCTGATCAAGCAGGGGCTCTTGGATAAGCACGGCAA
GCCCACAGACAGCACTCCTGCCTCATGGACCCAGGACTACGTGGACTACAGGTGAGTCTC
GTGGGAGGGCAGGCCAAGGGCAGTGGGCCTCGCCCGCAGATGGTTATCCCTTTCTTGTCT
GGCATGGGGGACTCTAGAGGGAGTCAATCTGCAAAAACAAGTGGTAAGTTCTGCTTCTGC
CTAGCTTGTGCCTATTGGTGGCTTTAGACTTGCCAAACATGGTTGCACTGGGGGCTCCGT
GGAGCCCTCACCACTCTACTGCTTCTTCTGTTGCAGTGACTCAGGGAAGAAAGAGGCAGC
ACCCGGAGCAGTGGCAGCCCCGCCAGTGCTTCCTGGTGATGGGAAGGTCCAGAAGGTGAG
TGGCCTGGGTTTTCCTCCTGCCTGTGTGCCTGGGGGCGGTGAGGGCGGCAGCTGGCGCTG
GACTGAGCGTGGTGTCCTGGCCCTACTGCTGCGGGTCTCCCTGGCCTAGTCGGGTAGGAA
TGGGGTTGACTGGAAGCCTGACACAGTTCATCTGTCCACTTCAGCGGAAGCGCGAGAGTG
AAAGTGATGACTCCCCAGCATCTACACCAATGGTTAAAAAAGAAAAGAAGAAGAAGAAGG
ACAAGAAGGCCAGGGAAGCTGTGGAGACTGTAGAAGAGCCAGGAGATGGGGTGTGTAGGG
GCATATACAGGGCCCGTGGGCTCCCTTAGACCAGGAGGGTCCCCCAGCCCAGCCCAGAAA
CTGCTGCCCCGTTCACTGGTGTGGCTGGTAGGTGGGCAGTACGTCAGCCAGATGCAGTTT
CCCCAGGAAACCAGAAAGCTTGGGACTTTGGGGTGGGGGTGTCTCTGGGCCAAAATCCTC
TCATCCTGCCAGCCCAAGTGACTGGACATGTCCATGGCCATGCAGACCGCTGAGCATGCT
TGCTCTTCCCCCACCCCCTTAGGACAGCGATGGCGTAAAGAAGAAGAAGAAGAAGAAGAA
AATCAAAGAAGTGGTTTCCAAGTAGCGCGGACCATCCCAAGCACTGTGTCAGCTGGGAGA
AGAAACGAAAGCCTTACCGAAAACAGTTCCTTAGGTGGTTGAGGGCATGGGACCTAGGGC
CTTCTGGCACGTTCTAGCCACTGGGAGACTTTGCTGGTCAGATCTGCTGTGGCCAGCCAA
CTCCATCCTGTTTCAGGCATGGGTGGAGGAGGCACCATGTACACAGCCTCACCAGTGCCC
CTTCTTGATAAGAAGTTTTTCAAAATGAGATGATCATTGAAATGATGCGGAGCTCTCGGG
AATCCAGAGTTGGACTGGATAATGCTCCTGGGTGCGGGAAGTGCTCATCATTCTGTGAGG
AGCATGAAACCCTGTTTCCAGGCATGGATCTGAGTTGACCTAAGCTCTCTGTGCAGATCA
TTGAAGCTCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNCATTCATCTTGGGGATCTGGGAATCCAATACACCCAAGAGTATGATGGAATTGGAGTC
CTAGATCCAGAGCGCTTCACATGTGTGGGGTGTCACCACGTGGCCCAGATCCTGAGAACA
AGCTGCACCCTAGGTTGGAAGTTGAGGTTTTTCCCTTCCTGTGGCATCCCAGGGTCTCGG
CGGGTGCTTGCTCCCAGGAGAGTGGAGGAGCAGGGAGTATGAGTGGAACCATGAGTGAGG
GCTGTGTTCTAGGCACACACATGGGGCCAGCCAGGTGTACAGGTGTTCTGAAAATCCAAC
TCAAGAAGCTAGATCCAGCAGCTGGGGAATGAGGGCAGAGCTCGGCTAGTCTTTGAGGAG
GCAAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1066, 1332..1418, 2610..2668, 3871..3903, 4250..4434, 4996..5060, 5894..6020, 6127..6257, 6650..6793, 7316..7436, 7979..8097, 8587..8690, 8916..8994, 9164..9187, 9189..9191, 9194..9289, 9562..9624
1001..1066, 1332..1418, 2610..2668, 3871..3903, 4250..4434, 4996..5060, 5894..6020, 6127..6257, 6650..6793, 7316..7436, 7979..8097, 8587..8690, 8916..8994, 9164..9187, 9189..9191, 9194..9289, 9562..9621
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved